Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
July-2019 Volume 18 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2019 Volume 18 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Platelet‑rich fibrin increases the osteoprotegerin/receptor activator of nuclear factor‑κB ligand ratio in osteoblasts

  • Authors:
    • Ryuta Sumida
    • Toyonobu Maeda
    • Ichiro Kawahara
    • Junko Yusa
    • Yasumasa Kato
  • View Affiliations / Copyright

    Affiliations: Department of Oral and Maxillofacial Surgery, Ohu University School of Dentistry, Koriyama, Fukushima 963‑8611, Japan, Department of Oral Function and Molecular Biology, Ohu University School of Dentistry, Koriyama, Fukushima 963‑8611, Japan, Department of Oral Medical Sciences, Ohu University School of Dentistry, Koriyama, Fukushima 963‑8611, Japan
    Copyright: © Sumida et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 358-365
    |
    Published online on: May 8, 2019
       https://doi.org/10.3892/etm.2019.7560
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Platelet‑rich fibrin (PRF) is a platelet concentrate derived from complete autologous blood rich in growth factors in the fibrin matrix. Although PRF has been used during oral surgery to optimize wound healing in soft and hard tissue, the precise role of PRF in bone healing remains unclear. The present study assessed the role of PRF in bone remodeling. PRF was prepared from whole blood by low speed centrifugation without any anti‑coagulants. Culture of MC3T3‑E1 cells with PRF induced the expression of osteoprotegerin (OPG), but had no effect on the expression of receptor activator of nuclear factor‑κB ligand (RANKL), increasing the OPG/RANKL ratio. Expression of other osteoblastic differentiation makers, including BMP‑2 and ‑4 and RUNX2, was not affected. PRF filling of a hole defect in the mental foramen bone of rats increased OPG positivity and decreased tartrate‑resistant acid phosphatase positivity compared with unfilled control. In conclusion, PRF increased the OPG/RANKL ratio by inducing OPG expression, suggesting that PRF enhances early stage osteogenesis by optimizing osteoblastic differentiation. The present study provides a scientific basis for clinical findings showing that PRF can enhance bone regeneration such as sinus lift.

Introduction

Tissue engineering techniques are important for maxillofacial surgery. Current techniques involve combinations of cellular components, carrier/scaffold, and bioactive components. Platelets contain high intracellular concentrations of cytokines and growth factors, including platelet-derived growth factors (PDGF-AA, PDGF-BB and PDGF-AB), transforming growth factor-β (TGF-β1 and TGF-β2) and vascular endothelial growth factors (VEGFs), all of which can stimulate cell proliferation, matrix remodeling and angiogenesis (1). Following platelet aggregation, these molecules are released from intracellular pools and act to repair injured tissue. Platelets not only secrete cytokines from their cytoplasm but continue to synthesize cytokines using their mRNA reserves for at least another 7 days (2). Therefore, platelet concentrates, which are regarded as autologous alternatives to fibrin glue without anti-coagulants, contain fibrin glue rich in cytokines and are widely utilized for tissue regeneration following surgical treatment.

Platelet concentrates were originally utilized to treat haemorrhage-based severe thrombocytopenia, which is caused by medullar aplasia or acute leukaemia. Platelet concentrates, called platelet-rich plasma (PRP), have been used successfully for bone grafting in patients undergoing maxillofacial surgery (3) and for regeneration of periodontal tissue (4–6). PRP preparations are needed by subjects administered thrombin as an anti-coagulant. Some alternative preparations without anti-coagulant have been described, including platelet rich fibrin (PRF) (7) and concentrated growth factors (CGF) using a centrifuge (Medifuge) designated only for these preparations (8,9). Regardless of their methods of preparation, the resulting platelet concentrates are rich in the above-mentioned growth factors (10). Therefore, platelet concentrates, which act as a source of growth factors as well as containing a cellular scaffold, are thought to promote tissue regeneration.

Bone remodeling is maintained through a balance between bone formation and resorption (11). TGF-β and bone morphogenetic protein-2 (BMP-2) promote bone forming activity, by activating Smad1/2 and by increasing the production of type I collagen, alkaline phosphatase (ALP), and osteocalcin. The Wnt protein family also contributes to bone formation, either alone or combined with TGF-β/BMP-2 receptor signalling (12–15). Wnt signaling is initiated by its binding to its receptor, Frizzled. To date, two types of Wnt signaling pathways have been identified, the β-catenin-dependent ‘canonical’ pathway, involving, for example, Wnt3a; and the β-catenin-independent, ‘non-canonical’ pathway, involving, for example, Wnt5a (16–18). Phosphorylation of β-catenin by glycogen synthase kinase (GSK)-3β causes the former to become unstable, leading to its degradation under non-stimulating conditions. Inactivation of GSK-3β by Wnt signaling, however, stabilizes β-catenin and induces its binding to the transcription factor Lef1/Tcf, leading to osteoblastic differentiation (19).

In contrast, the differentiation and activation of osteoclasts are physiologically stimulated by osteoblasts through receptor activator of nuclear factor-κB (RANK) and its ligand RANKL (20). Because RANKL, a type II homotrimeric transmembrane protein, is expressed on the outer membrane of osteoblasts, osteoblasts play a central role in both the osteogenic and osteolytic activities of bone. Bone resorption is an important process, not only for bone remodeling but for calcium release from bone, which acts as a calcium store to maintain blood calcium concentrations. Calcium release is controlled by the RANK-RANKL system, which can be activated by an external signaling molecule such as parathyroid hormone (PTH) or 1α,25(OH)2D3, a stimulation that down-regulates the expression of osteoprotegerin (OPG). OPG is a decoy receptor for RANKL, inhibiting osteoclast differentiation and preventing excess bone resorption. Both Wnt/β-catenin and BMP-2 signaling activate Lef1/Tcf for transcription of Tnfrsf11b, the gene that encodes OPG (21). Treatment of human osteogenic sarcoma U2OS cells with PRF induced the production of OPG protein within one day, with production maintained for five 5 days, but rapidly decreasing at day 7 (22). The OPG/RANKL ratio has been reported to reflect osteoblastic differentiation status, with a high OPG/RANKL ratio resulting in a switch to osteoblast maturation (23). To date, however, the effect of PRF on OPG/RANKL ratio has not been widely accepted as a standard effect of PRF. The present study was designed to confirm that a PRF-induced increase in OPG/RANKL ratio resulted in osteoblastic differentiation of the mouse osteoblast MC3T3-E1 cell line and that PRF was involved in the healing process in a rat bone defect model. These findings confirm that PRF may play a role in bone defect/fracture healing.

Materials and methods

Cells and cell culture

The MC3T3-E1 cell line, a clonal pre-osteoblastic cell line derived from newborn mouse calvaria, was grown in α-minimum essential medium (α-MEM; ICN Pharmaceuticals, Inc.) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific), 50 µg/ml ascorbate 2-phosphate, 10 mM β-glycerophosphate, and 40 mM HEPES (pH 7.4), as described (24). Mouse NIH3T3 fibroblasts were purchased from Riken (Tsukuba) and maintained in Dulbecco's modified Eagle's medium (DMEM; Thermo Fisher Scientific) supplemented with FBS. All cells were cultured at 37°C in a humidified atmosphere containing 5% CO2 and 95% air.

Animals

Male Wistar rats, aged 8–10 weeks and weighing 400–450 g, were obtained from Clea Japan Inc., Tokyo, Japan). The rats were housed individually in a barrier facility for laboratory animals with a 12 h light-dark cycle and allowed food and water ad libitum. All surgical procedures were performed under general anesthesia with sevoflurane (Mylan; 4% for the induction and 3% for the maintenance), with local anaesthesia provided by 2% lidocaine (250 µg/kg) if necessary. Rats were sacrificed by intraperitoneal injection of over dose (120 mg/kg) of sodium pentobarbital (Kyoritsu) under general anaesthesia with sevoflurane.

All animal experiments were approved by the animal ethics committee of Ohu University (Koriyama, Japan) and done in the Animal Facility where animals were cared by the Animal Care Staff according to compliance by the ARRIVE guidelines (no. 2017-14). Number of rats used for preparation of PRF were as follows: One donor rat for a set of in vitro experiment and one donor rat for two recipient rats to treat defect. One in vivo experiment used eight rats as the recipient, which were divided into two groups: One group was used as PRF-grafted group and the other one was as the control. Thus, we minimized number of rats and used total 23 rats including repetition.

Preparation of PRF

PRF was prepared as described (7,25,26), with slight modifications. Briefly, rats were anaesthetized with sevoflurane. Whole blood (6 ml) was collected from the apex of the heart using a 23-gauge needle and BD Vacutainer® Blood Collection Tubes (Becton-Dickinson) without anti-coagulants. Immediately after collection, the blood was centrifuged at 890 × g at room temperature for 13 min. The intermediate layer was defined as PRF to be subjected to in vitro and in vivo experiments (27).

Osteoblastic differentiation and PRF treatment

We used preosteoblastic cell line MC3T3-E1 cells, which was well established model for osteoblastic differentiation, to analyze the effects of PRF on osteoblastic differentiation according to Ogino et al (27) with slight modifications. MC3T3-E1 cells that reached 70% confluence in 6-well culture plates were induced to undergo osteoblastic differentiation by the addition of 50 µg/ml ascorbate 2-phosphate and 10 mM β-glycerophosphate, as described (24), with the culture medium renewed every 2–3 days. PRF (21 µg/cm2) was placed at the center of a cell monolayer sheet and the treatment was started at the same time.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from samples with acid guanidinium thiocyanate-phenol-chloroform (AGPC) and reverse-transcribed to cDNA with a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). The resulting cDNA was PCR amplified using a GoTaq® Real-Time qPCR Kit (Bio-Rad) with specific primers (Table I) in a Thermal Cycler Dice Real Time System (TP-870; Takara). Results were normalized relative to Actb (β-actin) mRNA expression levels in the same samples.

Table I.

Primer sets.

Table I.

Primer sets.

Genes (products)Primer sequences (5′-3′)
Alpl (ALP)
  Forward GCAGTATGAATTGAATCGGAACAAC
  Reverse ATGGCCTGGTCCATCTCCAC
Runx2 (Cbfa1/Runx2)
  Forward ACTCCAGGCATACTGTACAACT
  Reverse AGGCTGTTTGACGCCATAGT
Bmp2 (Bmp-2)
  Forward TGACTGGATCGTGGCACCTC
  Reverse CAGAGTCTGCACTATGGCATGGTTA
Bmp4 (Bmp-4)
  Forward AGCCGAGCCAACACTGTGAG
  Reverse TCACTGGTCCCTGGGATGTTC
Csf1 (M-CSF)
  Forward AGTGCTCTAGCCGAGATGTG
  Reverse CTGCTAGGGGTGGCTTTAGG
Tnfsf11 (RANKL)
  Forward AGCGCAGATGGATCCTAACA
  Reverse CCAGAGTCGAGTCCTGCAAAT
Tnfrsf11b (OPG)
  Forward AGTGTGAGGAAGGGCGTTAC
  Reverse AATGTGCTGCAGTTCGTGTG
Wnt3a (Wnt3a)
  Forward CTACCCGATCTGGTGGTCCT
  Reverse ACAGAGAATGGGCTGAGTGC
Wnt5a (Wnt5a)
  Forward AAAGGGAACGAATCCACGCT
  Reverse CAGCACGTCTTGAGGCTACA
Actb (β-actin)
  Forward CATCCGTAAAGACCTCTATGCCAAC
  Reverse ATGGAGCCACCGATCCACA

[i] ALP, alkaline phosphatase; RANKL, receptor activator of NF-κB ligand; OPG, osteoprotegerin; BMP, bone morphogenetic protein.

TCF-4 binding activity

The TCF-4 binding motif was cloned by PCR and inserted into the pGL3-OT vector (Addgene #16558). Following transfection of this vector into MC3T3-E1 cells using Xfect Transfection Reagent (Takara), the cells were stimulated with PRF (0.2 g/well; 21 µg/cm2) in 6-well plates for 24 h. TCF-4 binding activity was evaluated using Dual-Luciferase Reporter Assay System (Promega). Cells were co-transfected with the pGL4.75 [hRluc (Renilla reniformis)/CMV] vector to control for transfection efficiency.

Alizarin red S (AR-S)

Mineralized matrix in culture plates was stained with AR-S as described (24). Briefly, cells were fixed in 70% ethanol for 1 h at room temperature and stained with 40 mM AR-S at pH 4.2 for 10 min at room temperature. After washing with deionized water and Ca2+- and Mg2+-free phosphate buffered saline [PBS(−)], AR-S-positivity was quantified using Molecular Imager (Bio-Rad).

Alkaline phosphatase (ALP) activity

Cells were washed twice with PBS(−) and sonicated in ice-cold 0.1 M Tris-HCl (pH 7.2) containing 0.1% Triton X-100. ALP activity was determined using a Lab Assay ALP kit (Wako), according to the Bessey-Lowry method.

Western blotting

Proteins in cell lysates (20 µg), prepared in RIPA buffer, and those in conditioned medium (CM, 10 µg), which were concentrated by acetone precipitation, were separated by sodium dodecyl sulfate (SDS)-10% polyacrylamide gel electrophoresis (PAGE) and transferred onto polyvinylidene difluoride (PVDF) membranes. The membranes were sequentially incubated with primary antibody, biotinylated anti-rabbit IgG or anti-mouse IgG (Jackson ImmunoResearch Laboratories) as secondary antibody, and horseradish peroxidase (HRP)-conjugated streptavidin (Bio-Rad). Signals were detected using Luminate™ Forte Western HRP Substrate (Merck Millipore). The primary antibodies used in this study included anti-RANKL antibody (BioLegend), anti-M-CSF antibody (Abcam), anti-OPG antibodies, and anti-β-actin antibodies (both from GeneTex).

Bone defect-healing model

A bone defect-healing model in calvaria was adapted to the mental foramen bone to assess the effects of PRF on bone regeneration (1,28–31). Briefly, following anesthetisation with 4% sevoflurane, both sides of the mental foramen bone were treated with 100 µg of lidocaine and each side was surgically drilled to make holes 2.0 mm in diameter while avoiding injury to the roots of the teeth. The bone defect was filled with PRF (doses equivalent to 0.3 g/defect area) on one side (PRF-grafted group, n=4) and without PRF on the other side (non-grafted or control group, n=4). Four days after surgery, rats were sacrificed by over dose of pentobarbital subject to histological analysis.

Histological analysis

Samples of mandibular tissue were obtained from rats under sodium pentobarbital anaesthesia and fixed in phosphate-buffered 4% paraformaldehyde (pH 7.2) at 4°C for 24 h. The samples were decalcified with 10% EDTA (pH 7.0), which was changed every 2–3 days, at 4°C for 4 weeks. The tissue samples were embedded in paraffin and sectioned. The sections were stained with haematoxylin and eosin (H&E) and then tartrate-resistant acid phosphatase (TRAP) using a commercial TRAP staining kit (Wako), according to the manufacturer's protocol.

OPG was detected by immunohistochemistry, as previously described (32–34). Specimens were blocked with 5% skim milk and incubated sequentially with anti-OPG antibodies (GeneTex), biotinylated anti-rabbit IgG (Jackson ImmunoResearch Laboratories, West Grove, PA, USA), and fluorescein isothiocyanate (FITC)-conjugated streptavidin. Signals were observed with a fluorescence microscope (Axio Observer, Carl Zeiss Microscopy GmbH).

Protein assay

Protein concentration was determined by the Bradford method, using a Bio-Rad protein assay kit, with bovine serum albumin (BSA) as the standard.

Statistical analysis

Representative results from three independent experiments (unless otherwise noted) were shown and statistical significance between two groups was evaluated by Student's t-tests. Simple regression analysis was used to compare two slopes obtained by the least squares method. A P-value <0.05 was considered statistically significant.

Results

PRF induced expression of OPG-encoding mRNA in osteoblastic cells

MC3T3-E1 cells were treated with PRF to evaluate OPG production during osteoblastic differentiation. PRF treatment gradually but significantly increased expression of Tnfrsf11b mRNA, encoding OPG, for 12 days (Fig. 1A-C). In contrast, Tnfsf11 mRNA, encoding RANKL, was constitutively expressed but not affected by treatment of cells with PRF. Expression of Csf1 mRNA, encoding M-CSF was transiently lowered in PRF treated cells on day 4, with no significant differences at later times. Western blot analysis showed that PRF strongly upregulated the expression of OPG, but not of RANKL or M-CSF, by these cells (Fig. 1D). PRF, however, did not induce expression of Tnfrsf11b mRNA in non-osteoblastic NIH3T3 fibroblasts (Fig. 1E), although non-osteoblastic cells, such as gingival fibroblasts (35), adipocytes (36), and endothelial cells (37), can produce OPG. PRF also increased the ratio of OPG-encoding mRNA to RANKL-encoding mRNA in these cells (Fig. 2).

Figure 1.

PRF suppresses osteoclast-differentiation factor expression in MC3T3-E1 cells. MC3T3-E1 cells were cultured in the absence or presence of PRF for 6 days. Total RNA was extracted and the expression of (A) Tnfrsf11b, (B) Tnfsf11 and (C) Csf1 mRNAs was determined by reverse transcription-quantitative PCR. (D) The amount of RANKL in whole-cell lysates and of MCSF and OPG in concentrated CM was assayed by western blotting. (E) PRF did not affect Tnfrsf11b mRNA expression by NIH3T3 cells. Representative results were from three independent experiments. Data are presented as the mean ± standard error (n=3). *P<0.05, **P<0.01 and ***P<0.001 vs. samples incubated in the absence of PRF at each time point. PRF, platelet rich fibrin; CM, conditioned medium; OPG, osteoprotegerin; M-CSF, macrophage colony-stimulating factor; RANKL, receptor activator of NF-κB ligand.

Figure 2.

Effect of PRF on OPG/RANKL ratio. MC3T3-E1 cells were cultured in the absence or presence of PRF for 6 days. Total RNA was extracted and the expression of Tnfrsf11b and Tnfsf11 mRNAs was determined by reverse transcription-quantitative PCR. Cq values of Tnfrsf11b and Tnfsf11 mRNAs were normalized relative to that of Actb mRNA in the same samples to calculate OPG/RANKL ratios. Representative results were from three independent experiments. *P<0.05. PRF, platelet rich fibrin; OPG, osteoprotegerin; RANKL, receptor activator of NF-κB ligand.

PRF did not affect the expression of other osteoblastic marker encoding genes and mineralization in vitro

Treatment of MC3T3-E1 cells with PRF did not induce formation of nodules resulting from mineral deposition (Fig. 3A). PRF reduced ALP mRNA level on day 4, with low ALP mRNA level maintained through day 8, although ALP mRNA level was higher on day 8 than on day 4 (Fig. 3B). ALP activity was also lower in the presence than in the absence of PRF on day 8 (Fig. 3C), ALP activity in PRF-treated cells was higher on day 8 than on day 4, whereas ALP activity in control cells was higher on day 4 than on day 8, suggesting that PRF regulates bone regeneration by delaying the peak of osteoblast differentiation. The expression of other osteoblastic marker genes, encoding Runx2, BMP2, and BMP4, were not affected by PRF treatment (Fig. 3D-F).

Figure 3.

PRF does not affect in vitro mineralization or osteoblastic differentiation for mineralization. Cells were treated with (+) or without (−) PRF for 24 days. (A) Calcification determined by AR-S staining. (B) Total RNA was extracted, reverse-transcribed and amplified by qPCR with primer sets for Alpl mRNA. (C) Samples from whole-cell extracts were assayed using an ALP kit. Time course of the effect of PRF on expression of (D) Runx2, (E) Bmp2 and (F) Bmp4 mRNAs, as determined by reverse transcription-quantitative PCR. Cells were treated with or without PRF for the time periods indicated. Representative results were from two independent experiments. Data are presented as the mean ± standard error (n=3). **P<0.01 and ***P<0.001 vs. samples incubated in the absence of PRF at each time point. PRF, platelet rich fibrin; AR-S, alizarin red S; ALP, alkaline phosphatase; CM, conditioned medium; OPG, osteoprotegerin; M-CSF, macrophage colony-stimulating factor; RANKL, receptor activator of NF-κB ligand.

In assessing the effect of PRF on Wnt signaling which plays a role in OPG expression, we found that PRF had no effect on the expression of Wnt3a and Wnt5a (Fig. 4A and B). In addition, PRF did not significantly activate the transcription of β-catenin from a TCF-4 binding motif containing a reporter vector (Fig. 4C). These findings suggested that the Wnt pathway is not involved in the induction of Tnfrsf11b mRNA in MC3T3-E1 cells.

Figure 4.

PRF does not affect Wnt signaling. Total RNA was extracted and the levels of expression of (A) Wnt3a and (B) Wnt5a mRNAs were determined by reverse transcription-quantitative PCR. (C) TCF-4 activity in the presence of PRF was assessed by measuring luciferase activity after transfection of the luciferase vector linked to the TCF-4 binding motif (pGL3-OT) into MC3T3-E1 cells. Data are presented as the mean ± standard error (n=3). Representative results were from two independent experiments. No significant differences were observed by Student's t-tests. PRF, platelet rich fibrin; NS, not significant.

PRF increases the number of OPG producing cells but reduces the number of active osteoclasts

To determine whether PRF mediates OPG induction and osteoclastogenesis in vivo, a bone defect-healing model in calvaria was adapted for use in mental foramen bone. A bone defect area 2.7 mm in diameter treated with a low-level laser was reported filled with calcium (~180 mg/g-tissue) and phosphorus (~115 mg/g-tissue) within 2 weeks (28). Both values were 1.4 times higher than in control, non-laser treated, bone. After an additional 2 weeks, these increases in calcium and phosphorus deposition were 1.3- and 1.2-fold higher than in control, respectively, suggesting that early stage bone repair process, within 2 weeks after surgery, was extremely important. Therefore, we created a small defect (2.0 mm in diameter) and observed early stage regeneration. After 4 days, OPG-positive cells were 2.7-fold more abundant in the PRF-engrafted than in the control region (Fig. 5A). Conversely, PRF grafting decreased TRAP positivity to 41.7% of that observed in the control region (Fig. 5B). Taken together, these findings indicate that an elevation in OPG/RANKL ratio may be critical during early stage osteoblastic differentiation.

Figure 5.

PRF increases the number of OPG-positive cells and reduces the number of TRAP-positive in vivo in bone healing regions. Immunohistochemical staining for (A) OPG and (B) number of OPG positive cells. (C) TRAP staining and (D) number of TRAP-positive cells. Arrows indicate TRAP positive cells; scale bars, 10 µm. Representative results were from two independent experiments. Data are presented as the mean ± standard error (n=4). *P<0.05 vs. no PRF treatment. PRF, platelet rich fibrin; OPG, osteoprotegerin; TRAP, tartrate-resistant acid phosphatase.

Discussion

Fibrin acts as a scaffold for cells during wound repair (38,39). Insertion of PRF as the sole filling material was found to promote bone regeneration and subsequent sinus elevation (40). Moreover, the combination of PRF and a demineralized freeze-dried bone allograft (DFDBA) accelerated bone formation; although DFDBA-induced maturation required about 8 months, the addition of PRF shortened bone formation to 4 months (41). PRF has been reported to accelerate bone healing both in vivo and in vitro (8,42,43). The ability of platelet concentrate clots to gradually release PDGFs, TGF-β, IGF-1, and FGF-2 (44) enables them to assist in bone healing in the defect/fracture region, similar to the activity of PRF.

More preclinical and clinical studies have evaluated PRP than PRF, with most studies of PRP showing its benefits for bone repair, although several have reported that PRP has low or limited impact on osteogenesis in bone defect repair (45,46). These discrepancies may be explained by differences among PRP preparations in components and/or their ratios, including differences not only in growth factors but platelets and leukocytes (47,48). Even studies reporting that PRP does not affect bone healing activity did not find that PRP had negative effects on bone healing. Using MC3T3-E1 cell line, which has been widely used as a model for osteoblastic differentiation (14,49,50), here we showed that ALP expression/activity was lower in PRF-treated than in control cells, in which medium contained ascorbate 2-phosphate and β-glycerophosphate, but no other osteogenic inducers. Because ALP activity is high in mature osteoblasts, PRF did not inhibit osteoblastic differentiation, but rather may have optimized osteoblastic differentiation. Thus, the low ALP mRNA/activity in response to PRF treatment suggests that PRF regulated ALP expression by delaying it, thereby optimizing bone remodeling to an osteogenic state during the early stages of osteoblastic differentiation in our culture system. Indeed, ALP expression/activity gradually increased during the time in culture.

The present study found that OPG was the only molecule induced by PRF stimulation. Many studies have focused on OPG/RANKL ratio and bone resorption, but few have linked these findings to osteoblastic differentiation (51). OPG/RANKL ratio has been reported: Low in immature osteoblasts and high in mature osteoblasts (23,52), suggesting that the PRF-induced increase in OPG/RANKL ratio is associated with bone formation. Our results also showed that PRF affected OPG production, leading to a high OPG/RANKL ratio, suggesting that autologous platelet concentrates may be suitable to balance bone formation (53–55). PRF-induced OPG production by an osteosarcoma cell line was found to peak within 1 day, remaining high up to day 3 and decreasing to baseline level by day 5, while RANKL production remained steady (22). Although our OPG induction peak differed slightly, the two studies, taken together, indicate that PRF-induced increases in OPG/RANKL ratio occur during early stage osteoblastic differentiation, similar to the effects of genestein on early stage osteoblastic differentiation (51).

Clinically, PRF, combined with other materials, has been used in surgical repairs (47,56). Because we found that PRF did not induce markers of osteogenic differentiation, such as Runx2, Bmp2, or Bmp4 mRNAs, in vitro, PRF may play a role during the early stages in vivo to optimize osteoblastic differentiation towards an osteogenic state by inducing OPG production. Similarly, the OPG/RANKL ratio in osteoblastic differentiation was reported to be associated with bone formation during the remodeling process (57).

This study could not determine which factors in PRF are responsible for the induction of OPG. Since OPG expression in osteoblasts was reported to be induced by BMP-2, TGF-β, and PDGF (57,58), it is reasonable to assume that these factors, either alone or in combination in PRF, induce OPG expression. Reverse signaling of RANKL stimulated by RANK was recently reported (59). Although osteoblasts in OPG-deficient mice did not show reduced osteogenic activity (60), studies are needed to elucidate the role of OPG in RANKL-induced reverse signaling during the bone healing process in bone defect/fracture models.

In conclusion, our results showed that PRF increased the OPG/RANKL ratio by inducing OPG production, suggesting that PRF assists in early stage osteogenesis by optimizing osteoblastic differentiation. Because PRF aids in earlier and better wound healing (61). PRF has advantages in patients undergoing oral surgery, such as sinus lift.

Acknowledgements

The authors would like to thank Dr Keiko Kasai (Jusendo Hospital, Koriyama, Japan) for technical assistance and Dr Satoshi Takada, Dr Hirosi Ito and Dr Yoko Sakurai (Ohu University, Koriyama, Japan) for their critical comments. This work was based on a PhD thesis (Ryuta Sumida), which was published by Ohu University Press (Koriyama, Japan) in 2018.

Funding

This work was supported by JSPS KAKENHI (grant no. JP16K11517).

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

YK conceived the study and planned the experiments. RS performed all experiments. IK and JY assisted in the animal experiments, and reviewed the manuscript critically for important intellectual content. RS, TM and YK analysed and interpreted the data, and wrote the manuscript.

Ethics approval and consent to participate

All animal experiments were approved by the Animal Ethics Committee of Ohu University (Koriyama, Japan; no. 2017-14).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Dohan DM, Choukroun J, Diss A, Dohan SL, Dohan AJ, Mouhyi J and Gogly B: Platelet-rich fibrin (PRF): A second-generation platelet concentrate. Part II: Platelet-related biologic features. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 101:e45–e50. 2006. View Article : Google Scholar : PubMed/NCBI

2 

Senzel L, Gnatenko DV and Bahou WF: The platelet proteome. Curr Opin Hematol. 16:329–333. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Whitman DH, Berry RL and Green DM: Platelet gel: An autologous alternative to fibrin glue with applications in oral and maxillofacial surgery. J Oral Maxillofac Surg. 55:1294–1299. 1997. View Article : Google Scholar : PubMed/NCBI

4 

Vaishnavi C, Mohan B and Narayanan LL: Treatment of endodontically induced periapical lesions using hydroxyapatite, platelet-rich plasma, and a combination of both: An in vivo study. J Conserv Dent. 14:140–146. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Gupta C, Mehrotra D, Mohammad S, Khanna V, Kumar Singh G, Singh G, Chellappa AA and Passi D: Alveolar bone graft with platelet rich plasma in cleft alveolus. J Oral Biol Craniofac Res. 3:3–8. 2013. View Article : Google Scholar : PubMed/NCBI

6 

Kawase T: Platelet-rich plasma and its derivatives as promising bioactive materials for regenerative medicine: Basic principles and concepts underlying recent advances. Odontology. 103:126–135. 2015. View Article : Google Scholar : PubMed/NCBI

7 

Dohan DM, Choukroun J, Diss A, Dohan SL, Dohan AJ, Mouhyi J and Gogly B: Platelet-rich fibrin (PRF): A second-generation platelet concentrate. Part I: Technological concepts and evolution. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 101:e37–e44. 2006. View Article : Google Scholar : PubMed/NCBI

8 

Rodella LF, Favero G, Boninsegna R, Buffoli B, Labanca M, Scari G, Sacco L, Batani T and Rezzani R: Growth factors, CD34 positive cells, and fibrin network analysis in concentrated growth factors fraction. Microsc Res Tech. 74:772–777. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Durmuşlar MC, Balli U, Dede FÖ, Misir AF, Bariş E, Kürkçü M and Kahraman SA: Histological evaluation of the effect of concentrated growth factor on bone healing. J Craniofac Surg. 27:1494–1497. 2016. View Article : Google Scholar : PubMed/NCBI

10 

Su CY, Kuo YP, Tseng YH, Su CH and Burnouf T: In vitro release of growth factors from platelet-rich fibrin (PRF): A proposal to optimize the clinical applications of PRF. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 108:56–61. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Raggatt LJ and Partridge NC: Cellular and molecular mechanisms of bone remodeling. J Biol Chem. 285:25103–25108. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Franceschi RT and Iyer BS: Relationship between collagen synthesis and expression of the osteoblast phenotype in MC3T3-E1 cells. J Bone Miner Res. 7:235–246. 1992. View Article : Google Scholar : PubMed/NCBI

13 

Spelsberg TC, Subramaniam M, Riggs BL and Khosla S: The actions and interactions of sex steroids and growth factors/cytokines on the skeleton. Mol Endocrinol. 13:819–828. 1999. View Article : Google Scholar : PubMed/NCBI

14 

Maeda T, Matsunuma A, Kawane T and Horiuchi N: Simvastatin promotes osteoblast differentiation and mineralization in MC3T3-E1 cells. Biochem Biophys Res Commun. 280:874–877. 2001. View Article : Google Scholar : PubMed/NCBI

15 

Wu M, Chen G and Li YP: TGF-β and BMP signaling in osteoblast, skeletal development, and bone formation, homeostasis and disease. Bone Res. 4:160092016. View Article : Google Scholar : PubMed/NCBI

16 

Sparks AB, Morin PJ, Vogelstein B and Kinzler KW: Mutational analysis of the APC/beta-catenin/Tcf pathway in colorectal cancer. Cancer Res. 58:1130–1134. 1998.PubMed/NCBI

17 

Dejmek J, Säfholm A, Kamp Nielsen C, Andersson T and Leandersson K: Wnt-5a/Ca2+-induced NFAT activity is counteracted by Wnt-5a/Yes-Cdc42-casein kinase 1alpha signaling in human mammary epithelial cells. Mol Cell Biol. 26:6024–6036. 2006. View Article : Google Scholar : PubMed/NCBI

18 

Lin SS, Ueng SW, Niu CC, Yuan LJ, Yang CY, Chen WJ, Lee MS and Chen JK: Hyperbaric oxygen promotes osteogenic differentiation of bone marrow stromal cells by regulating Wnt3a/β-catenin signaling-an in vitro and in vivo study. Stem Cell Res. 12:260–274. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Krause U, Harris S, Green A, Ylostalo J, Zeitouni S, Lee N and Gregory CA: Pharmaceutical modulation of canonical Wnt signaling in multipotent stromal cells for improved osteoinductive therapy. Proc Natl Acad Sci USA. 107:4147–4152. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Anderson DM, Maraskovsky E, Billingsley WL, Dougall WC, Tometsko ME, Roux ER, Teepe MC, DuBose RF, Cosman D and Galibert L: A homologue of the TNF receptor and its ligand enhance T-cell growth and dendritic-cell function. Nature. 390:175–179. 1997. View Article : Google Scholar : PubMed/NCBI

21 

Sato MM, Nakashima A, Nashimoto M, Yawaka Y and Tamura M: Bone morphogenetic protein-2 enhances Wnt/beta-catenin signaling-induced osteoprotegerin expression. Genes Cells. 14:141–153. 2009. View Article : Google Scholar : PubMed/NCBI

22 

Chang IC, Tsai CH and Chang YC: Platelet-rich fibrin modulates the expression of extracellular signal-regulated protein kinase and osteoprotegerin in human osteoblasts. J Biomed Mater Res A. 95:327–332. 2010. View Article : Google Scholar : PubMed/NCBI

23 

Rogers A, Saleh G, Hannon RA, Greenfield D and Eastell R: Circulating estradiol and osteoprotegerin as determinants of bone turnover and bone density in postmenopausal women. J Clin Endocrinol Metab. 87:4470–4475. 2002. View Article : Google Scholar : PubMed/NCBI

24 

Maeda T, Suzuki A, Yuzawa S, Baba Y, Kimura Y and Kato Y: Mineral trioxide aggregate induces osteoblastogenesis via Atf6. Bone Rep. 2:36–43. 2015. View Article : Google Scholar : PubMed/NCBI

25 

Kim TH, Kim SH, Sándor GK and Kim YD: Comparison of platelet-rich plasma (PRP), platelet-rich fibrin (PRF), and concentrated growth factor (CGF) in rabbit-skull defect healing. Arch Oral Biol. 59:550–558. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Fukui N, Ueno T, Ito Y, Takahashi Y, Kimura Y, Nakajima Y, Kasuya S, Kanou M, Takubo K, Yamamoto K, et al: Quantification of growth factors in platelet-rich Fibrin: A preliminary study. J Hard Tissue Biol. 24:231–234. 2015. View Article : Google Scholar

27 

Ogino Y, Ayukawa Y, Kukita T, Atsuta I and Koyano K: Platelet-rich plasma suppresses osteoclastogenesis by promoting the secretion of osteoprotegerin. J Periodontal Res. 44:217–224. 2009. View Article : Google Scholar : PubMed/NCBI

28 

Khadra M, Kasem N, Haanaes HR, Ellingsen JE and Lyngstadaas SP: Enhancement of bone formation in rat calvarial bone defects using low-level laser therapy. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 97:693–700. 2004. View Article : Google Scholar : PubMed/NCBI

29 

Choukroun J, Diss A, Simonpieri A, Girard MO, Schoeffler C, Dohan SL, Dohan AJ, Mouhyi J and Dohan DM: Platelet-rich fibrin (PRF): A second-generation platelet concentrate. Part IV: Clinical effects on tissue healing. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 101:e56–e60. 2006. View Article : Google Scholar : PubMed/NCBI

30 

Pripatnanont P, Nuntanaranont T, Vongvatcharanon S and Phurisat K: The primacy of platelet-rich fibrin on bone regeneration of various grafts in rabbit's calvarial defects. J Craniomaxillofac Surg. 41:e191–e200. 2013. View Article : Google Scholar : PubMed/NCBI

31 

Yamazaki T, Tetsuya K and Yokose S: Histological demonstration of bone healing in rat tibiae influenced by diode laser irradiation. J Japan Soc Laser Surg Med. 37:80–86. 2016.

32 

Simonet WS, Lacey DL, Dunstan CR, Kelley M, Chang MS, Lüthy R, Nguyen HQ, Wooden S, Bennett L, Boone T, et al: Osteoprotegerin: A novel secreted protein involved in the regulation of bone density. Cell. 89:309–319. 1997. View Article : Google Scholar : PubMed/NCBI

33 

Yasuda H, Shima N, Nakagawa N, Yamaguchi K, Kinosaki M, Mochizuki S, Tomoyasu A, Yano K, Goto M, Murakami A, et al: Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesis-inhibitory factor and is identical to TRANCE/RANKL. Proc Natl Acad Sci USA. 95:3597–3602. 1998. View Article : Google Scholar : PubMed/NCBI

34 

Yang X, Wang Y, Han X, Shu R, Chen T, Zeng H, Xu X, Huang L, Ren A, Song J, et al: Effects of TGF-β1 on OPG/RANKL expression of cementoblasts and osteoblasts are similar without stress but different with mechanical compressive stress. Scientific World Journal. 2015:7181802015. View Article : Google Scholar : PubMed/NCBI

35 

Baek KJ, Choi Y and Ji S: Gingival fibroblasts from periodontitis patients exhibit inflammatory characteristics in vitro. Arch Oral Biol. 58:1282–1292. 2013. View Article : Google Scholar : PubMed/NCBI

36 

Gautam J, Khedgikar V, Choudhary D, Kushwaha P, Dixit P, Singh D, Maurya R and Trivedi R: An isoflavone cladrin prevents high-fat diet-induced bone loss and inhibits the expression of adipogenic gene regulators in 3T3-L1 adipocyte. J Pharm Pharmacol. 68:1051–1063. 2016. View Article : Google Scholar : PubMed/NCBI

37 

Songia P, Branchetti E, Parolari A, Myasoedova V, Ferrari G, Alamanni F, Tremoli E and Poggio P: Mitral valve endothelial cells secrete osteoprotegerin during endothelial mesenchymal transition. J Mol Cell Cardiol. 98:48–57. 2016. View Article : Google Scholar : PubMed/NCBI

38 

Sahni A and Francis CW: Vascular endothelial growth factor binds to fibrinogen and fibrin and stimulates endothelial cell proliferation. Blood. 96:3772–3778. 2000.PubMed/NCBI

39 

van Hinsbergh VW, Collen A and Koolwijk P: Role of fibrin matrix in angiogenesis. Ann NY Acad Sci. 936:426–437. 2001. View Article : Google Scholar : PubMed/NCBI

40 

Tajima N, Ohba S, Sawase T and Asahina I: Evaluation of sinus floor augmentation with simultaneous implant placement using platelet-rich fibrin as sole grafting material. Int J Oral Maxillofac Implants. 28:77–83. 2013. View Article : Google Scholar : PubMed/NCBI

41 

Choukroun J, Diss A, Simonpieri A, Girard MO, Schoeffler C, Dohan SL, Dohan AJ, Mouhyi J and Dohan DM: Platelet-rich fibrin (PRF): A second-generation platelet concentrate. Part V: Histologic evaluations of PRF effects on bone allograft maturation in sinus lift. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 101:299–303. 2006. View Article : Google Scholar : PubMed/NCBI

42 

Takeda Y, Katsutoshi K, Matsuzaka K and Inoue T: The effect of concentrated growth factor on rat bone marrow cells in vitro and on calvarial bone healing in vivo. Int J Oral Maxillofac Implants. 30:1187–1196. 2015. View Article : Google Scholar : PubMed/NCBI

43 

Litvinov RI and Weisel JW: What is the biological and clinical relevance of fibrin? Semin Thromb Hemost. 42:333–343. 2016. View Article : Google Scholar : PubMed/NCBI

44 

Marx RE, Carlson ER, Eichstaedt RM, Schimmele SR, Strauss JE and Georgeff KR: Platelet-rich plasma: Growth factor enhancement for bone grafts. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 85:638–646. 1998. View Article : Google Scholar : PubMed/NCBI

45 

Plachokova AS, Nikolidakis D, Mulder J, Jansen JA and Creugers NH: Effect of platelet-rich plasma on bone regeneration in dentistry: A systematic review. Clin Oral Implants Res. 19:539–545. 2008. View Article : Google Scholar : PubMed/NCBI

46 

Roffi A, Di Matteo B, Krishnakumar GS, Kon E and Filardo G: Platelet-rich plasma for the treatment of bone defects: From pre-clinical rational to evidence in the clinical practice. A systematic review. Int Orthop. 41:221–237. 2017. View Article : Google Scholar : PubMed/NCBI

47 

Broggini N, Hofstetter W, Hunziker E, Bosshardt DD, Bornstein MM, Seto I, Weibrich G and Buser D: The influence of PRP on early bone formation in membrane protected defects. A histological and histomorphometric study in the rabbit calvaria. Clin Implant Dent Relat Res. 13:1–12. 2011. View Article : Google Scholar : PubMed/NCBI

48 

Simonpieri A, Del Corso M, Vervelle A, Jimbo R, Inchingolo F, Sammartino G and Dohan Ehrenfest DM: Current knowledge and perspectives for the use of platelet-rich plasma (PRP) and platelet-rich fibrin (PRF) in oral and maxillofacial surgery part 2: Bone graft, implant and reconstructive surgery. Curr Pharm Biotechnol. 13:1231–1256. 2012. View Article : Google Scholar : PubMed/NCBI

49 

Quarles LD, Yohay DA, Lever LW, Caton R and Wenstrup RJ: Distinct proliferative and differentiated stages of murine MC3T3-E1 cells in culture: An in vitro model of osteoblast development. J Bone Miner Res. 7:683–692. 1992. View Article : Google Scholar : PubMed/NCBI

50 

Li F, Yang Y, Zhu P, Chen W, Qi D, Shi X, Zhang C, Yang Z and Li P: Echinacoside promotes bone regeneration by increasing OPG/RANKL ratio in MC3T3-E1 cells. Fitoterapia. 83:1443–1450. 2012. View Article : Google Scholar : PubMed/NCBI

51 

Chen X, Garner SC, Quarles LD and Anderson JJ: Effects of genistein on expression of bone markers during MC3T3-E1 osteoblastic cell differentiation. J Nutr Biochem. 14:342–349. 2003. View Article : Google Scholar : PubMed/NCBI

52 

Gori F, Hofbauer LC, Dunstan CR, Spelsberg TC, Khosla S and Riggs BL: The expression of osteoprotegerin and RANK ligand and the support of osteoclast formation by stromal-osteoblast lineage cells is developmentally regulated. Endocrinology. 141:4768–4776. 2000. View Article : Google Scholar : PubMed/NCBI

53 

Clark RA: Fibrin and wound healing. Ann NY Acad Sci. 936:355–367. 2001. View Article : Google Scholar : PubMed/NCBI

54 

Intini G: The use of platelet-rich plasma in bone reconstruction therapy. Biomaterials. 30:4956–4966. 2009. View Article : Google Scholar : PubMed/NCBI

55 

Anitua E, Andia I, Ardanza B, Nurden P and Nurden AT: Autologous platelets as a source of proteins for healing and tissue regeneration. Thromb Haemost. 91:4–15. 2004. View Article : Google Scholar : PubMed/NCBI

56 

Marques LF, Stessuk T, Camargo IC, Sabeh Junior N, dos Santos L and Ribeiro-Paes JT: Platelet-rich plasma (PRP): Methodological aspects and clinical applications. Platelets. 26:101–113. 2015. View Article : Google Scholar : PubMed/NCBI

57 

Silva I and Branco JC: Rank/Rankl/opg: Literature review. Acta Reumatol Port. 36:209–218. 2011.PubMed/NCBI

58 

McCarthy HS, Williams JH, Davie MW and Marshall MJ: Platelet-derived growth factor stimulates osteoprotegerin production in osteoblastic cells. J Cell Physiol. 218:350–354. 2009. View Article : Google Scholar : PubMed/NCBI

59 

Ikebuchi Y, Aoki S, Honma M, Hayashi M, Sugamori Y, Khan M, Kariya Y, Kato G, Tabata Y, Penninger JM, et al: Coupling of bone resorption and formation by RANKL reverse signalling. Nature. 561:195–200. 2018. View Article : Google Scholar : PubMed/NCBI

60 

Fei Q, Guo C, Xu X, Gao J, Zhang J, Chen T and Cui D: Osteogenic growth peptide enhances the proliferation of bone marrow mesenchymal stem cells from osteoprotegerin-deficient mice by CDK2/cyclin A. Acta Biochim Biophys Sin (Shanghai). 42:801–806. 2010. View Article : Google Scholar : PubMed/NCBI

61 

Kapse S, Surana S, Satish M, Hussain SE, Vyas S and Thakur D: Autologous platelet-rich fibrin: Can it secure a better healing? Oral Surg Oral Med Oral Pathol Oral Radiol. 127:8–18. 2019. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Sumida R, Maeda T, Kawahara I, Yusa J and Kato Y: Platelet‑rich fibrin increases the osteoprotegerin/receptor activator of nuclear factor‑κB ligand ratio in osteoblasts. Exp Ther Med 18: 358-365, 2019.
APA
Sumida, R., Maeda, T., Kawahara, I., Yusa, J., & Kato, Y. (2019). Platelet‑rich fibrin increases the osteoprotegerin/receptor activator of nuclear factor‑κB ligand ratio in osteoblasts. Experimental and Therapeutic Medicine, 18, 358-365. https://doi.org/10.3892/etm.2019.7560
MLA
Sumida, R., Maeda, T., Kawahara, I., Yusa, J., Kato, Y."Platelet‑rich fibrin increases the osteoprotegerin/receptor activator of nuclear factor‑κB ligand ratio in osteoblasts". Experimental and Therapeutic Medicine 18.1 (2019): 358-365.
Chicago
Sumida, R., Maeda, T., Kawahara, I., Yusa, J., Kato, Y."Platelet‑rich fibrin increases the osteoprotegerin/receptor activator of nuclear factor‑κB ligand ratio in osteoblasts". Experimental and Therapeutic Medicine 18, no. 1 (2019): 358-365. https://doi.org/10.3892/etm.2019.7560
Copy and paste a formatted citation
x
Spandidos Publications style
Sumida R, Maeda T, Kawahara I, Yusa J and Kato Y: Platelet‑rich fibrin increases the osteoprotegerin/receptor activator of nuclear factor‑κB ligand ratio in osteoblasts. Exp Ther Med 18: 358-365, 2019.
APA
Sumida, R., Maeda, T., Kawahara, I., Yusa, J., & Kato, Y. (2019). Platelet‑rich fibrin increases the osteoprotegerin/receptor activator of nuclear factor‑κB ligand ratio in osteoblasts. Experimental and Therapeutic Medicine, 18, 358-365. https://doi.org/10.3892/etm.2019.7560
MLA
Sumida, R., Maeda, T., Kawahara, I., Yusa, J., Kato, Y."Platelet‑rich fibrin increases the osteoprotegerin/receptor activator of nuclear factor‑κB ligand ratio in osteoblasts". Experimental and Therapeutic Medicine 18.1 (2019): 358-365.
Chicago
Sumida, R., Maeda, T., Kawahara, I., Yusa, J., Kato, Y."Platelet‑rich fibrin increases the osteoprotegerin/receptor activator of nuclear factor‑κB ligand ratio in osteoblasts". Experimental and Therapeutic Medicine 18, no. 1 (2019): 358-365. https://doi.org/10.3892/etm.2019.7560
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team