Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
October-2021 Volume 22 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2021 Volume 22 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Fumaric acid and succinic acid treat gestational hypertension by downregulating the expression of KCNMB1 and TET1

  • Authors:
    • Yiyuan Zhou
    • Fang Zhang
    • Huijiao Jiang
    • Di Xu
    • Dongyang Deng
  • View Affiliations / Copyright

    Affiliations: Department of Obstetrics, The First Affliated Hospital of Guizhou University of Traditional Chinese Medicine, Guiyang, Guizhou 550001, P.R. China
    Copyright: © Zhou et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 1072
    |
    Published online on: July 28, 2021
       https://doi.org/10.3892/etm.2021.10506
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The present study hypothesized that fumaric acid and succinic acid may exhibit therapeutic effects on gestational hypertension. During pregnancy, estrogen upregulates ten‑eleven translocation 1 (TET1) expression, which subsequently increases calcium‑activated potassium channel subunit β1 (KCNMB1) expression. KCNMB1 is associated with hypertension. Fumaric acid and succinic acid are understood to inhibit TET. Therefore, the present study investigated whether fumaric acid and succinic acid exhibit therapeutic effects on gestational hypertension and whether these effects are mediated by TET1 and KCNMB1. Nω‑Nitro‑L‑arginine methyl ester hydrochloride was injected into rats to establish a gestational hypertension model. Dimethyl fumarate (DMF) and succinic acid were administrated into rats to treat gestational hypertension. Rats were divided into five groups: i) Control; ii) model; iii) DMF; iv) succinic acid; and v) DMF + succinic acid. Blood pressure was monitored by a noninvasive meter and urinary protein was determined using a urinary protein kit. Placenta pathology was examined by hematoxylin‑eosin staining. Compared with the control group, urinary protein and blood pressure in the model group increased significantly. The placental cells in the control group were arranged orderly. However, in the model group, decidual cellular edema of placenta and vacuolar degeneration were observed, and the intervascular membrane was markedly thicker with plenty of fibrin deposition. These results indicate successful establishment of a gestational hypertension model. However, compared with the model group, urinary protein, blood pressure, edema, vacuoles and fibrin deposition were markedly reduced in the DMF, succinic acid and DMF + succinic acid groups. mRNA and protein levels of TET1 and KCNMB1 in placenta were evaluated by immunohistochemical analysis, reverse transcription‑quantitative polymerase chain reaction and western blotting. The TET1 and KCNMB1 levels in the model group were markedly increased compared with those in the control group. However, compared with the model group, the expression levels were markedly downregulated in the DMF, succinic acid and DMF + succinic acid groups. In conclusion, fumaric acid and succinic acid may treat gestational hypertension by downregulating the expression of KCNMB1 and TET1.

Introduction

Gestational hypertension is a common obstetric disease, occurring in 5-10% of pregnancies (1). Maternal death induced by gestational hypertension accounts for 10-16% of all pregnancy-associated mortalities and gestational hypertension is the second leading cause of maternal death in China (1). Hypertension, proteinuria and edema are the main symptoms of this condition. Gestational hypertension may be induced by maternal, placental and fetal factors, such as abnormal invasion of trophoblasts, abnormal immune regulation, endothelial cell damage, genetic factors and nutritional factors (2). No single factor can explain the complex etiology and mechanism of gestational hypertension (3). In the treatment of gestational hypertension, blood pressure must be lowered and severe preeclampsia and eclampsia must be prevented (4).

Metoprolol succinate is a selective β1 receptor blocker. The dose required for its action on cardiac β1 receptors is lower than that required for its action on peripheral blood vessels and bronchi β2 receptors (5). Metoprolol succinate doesn't activate β receptors on membranes. Metoprolol succinate can attenuate the effect of catecholamines associated with physiological and psychological loads, and reduce the heart rate, cardiac output and blood pressure (5). Bisoprolol fumarate is also a highly selective β1 adrenoceptor antagonist, without intrinsic sympathomimetic and membrane stabilization activities. Bisoprolol fumarate has a high affinity for β1 receptors of bronchi and vascular smooth muscle, which leads to vasodilation and lower blood pressure (5). Metoprolol succinate and bisoprolol fumarate are widely used in the treatment of hypertension (5). In addition, during pregnancy, estrogen upregulates ten-eleven translocation 1 (TET1) expression in uterine arteries, which activates demethylation and subsequently increases calcium-activated potassium channel subunit β1 (KCNMB1) expression (6). KCNMB1 is associated with hypertension (7). Fumaric acid and succinic acid are known to inhibit TET (8). Therefore, the present study hypothesized that fumaric acid and succinic acid may exhibit therapeutic effects on gestational hypertension, and the present study was performed for preliminary confirmation.

The TET1 gene is a research hotspot at present for its special role in DNA methylation (9). TET1 is a hydroxymethylase, originally discovered as a fusion protein of histone H3K4 methyltransferase (10). TET1 can bind to the CpG region in the genome, which hinders catalytic activity of DNA methyltransferase and activates gene transcription (11). In addition, TET1 can recruit polycomb repressive complex 2 to the promoter region of a target gene, which ultimately suppressed the expression of the target gene (12). The TET protein family participates in the whole embryonic development process. When TET1 and TET3 are knocked-out at the same time, the transcriptome diversity increases during early embryonic development (13). Growth defects, increased mortality and developmental retardation are identified in the offspring of paternal mice following TET1-knockdown (14). BKCa channels are involved in the regulation of cellular functions, including neurotransmitter release, hormone secretion, heart rate, vascular stress resistance and smooth muscle tension, for their multiple regulatory characteristics. BKCa is composed of an ion-mediated α subunit and different β subunits. The β1 subunit is predominantly expressed in smooth muscle cells and it affects the behavior of these cells (15). Mutations in the KCNMBl gene encoding the β1 subunit are associated with heart rate variability and baroreflex function (16). Variation of the KCNMBl gene loci decreases arterial impedance (17). KCNMBl may serve an important role in the development and progression of hypertension (18).

Therefore, the present study established a rat gestational hypertension model and investigated whether fumaric acid and succinic acid exhibit therapeutic effects on gestational hypertension and whether these effects are mediated by TET1 and KCNMBl.

Materials and methods

Materials and animals

Nω-Nitro-L-arginine methyl ester hydrochloride (L-NAME; cat. no. 51298-65.5) and dimethyl fumarate (DMF; cat. no. C1821194) were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. Succinic acid (cat. no. ZN1113EA14) was obtained from Shanghai Yuanye Bio-Technology Co., Ltd. The rat urinary protein kit (cat. no. CO35-2) was obtained from Nanjing Jiancheng Bioengineering Institute. The bicinchoninic acid (BCA) kit (cat. no. CW0014), diaminobenzidine (DAB) kit (cat. no. CW0125), TRIzol reagent (cat. no. CW0580), Ultrapure RNA extraction kit (cat. no. CW0581), HiFiScript cDNA synthesis kit (cat. no. CW2569) and ULtraSYBR Mixture (cat. no. CW0957) were purchased from CoWin Biosciences Co., Ltd. (CWBIO). RIPA lysis buffer (cat. no. C1053) was purchased from Applygen Technologies, Inc. SuperSignal® west pico chemiluminescent substrate (cat. no. RJ239676) was obtained from Thermo Fisher Scientific, Inc. The polyvinylidene fluoride (PVDF) membrane (cat. no. IPVH00010) was obtained from EMD Millipore. Mouse anti-GAPDH monoclonal antibody (cat. no. TA-08; 1:2,000), horseradish peroxidase (HRP) conjugated goat anti-mouse IgG (H+L) (cat. no. ZB-2305; 1:2,000) and HRP conjugated goat anti-rabbit IgG (H+L) (cat. no. ZB-2301; 1:2,000) were purchased from OriGene Technologies, Inc. Rabbit anti-TET1 polyclonal antibody (cat. no. DF6428; 1:500) and rabbit anti-KCNMB1 polyclonal antibody (cat. no. DF-9301; 1:1,000) were purchased from Affinity Biosciences. Rabbit anti-KCNMB1 polyclonal antibody (cat, no. bs-7689R; 1:1,000) was obtained from BIOSS.

In total, 35 female (three months-old, 250-280 g) and 20 male (three months-old, 400-500 g) Sprague-Dawley rats were obtained from the Hunan SJA Laboratory Animal Co., Ltd. [license no. SCXK(Xiang)2016-0002]. All rats were provided with free access to food and water and kept in conditions of 22-25˚C under a 12-h light/dark cycle. During the experimental phase, animal well-being was monitored by individual ventilated caging system (SmartRack, BioZone). Unpregnant rats and male rats after mating was completed and the fetuses after birth were fed normally and sacrificed at the end of the whole experiment. The experiments did not affect normal activity and eating behavior of rats. Rats were sacrificed after anesthesia. The study protocol was reviewed and approved by the Ethics Committee of the First Affiliated Hospital of Guiyang University of Chinese Medicine.

Gestational hypertension model establishment

Overnight, female and male rats were placed in a cage at a ratio of 2:1 to induce pregnancy. Formation of vaginal plug was observed the next morning. A total of 30 female rats were impregnated. Rats with vaginal plug were immediately placed in separate cages and day 0 of pregnancy was record. Blood pressure was measured on day 9 of pregnancy using a constant temperature noninvasive blood pressure meter (XH200; Beijing Zhongshidichuang Co., Ltd.). The rats were then randomly grouped (n=6). Drugs were administrated by gavage at 10 ml/kg q.o.d, from day 10 of pregnancy to the birth of the fetus. Concentrations of DMF and succinic acid were 2.5 and 40 mg/ml, respectively. Rats in the control and model groups were not treated with drugs. Subcutaneous injection of L-NAME into the back was performed continuously at 125 mg/kg q.o.d. for 5 days from day 14 of pregnancy to induce gestational hypertension. Blood pressure was measured again on day 19 of pregnancy. Finally, rats were anesthetized by intraperitoneal injection of 10% chloral hydrate at 350 mg/kg. No signs of peritonitis were observed. Urine was collected by abdominal compression and punctio vesicae. After the fetus was born, rats were sacrificed by cervical dislocation and the placenta was collected. The urine and a portion of the placenta were stored at -80˚C. Another portion of the placenta was fixed in 4% paraformaldehyde at room temperature for 24 h and stored at room temperature.

Experimental grouping

A total of 30 pregnant rats were divided into five groups (n=6): i) Control; ii) model; iii) DMF; iv) succinic acid; and v) DMF + succinic acid. Rats without any treatment served as the control group. Rats in the model group received L-NAME injection but did not receive any drug treatment. Rats that had gestational hypertension and were treated with DMF were assigned as the DMF group. Rats that had gestational hypertension and were treated with succinic acid were assigned as the succinic acid group. Rats that had gestational hypertension and were treated with both DMF and succinic acid were assigned as the DMF + succinic acid group. In the DMF + succinic acid group, the doses of the two drugs were halved.

Urinary protein determination

Urinary protein was determined using a urinary protein kit, according to the manufacturer's protocol. Briefly, 50 µl water, protein standard solution (563 mg/l) and the urine sample were added into a blank well, standard well and test well, respectively. Coomassie brilliant blue solution (3 ml) was added into each well, followed by mixing. After 5 min, the absorbance (optical density value) was measured at 595 nm using a microplate reader (RT-6100; Rayto Life and Analytical Sciences Co., Ltd.).

Hematoxylin and eosin (H&E) staining

Tissues were fixed in 4% paraformaldehyde at room temperature, washed with running water, dehydrated in 70, 80 and 90% ethanol solution, immersed in an equivalent mixture of absolute ethanol and xylene for 15 min, and transparentized in xylene twice for 15 min each time until transparency. After immersing in an equivalent mixture of xylene and paraffin for 15 min and then in paraffin twice for 50-60 min each time, the tissues were embedded in paraffin and cut into slices, 4-µm thick. Subsequently, the slices were baked, dewaxed, hydrated and then stained with hematoxylin solution for 3 min. Sections were then differentiated in alcoholic hydrochloric acid for 15 sec, washed slightly, blued in bluing buffer for 15 sec, washed with running water, stained in eosin solution at room temperature for 3 min. After staining sections were washed with running water, dehydrated, transparentized, mounted with neutral resin and examined under a light microscope (CKX41; Olympus Corporation).

Immunohistochemical analysis

Tissue slices were prepared as mentioned above and baked at 65˚C for 2 h, immersed in xylene twice for 10 min each, and successively incubated in 100, 100, 95 and 80% ethanol and water for 5 min each time. Subsequently, the slices were incubated in citrate buffer and heated for 2 min in a high-pressure cooker. The slices were then cooled naturally, rinsed with PBS, incubated in fresh 3% hydrogen peroxide at room temperature for 10 min and washed with PBS. After the excess PBS was absorbed by absorbent papers, 5% bovine serum albumin (Beijing Solarbio Science & Technology, Co., Ltd.) was added dropwise onto the slices, which were then incubated at 37˚C for 30 min. After excess blocking buffer was absorbed by absorbent papers, the slices were incubated with primary antibody buffer (rabbit anti-TET1 polyclonal antibody, rabbit anti-KCNMB1 polyclonal antibody) at 4˚C overnight. Following washing with PBS three times, sections were incubated with the secondary antibody buffer (horseradish peroxidase-conjugated goat anti-rabbit IgG) at 37˚C for 30 min. Then sections were rinsed with PBS, developed for 5-10 min using a DAB kit, rinsed with PBS, stained in hematoxylin solution at room temperature for 3 min. Alcoholic hydrochloric acid was used to differentiate and after that sections were blued in bluing buffer, rinsed with water, dehydrated, transparentized, mounted and examined under a light microscope (CKX41; Olympus Corporation).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Tissue RNA was extracted using TRIzol reagent and RT to cDNA was conducted at 42˚C using the HiFiScript cDNA synthesis kit according to their manufacturer's protocol. Table I presents the primer sequences. The PCR reaction was composed of 1 µl cDNA/DNA, 1 µl forward primer, 1 µl reverse primer, 12.5 µl ULtraSYBR Mixture and 9.5 µl RNase free dH2O. Reaction parameters included pre-denaturation at 95˚C for 10 min, denaturation at 95˚C for 10 sec, annealing at 58.5˚C for 30 sec, elongation at 72˚C for 30 sec (40 cycles). Analysis parameters of the dissociation curve included 15 sec at 95˚C, 1 min at 58.5˚C, 15 sec at 95˚C, 15 sec at 58.5˚C and 15 sec at 58.5˚C, and measured stepwise from 95˚C, every 0.5˚C. Products were examined using a RT-qPCR detection system (CFX Connect™; Bio-Rad Laboratories, Inc.). GAPDH served as an internal control. Relative levels of genes were calculated using a 2-ΔΔCq method (19).

Table I

The sequences of primers.

Table I

The sequences of primers.

PrimersSequences (5'-3')Product length (bp)
TET1F: AAACGGAAGTCAAAACCCC140
 R: CCGAAGAGCCATTGTAAACC 
KCNMB1F: AACATCAAGGACCAGGAAGAG129
 R: TTGGTTTTGATCCCGAGTG 
GAPDHF: GCAAGTTCAACGGCACAG141
 R: CGCCAGTAGACTCCACGAC 

[i] TET1, ten-eleven translocation 1; KCNMB1, calcium-activated potassium channel subunit β; F, forward; R, reverse.

Western blotting

Tissues were lysed in RIPA lysis buffer at 4˚C for 30 min and then centrifuged at 9,000 x g and 4˚C for 10 min. The supernatant was collected carefully to obtain total protein. Protein concentration was determined using a BCA kit. Subsequently, the protein (24 µg) was denatured and separated by 12% SDS-PAGE for 1-2 h. The protein was transferred to a PVDF membrane by a wet method for 30-50 min, which was then blocked with 3% skimmed milk at room temperature for 1 h and incubated with primary antibody buffer at 4˚C overnight. After washing, the membrane was incubated with secondary antibody buffer at room temperature for 1-2 h, incubated with chemiluminescent substrate and examined on a gel imaging system (ChemiDoc™ XRS+; Bio-Rad Laboratories, Inc.). Gray values were analyzed using Quantity One software (v4.62; Bio-Rad Laboratories, Inc.). GAPDH served as an internal control.

Statistical analysis

Data are presented as the mean ± standard deviation. Every experiment was repeated three times. Data were statistically analyzed using one-way analysis of variance followed by Tukey's post-hoc test with SPSS 19.0 software (IBM, Corp.). P<0.05 was considered to indicate a statistically significant difference.

Results

Establishment of a gestational hypertension model

Fig. 1 presents urinary protein (Fig. 1A), blood pressure (Fig. 1B) and H&E staining images of the placenta (Fig. 1C) in the control and model rats. Compared with the control rats, urinary protein and blood pressure in the model rats increased significantly (P<0.05; Fig. 1A and B). As presented in Fig. 1C, placental cells in the control rats were arranged in an orderly fashion. However, in the model rats, decidual cellular edema of the placenta and vacuolar degeneration were observed, and the intervascular membrane was obviously thicker with a large amount of fibrin deposition. These results indicate that the gestational hypertension model was successfully established.

Figure 1

Characterization of gestational hypertension model. (A) Urinary protein, (B) blood pressure and (C) hematoxylin and eosin staining images of the placenta in the control and model rats. *P<0.05 vs. the control.

Urinary protein and blood pressure

Fig. 2 presents the urinary protein (Fig. 2A) and blood pressure (Fig. 2B) of rats in various groups. Compared with the control group, urinary protein and blood pressure in the model group increased significantly (P<0.05). However, compared with the model group, urinary protein and blood pressure in the DMF, succinic acid and DMF + succinic acid groups decreased significantly (P<0.05).

Figure 2

Urinary protein and blood pressure after drug treatment. (A) Urinary protein and (B) blood pressure of rats in the control, model, DMF, succinic acid and DMF + succinic acid groups. *P<0.05 vs. the control; #P<0.05 vs. the model. DMF, dimethyl fumarate.

H&E staining

Fig. 3 presents H&E staining images of the placenta in the rats of various groups. Placental cells were arranged in an orderly manner in the control group. However, decidual cellular edema of the placenta, vacuolar degeneration, thicker intervascular membranes and a large amount of fibrin deposition were identified in the model group. Notably, compared with the model group, the edema, vacuoles and fibrin deposition were markedly reduced in the DMF, succinic acid and DMF + succinic acid groups.

Figure 3

Hematoxylin and eosin staining images of placenta in the rats of the control, model, DMF, succinic acid and DMF + succinic acid groups. DMF, dimethyl fumarate.

Levels of TET1 and KCNMB1

mRNA and protein levels of TET1 and KCNMB1 in the placenta of various groups were examined by immunohistochemical analysis (Fig. 4A), RT-qPCR (Fig. 4B) and western blotting (Fig. 4C). The protein of interest is brown in the immunohistochemical images. Immunohistochemical analysis, RT-qPCR and western blot demonstrated similar results. The levels of TET1 and KCNMB1 were significantly increased in the model groups compared with the control group (P<0.05). However, compared with the model group, their levels were significantly downregulated in the DMF, succinic acid and DMF + succinic acid groups (P<0.05).

Figure 4

mRNA and protein levels of TET1 and KCNMB1 in the placenta of the control, model, DMF, succinic acid and DMF + succinic acid groups, which were examined by (A) immunohistochemical analysis, (B) reverse transcription-quantitative PCR and (C) western blotting. The protein of interest is brown in the immunohistochemical images. *P<0.05 vs. control; #P<0.05 vs. model. DMF, dimethyl fumarate; TET1, ten-eleven translocation 1; KCNMB1, calcium-activated potassium channel subunit β.

Discussion

At present, therapies for gestational hypertension are far from satisfactory. Establishment of an animal model provides a good basis for the investigation of treatments due to the relatively short gestation period in animals. However, the short gestation period and requirement of reserving enough time to treat the disease makes it difficult to establish a model. In the present study, a gestational hypertension model was established by subcutaneous injection of L-NAME. Results of urinary protein and blood pressure measurements demonstrated that urinary protein and blood pressure increased in the model rats. Furthermore, pathological examinations revealed the decidual cellular edema of the placenta, vacuolar degeneration, thicker intervascular membranes and a large amount of fibrin deposition in the model rats. These results confirmed the successful establishment of a gestational hypertension model. L-NAME is an inhibitor of nitric oxide (NO) synthase and can effectively inhibit NO synthesis. NO is an important active substance in maintaining homeostasis in humans and animals. A previous study reported that the NO level in pregnancy is higher than that in the normal state and inhibition of NO synthesis will lead to elevated blood pressure, proteinuria and symptoms of preeclampsia (20). The results of the present study agreed with this previous study. Elevated blood pressure may be a result of an enhanced response of the vascular system in pregnant rats to angiotensin E and norepinephrine by inhibiting NO synthesis (21).

The present study identified that urinary protein and blood pressure decreased, and placental cells in pregnant rats were improved during gestational hypertension when fumaric acid and succinic acid were administrated. These results suggest that fumaric acid and succinic acid exerted therapeutic effects on gestational hypertension. Non-toxic side effects of fumaric acid and succinic acid in rats are well recognized in previous reports (22,23); therefore, the present study did not perform experiments to confirm their non-toxic side effects in normal non-pregnant female rats.

The TET protein family participates in the whole embryonic development process. When TET1 and TET3 are knocked-out at the same time, the transcriptome diversity increases during early embryonic development (13). Growth defects, increased mortality and developmental retardation are identified in the offspring of paternal mice following TET1-knockout (14). TET1 expression is upregulated during fetal growth, suggesting that TET1 gene may regulate early fetal growth (24). Numerous studies have reported that KCNMB1 reduces the probability of a BKCa channel being open and instantaneous outward potassium current, which weakens the negative feedback inhibitory effect of the BKCa channel and consequently leads to depolarization of the cell membrane, contraction of vascular smooth muscle and elevation of blood pressure (18,25). Correlation analysis between KCNMB1 mutation and hypertension demonstrated that KCNMB1 mutation results in increased sensitivity of the BK channel to calcium ions, which makes blood vessels easier to relax (26). Therefore, the KCNMB1 channel has a negative feedback effect on the contraction of vascular smooth muscle (26). During pregnancy, estrogen upregulates TET1 expression in uterine arteries, which activates demethylation and subsequently increases KCNMB1 expression (6). KCNMB1 is associated with hypertension (7). The present results revealed that expression levels of TET1 and KCNMB1 increase during gestational hypertension. This is consistent with the aforementioned reports that TET1 expression is elevated during pregnancy and also suggests that KCNMB1 is associated with hypertension. Fumaric acid and succinic acid are known to inhibit TET (8). In the present study, the expression of TET1 and KCNMB1 decreased following the administration of fumaric acid and succinic acid, suggesting that fumaric acid and succinic acid downregulate the expression of TET1 and KCNMB1.

The absence of histological scoring data was a limitation of the current study. In future studies, promoters or inhibitors will be used to investigate the regulatory relationship between KCNMB1 and TET1 in the treatment of gestational hypertension by fumaric acid and succinic acid, and detect some other preeclampsia-related marker genes/proteins. Additionally, in the present study there were no significant differences for all results between the three treatment groups. This may be due to dosage or other reasons. In the DMF + succinic acid group, the doses of the two drugs were halved, respectively. The reasons underlying the non-significant differences between the three treatment groups is uncertain and requires further experiments to clarify; therefore this will be an aim of future studies.

In conclusion, fumaric acid and succinic acid may treat gestational hypertension by downregulating the expression of KCNMB1 and TET1. Although this requires further confirmation by larger-scale experiments and clinical trials, these results may offer interesting and effective knowledge for the development of drugs to treat gestational hypertension.

Acknowledgements

Not applicable.

Funding

Funding: The present study was supported by the Guizhou Provincial Science and Technology Foundation [grant no. QianKeHeLHZi(2016)7510].

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

YZ and DD designed the study, analyzed the data and wrote the paper. YZ, FZ, HJ, DX and DD performed the study and collected data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The study protocol was reviewed and approved by the Ethics Committee of the First Affiliated Hospital of Guiyang University of Chinese Medicine.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Wang YA, Chughtai AA, Farquhar CM, Pollock W, Lui K and Sullivan EA: Increased incidence of gestational hypertension and preeclampsia after assisted reproductive technology treatment. Fertil Steril. 105:920–926.e2. 2016.PubMed/NCBI View Article : Google Scholar

2 

Egeland GM, Klungsøyr K, Øyen N, Tell GS, Næss Ø and Skjærven R: Preconception cardiovascular risk factor differences between gestational hypertension and preeclampsia: Cohort Norway study. Hypertension. 67:1173–1180. 2016.PubMed/NCBI View Article : Google Scholar

3 

Hua X, Zhang J, Guo Y, Shen M, Gaudet L, Janoudi G, Walker M and Wen SW: Effect of folic acid supplementation during pregnancy on gestational hypertension/preeclampsia: A systematic review and meta-analysis. Hypertens Pregnancy. 35:447–460. 2016.PubMed/NCBI View Article : Google Scholar

4 

Hromadnikova I, Kotlabova K, Hympanova L and Krofta L: Gestational hypertension, preeclampsia and intrauterine growth restriction induce dysregulation of cardiovascular and cerebrovascular disease associated microRNAs in maternal whole peripheral blood. Thromb Res. 137:126–140. 2016.PubMed/NCBI View Article : Google Scholar

5 

Ripley TL and Saseen JJ: β-blockers: A review of their pharmacological and physiological diversity in hypertension. Ann Pharmacother. 48:723–733. 2014.PubMed/NCBI View Article : Google Scholar

6 

Hu XQ, Dasgupta C, Chen M, Xiao D, Huang X, Han L, Yang S, Xu Z and Zhang L: Pregnancy reprograms large-conductance Ca2+-activated K+ channel in uterine arteries: Roles of ten-eleven translocation methylcytosine dioxygenase 1-mediated active demethylation. Hypertension. 69:1181–1191. 2017.PubMed/NCBI View Article : Google Scholar

7 

Han YY, Wang LJ, Zhang L, Zhang WW, Ma KT, Li L and Si JQ: Association between potassium channel SNPs and essential hypertension in Xinjiang Kazak Chinese patients. Exp Ther Med. 14:1999–2006. 2017.PubMed/NCBI View Article : Google Scholar

8 

Laukka T, Mariani CJ, Ihantola T, Cao JZ, Hokkanen J, Kaelin WG Jr, Godley LA and Koivunen P: Fumarate and succinate regulate expression of hypoxia-inducible genes via TET enzymes. J Biol Chem. 291:4256–4265. 2016.PubMed/NCBI View Article : Google Scholar

9 

Wiehle L, Raddatz G, Musch T, Dawlaty MM, Jaenisch R, Lyko F and Breiling A: Tet1 and Tet2 protect DNA methylation canyons against hypermethylation. Mol Cell Biol. 36:452–461. 2015.PubMed/NCBI View Article : Google Scholar

10 

Choudhury SR, Cui Y, Lubecka K, Stefanska B and Irudayaraj J: CRISPR-dCas9 mediated TET1 targeting for selective DNA demethylation at BRCA1 promoter. Oncotarget. 7:46545–46556. 2016.PubMed/NCBI View Article : Google Scholar

11 

Thomson JP, Ottaviano R, Unterberger EB, Lempiäinen H, Muller A, Terranova R, Illingworth RS, Webb S, Kerr AR, Lyall MJ, et al: Loss of Tet1 associated 5-hydroxymethylcytosine is concomitant with aberrant promoter hypermethylation in liver cancer. Cancer Res. 76:3097–3108. 2016.PubMed/NCBI View Article : Google Scholar

12 

Somineni HK, Zhang X, Biagini Myers JM, Kovacic MB, Ulm A, Jurcak N, Ryan PH, Khurana Hershey GK and Ji H: Ten-eleven translocation 1 (TET1) methylation is associated with childhood asthma and traffic-related air pollution. J Allergy Clin Immunol. 137:797–805.e5. 2016.PubMed/NCBI View Article : Google Scholar

13 

Zhu X, Girardo D, Govek EE, John K, Mellén M, Tamayo P, Mesirov JP and Hatten ME: Role of Tet1/3 genes and chromatin remodeling genes in cerebellar circuit formation. Neuron. 89:100–112. 2016.PubMed/NCBI View Article : Google Scholar

14 

Pei YF, Tao R, Li JF, Su LP, Yu BQ, Wu XY, Yan M, Gu QL, Zhu ZG and Liu BY: TET1 inhibits gastric cancer growth and metastasis by PTEN demethylation and re-expression. Oncotarget. 7:31322–31335. 2016.PubMed/NCBI View Article : Google Scholar

15 

Du C, Zheng Z, Li D, Chen L, Li N, Yi X, Yang Y, Guo F, Liu W, Xie X, et al: BKCa promotes growth and metastasis of prostate cancer through facilitating the coupling between αvβ3 integrin and FAK. Oncotarget. 7:40174–40188. 2016.PubMed/NCBI View Article : Google Scholar

16 

Friedman D, Kannan K, Faustin A, Shroff S, Thomas C, Heguy A, Serrano J, Snuderl M and Devinsky O: Cardiac arrhythmia and neuroexcitability gene variants in resected brain tissue from patients with sudden unexpected death in epilepsy (SUDEP). NPJ Genom Med. 3(9)2018.PubMed/NCBI View Article : Google Scholar

17 

Díaz-Villamarín X, Dávila-Fajardo CL, Gónzalez-Medina MD, Soto-Pino MJ, Sánche-Gómez E, Acuña A, Gómez-Martín A, Martínez-González LJ, Casas-Hidalgo I and Cabeza-Barrera J: PKP-022 The KCNMB1 (A >G) (RS703505) genetic variant and the efficacy of tocilizumab in rheumatoid arthritis patients. Eur J Hosp Pharm Sci Pract. 23 (Suppl 1)(A188)2016.

18 

Hu XQ, Chen M, Dasgupta C, Xiao D, Huang X, Yang S and Zhang L: Chronic hypoxia upregulates DNA methyltransferase and represses large conductance Ca2+-activated K+ channel function in ovine uterine arteries. Biol Reprod. 96:424–434. 2017.PubMed/NCBI View Article : Google Scholar

19 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-ΔΔC(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

20 

Jin S, Teng X, Xiao L, Xue H, Guo Q, Duan X, Chen Y and Wu Y: Hydrogen sulfide ameliorated L-NAME-induced hypertensive heart disease by the Akt/eNOS/NO pathway. Exp Biol Med (Maywood). 242:1831–1841. 2017.PubMed/NCBI View Article : Google Scholar

21 

Bogodvid TK, Andrianov VV, Muranova LN and Gainutdinov KL: Influence of nonspecific inhibitor of NO-synthase L-NAME on electric characteristics of premotor interneurons of terrestrial snails. Bionanoscience. 8:884–887. 2018.

22 

Godbole SS, Kaul R, D'Souza SF and Nadkarni GB: Immobilization of fumarase by entrapment of rat liver mitochondria in polyacrylamide gel using gamma rays. Biotechnol Bioeng. 25:217–224. 1983.PubMed/NCBI View Article : Google Scholar

23 

Kirchgessner M, Roth FX, Tschierschwitz A and Grassmann E: Nutritive effect of fumaric acid on growth and body composition of rats. Z Tierphysiol Tierernähr Futtermittelkd. 47:175–186. 1982.PubMed/NCBI(In German).

24 

Kang J, Lienhard M, Pastor WA, Chawla A, Novotny M, Tsagaratou A, Lasken RS, Thompson EC, Surani MA, Koralov SB, et al: Simultaneous deletion of the methylcytosine oxidases Tet1 and Tet3 increases transcriptome variability in early embryogenesis. Proc Natl Acad Sci USA. 112:E4236–E4245. 2015.PubMed/NCBI View Article : Google Scholar

25 

Yang GX, Fu HJ, Liu TW, Li JL, Shen Y and Qian J: Effects of atorvastatin on VSMC apoptosis in rabbits with atherosclerosis and its molecular mechanism. Chin J Arterioscler. 25:463–466. 2017.

26 

Wang LJ, Zhang WW, Qian YF, Zhang L, Zhao L, Ma KT, Li L and Si JQ: Association between KCNMB1 polymorphism and essential hypertension in Xinjiang Kazak population. J Xian Jiaotong Univ. 37:78–81. 2016.

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhou Y, Zhang F, Jiang H, Xu D and Deng D: Fumaric acid and succinic acid treat gestational hypertension by downregulating the expression of KCNMB1 and TET1. Exp Ther Med 22: 1072, 2021.
APA
Zhou, Y., Zhang, F., Jiang, H., Xu, D., & Deng, D. (2021). Fumaric acid and succinic acid treat gestational hypertension by downregulating the expression of KCNMB1 and TET1. Experimental and Therapeutic Medicine, 22, 1072. https://doi.org/10.3892/etm.2021.10506
MLA
Zhou, Y., Zhang, F., Jiang, H., Xu, D., Deng, D."Fumaric acid and succinic acid treat gestational hypertension by downregulating the expression of KCNMB1 and TET1". Experimental and Therapeutic Medicine 22.4 (2021): 1072.
Chicago
Zhou, Y., Zhang, F., Jiang, H., Xu, D., Deng, D."Fumaric acid and succinic acid treat gestational hypertension by downregulating the expression of KCNMB1 and TET1". Experimental and Therapeutic Medicine 22, no. 4 (2021): 1072. https://doi.org/10.3892/etm.2021.10506
Copy and paste a formatted citation
x
Spandidos Publications style
Zhou Y, Zhang F, Jiang H, Xu D and Deng D: Fumaric acid and succinic acid treat gestational hypertension by downregulating the expression of KCNMB1 and TET1. Exp Ther Med 22: 1072, 2021.
APA
Zhou, Y., Zhang, F., Jiang, H., Xu, D., & Deng, D. (2021). Fumaric acid and succinic acid treat gestational hypertension by downregulating the expression of KCNMB1 and TET1. Experimental and Therapeutic Medicine, 22, 1072. https://doi.org/10.3892/etm.2021.10506
MLA
Zhou, Y., Zhang, F., Jiang, H., Xu, D., Deng, D."Fumaric acid and succinic acid treat gestational hypertension by downregulating the expression of KCNMB1 and TET1". Experimental and Therapeutic Medicine 22.4 (2021): 1072.
Chicago
Zhou, Y., Zhang, F., Jiang, H., Xu, D., Deng, D."Fumaric acid and succinic acid treat gestational hypertension by downregulating the expression of KCNMB1 and TET1". Experimental and Therapeutic Medicine 22, no. 4 (2021): 1072. https://doi.org/10.3892/etm.2021.10506
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team