Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
November-2021 Volume 22 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2021 Volume 22 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Autophagy is involved in neurofibromatosis type I gene‑modulated osteogenic differentiation in human bone mesenchymal stem cells

  • Authors:
    • Yiqiang Li
    • Mingwei Zhu
    • Xuemei Lin
    • Jingchun Li
    • Zhe Yuan
    • Yanhan Liu
    • Hongwen Xu
  • View Affiliations / Copyright

    Affiliations: Department of Pediatric Orthopedics, Guangzhou Women and Children's Medical Center, Guangzhou Medical University, Guangzhou, Guangdong 510623, P.R. China
    Copyright: © Li et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 1262
    |
    Published online on: September 6, 2021
       https://doi.org/10.3892/etm.2021.10697
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Neurofibromatosis type I (NF1) is an autosomal dominant genetic disease that is caused by mutations in the NF1 gene. Various studies have previously demonstrated that the mTOR complex 1 signaling pathway is essential for the NF1‑modulated osteogenic differentiation of bone mesenchymal stem cells (BMSCs). Additionally, the mTOR signaling pathway plays a notable role in autophagy. The present study hypothesized that NF1 could modulate the osteogenic differentiation of BMSCs by regulating the autophagic activities of BMSCs. In the present study, human BMSCs were cultured in an osteogenic induction medium. The expression of the NF1 gene was either knocked down or overexpressed by transfection with a specific small interfering RNA (siRNA) targeting NF1 or the pcDNA3.0 NF1‑overexpression plasmid, respectively. Autophagic activities of BMSCs (Beclin‑1, P62, LC3B I, and LC3B II) were determined using western blotting, electron microscopy, acridine orange (AO) staining and autophagic flux/lysosomal detection by fluorescence microscopy. In addition, the autophagy activator rapamycin (RAPA) and inhibitor 3‑methyladenine (3‑MA) were used to investigate the effects of autophagy on NF1‑modulated osteogenic differentiation in BMSCs. Inhibiting NF1 with siRNA significantly decreased the expression levels of autophagy markers Beclin‑1 and LC3B‑II, in addition to osteogenic differentiation markers osterix, runt‑related transcription factor 2 and alkaline phosphatase. By contrast, overexpressing NF1 with pcDNA3.0 significantly increased their levels. Transmission electron microscopy, AO staining and autophagic flux/lysosomal detection assays revealed that the extent of autophagosome formation was significantly decreased in the NF1‑siRNA group but significantly increased in the NF1‑pcDNA3.0 group when compared with the NC‑siRNA and pcDNA3.0 groups, respectively. In addition, the activity of the PI3K/AKT/mTOR pathway [phosphorylated (p)‑PI3K, p‑AKT, p‑mTOR and p‑p70S6 kinase] was significantly upregulated in the NF1‑siRNA group compared with the NC‑siRNA group, and significantly inhibited in the NF1‑pcDNA3.0 group, compared with the pcDNA3.0 group. The knockdown effects of NF1‑siRNA on the autophagy and osteogenic differentiation of BMSCs were reversed by the autophagy activator RAPA, while the overexpression effects of NF1‑pcDNA3.0 on the autophagy and osteogenic differentiation of BMSCs were reversed by the autophagy inhibitor 3‑MA. In conclusion, results from the present study suggest at the involvement of autophagy in the NF1‑modulated osteogenic differentiation of BMSCs. Furthermore, NF1 may partially regulate the autophagic activity of BMSCs through the PI3K/AKT/mTOR signaling pathway.

Introduction

Neurofibromatosis type I (NF1) is an autosomal dominant genetic disorder caused by mutations in the NF1 gene (1-3). The reported incidence of NF1 varies from 1/2,500 to 1/3,500 individuals worldwide (1-3). The clinical manifestations of NF1 are varied and include cafe-au-lait spots, hamartomas of the iris and skeletal abnormalities (2,4). It has been reported that 50% patients with NF1 have associated skeletal abnormalities, including long bone dysplasia, sphenoid wing dysplasia, scoliosis and congenital pseudarthrosis of the tibia (5,6).

Although mutations in the neurofibromin (NF1) gene are considered to be the primary cause of the occurrence of NF1 (1,7), the mechanism underlying the formation of skeletal abnormalities associated with NF1 is still not fully understood. The NF1 gene encodes a Ras GTPase that consists of 2,818 amino acids (1). Mutations in NF1 lead to the functional deficiency of neurofibromin and hyperactivation of p21-Ras (1,7). In addition, NF1 has been documented to regulate bone mesenchymal stem cell, neuronal, and glial cell proliferation, differentiation and survival (1).

Previous studies have demonstrated the existence of significantly impaired osteogenic differentiation in human bone mesenchymal stem cells (BMSCs) in patients with NF1-associated skeletal abnormalities (8,9). Furthermore, abnormal osteoblast differentiation and proliferation have been reported to occur due to the loss of NF1 function (10-12). A previous study showed that the NF1 gene can modulate the proliferation and osteogenic differentiation of BMSCs (13). In addition, it has been demonstrated that inhibiting the expression of NF1 can activate mTOR complex 1 (mTORC1) signaling and subsequently inhibit the osteogenic differentiation of BMSCs (13).

Autophagy is an evolutionarily conserved adaptive response that takes part in numerous physiological and pathological processes (14). Previous studies have reported that autophagy serves an important role in the osteogenic differentiation of BMSCs (15,16). The PI3K/AKT/mTOR pathway is an important signaling pathway that is involved in the regulation of signal transduction and biological processes, such as cell proliferation, differentiation, apoptosis, metabolism and angiogenesis (17). The PI3K/AKT/mTOR pathway is also considered to be a classical signaling pathway for autophagy activation (18), such that mTORC1 is the main gatekeeper to autophagy that connects environmental cues to metabolic processes in order to preserve cellular homoeostasis (19). In a recent study, Tan et al (20) revealed that overexpression of NF1 gene enhanced the osteogenic differentiation of BMSCs by promoting autophagy and that mTORC1 signaling was involved in this process. However, this previous study only established NF1-overexpression BMSC models, which is different from the clinical situation in patients with NF1, where the function of the NF1 gene is typically insufficient (20). Therefore, a cell model with the inhibited expression of NF1 would simulate the pathological conditions of NF1 more closely compared with one modeling the overexpression of NF1.

The present study established cell models of BMSCs that with reduced NF1 expression or overexpressed NF1, similar to the protocol followed in a previous study (13). To investigate the effect of autophagy on the osteogenic differentiation of BMSCs, a classical autophagy inhibitor 3-methyladenine (3-MA) and a specific mTOR inhibitor rapamycin (RAPA), were used. The aims of the present study were as follows: i) To evaluate the effect of NF1 on the autophagy of BMSCs; ii) to investigate the effect of autophagy on NF1-modulated osteogenic differentiation of BMSCs; and iii) to verify the effect of the PI3K/AKT/mTOR signaling pathway on NF1-mediated regulation of BMSC autophagy.

Materials and methods

Culture of human BMSCs

BMSCs were purchased from the American Type Culture Collection (cat. no. CRL-3421). They were cultured in Human Bone Marrow Mesenchymal Stem Cell Basal Medium (Cyagen Biosciences, Inc.) supplemented with 10% qualified FBS (Takara Bio, Inc.), 10% glutamine and 10% penicillin-streptomycin at 37˚C in a humidified atmosphere with 5% CO2 for 14 days (13). The standard procedure to induce osteogenic differentiation of BMSCs is by culturing cells in Human Mesenchymal Stem Cell Osteogenic Differentiation Basal Medium (Cyagen Biosciences, Inc.) containing 10% FBS (Takara Bio, Inc.), 0.2% ascorbate acid (Shanghai Aladdin Biochemical Technology Co., Ltd.), 0.01% dexamethasone (Shanghai Aladdin Biochemical Technology Co., Ltd.), 1% glutamine, 100 units of penicillin/streptomycin and 1% β-glycerophosphate sodium (13).

Cell transfection and treatment

BMSC models with inhibited or overexpressed NF1 were established using a method similar to that used by a previous study (13). Briefly, a small interfering RNA (siRNA) targeting NF1 and a negative control (NC) siRNA (non-targeting sequence) were purchased from Shanghai GenePharma Co., Ltd. The siRNA targeting sequences were as follows: NF1-siRNA, 5'-ACATACCAAAGTCAGTACT-3'; and NC-siRNA, 5'-AACAAGATGAAGAGCACCA-3'. Human BMSCs were grown in 6/12-well culture plates until ~80% confluence, then transfected with 100 nm siRNA-NF1 or NC-siRNA for 48 h at 37˚C using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Human NF1 cDNA was amplified by PCR and inserted into pcDNA3.0 (NF1-pcDNA3.0; Invitrogen; Thermo Fisher Scientific, Inc.). Then NF1-pcDNA3.0 (1/2 µg) or pcDNA3.0 (1/2 µg) was transfected into BMSCs using Lipofectamine® 2000 in accordance with the manufacturer's protocol. Twenty-four hours later, the transfected cells were divided into the following four groups: NC-siRNA, NF1-siRNA, pcDNA3.0 and NF1-pcDNA3.0. Additionally, a control group was established containing untransfected BMSCs. The transfected BMSCs were treated with 50 nM RAPA (cat. no. AY 22989; MedChemExpress) or 5 mM 3-MA (cat. no. S2767-1; Selleck Chemicals) for 24 h at 37˚C for the detection of autophagy and associated pathways. The concentrations used in the present study were based on those used in previous studies (21,22). In addition, osteogenic differentiation experiments were conducted on day 14 following transfection.

RNA extraction and reverse transcription-quantitative PCR (RT-qPCR)

Following transfection and differentiation on day 14, total RNA was isolated from cultured cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Gene expression levels were measured in a real-time PCR detection system (Bio-Rad Laboratories, Inc.) by SYBR® Green (Bio-Rad Laboratories, Inc.) detection. Briefly, the extracted RNA was reverse transcribed in the presence of a poly (A) polymerase with an oligo-dT adaptor, using the PrimeScript™ RT Reagent kit with gDNA Eraser (Perfect Real Time; cat. no. RR047A; Takara Bio, Inc.), according to the manufacturer's protocol. The thermocycling conditions were as follows: 42˚C for 2 min; followed by 37˚C for 15 min and 85˚C for 5 sec. The expression of NF1, runt-related transcription factor 2 (Runx2), alkaline phosphatase (ALP) and Osterix were quantified by qPCR using TB Green® Fast qPCR Mix (cat. no. RR430; Takara Bio, Inc.). Thermocycling conditions were as follows: Initial denaturation at 95˚C for 15 min; followed by 40 cycles of 95˚C for 15 sec, annealing 50-60˚C for 30 sec, 72˚C for 30 sec; followed by final extension at 72˚C for 7 min. GAPDH was used as the internal control. The PCR primers are listed in Table I. The Cq value obtained for the gene of interest was normalized to that of the housekeeping gene GAPDH to obtain the ΔCq value. The ΔΔCq value was then obtained by subtracting the ΔCq value for each gene of interest from the ΔCq value for the control sample. The results were calculated using the equation RQ=2-ΔΔCq, where RQ is the relative quantity and is expressed as the fold-change relative to the corresponding gene expression level in the control sample (23).

Table I

Primers used in the present study.

Table I

Primers used in the present study.

IDOrientationSequence (direction, 5'-3')
NF1F GTATTGAATTGAAGCACCTTTGTTTGG
NF1R CTGCCCAAGGCTCCCCCAG
ALPF CCAACTCTTTTGTGCCAGAGA
ALPR GGCTACATTGGTGTTGAGCTTTT
Runx2F GACTGTGGTTACCGTCATGGC
Runx2R ACTTGGTTTTTCATAACAGCGGA
OsterixFACCTACCC ATCTGACTTTGCTC
OsterixR CTGCCCACTATTTCCCACTG
GAPDHF AGGTCGGTGTGAACGGATTTG
GAPDHR GGGGTCGTTGATGGCAACA

[i] NF1, neurofibromatosis type I; ALP, alkaline phosphatase; Runx2, runt-related transcription factor 2; F, forward; R, reverse.

Western blotting

Transfected and treated BMSC proteins were extracted using lysis buffer containing 50 mM Tris (pH 7.6), 150 mM NaCl, 1% Triton X-100, 1% deoxycholate, 0.1% SDS, 1 mM PMSF and 0.2% aprotinin (Beyotime Institute of Biotechnology). A BCA™ Protein Assay kit (Pierce; Thermo Fisher Scientific, Inc.) was used for quantification of protein samples. Equal amounts of protein samples (30 µg per lane) were separated on 15% SDS-PAGE gels and transferred onto PVDF membranes. After blocking in 5% BSA serum (Roche Diagnostics GmbH) for 1 h at 37˚C, the blocked membranes were incubated with the corresponding primary antibodies overnight at 4˚C. The membranes were then washed in Tris-buffered saline (Tris 20 mM, NaCl 137 mM, pH 7.6) containing 0.1% Tween-20 (TBST; cat. no. P2287; Sigma-Aldrich; Merck KgaA) three times and incubated for 1 h at room temperature with appropriate secondary antibodies conjugated to horseradish peroxidase (HRP). The membranes were incubated with ECL reagent (Immun-Star HRP Substrate kit; cat. no. 1705040; Bio-Rad Laboratories, Inc.). The signals were then visualized and analyzed using Image Lab™ software 5.2 (Bio-Rad Laboratories, Inc.). For the present study, primary antibodies against NF1 (1:1,000; cat. no. ab128054; Abcam), Beclin-1 (1:1,000; cat. no. ab210498; Abcam), p62 (1:1,000; cat. no. ab109012; Abcam), LC3BI/II (1:1,000; cat. no. ab192890; Abcam), GAPDH (1:1,000; cat. no. ab8245; Abcam), ALP (1:1,000; cat. no. ab229126; Abcam), Runx2 (1:1,000; cat. no. ab236639; Abcam) and Osterix (1:1,000; cat. no. ab209484; Abcam) were used. Antibodies against phosphorylated (p)-mTOR (1:1,000; cat. no. 5536; Cell Signaling Technology), total (t)-mTOR (1:1,000; cat. no. 2983; Cell Signaling Technology), p-p70S6 kinase (p70S6K; 1:1,000; cat. no. 9204; Cell Signaling Technology), t-p70S6K (1:1,000; cat. no. 2708; Cell Signaling Technology), AKT (1:1,000; cat. no. 9272; Cell Signaling Technology), p-AKT (1:1,000; cat. no. 4060; Cell Signaling Technology), PI3K (1:1,000; cat. no. 4249; Cell Signaling Technology) and p-PI3K (1:1,000; cat. no. 17366; Cell Signaling Technology) were also used. HRP-conjugated anti-mouse IgG (1:5,000; cat. no. ab6728; Abcam) and HRP-conjugated anti-rabbit IgG (1:5,000; cat. no. ab6721; Abcam) were used as secondary antibodies.

Acridine orange (AO) staining

After conditioning, BMSCs were harvested and suspended in PBS at 1x106 cells/ml. Next, 95 µl of this cell suspension was considered and 5 µl AO staining solution (Sigma-Aldrich; Merck KGaA) was added. The reaction was allowed to proceed for 10 min in the dark at room temperature. Subsequently, 5 ml PBS was added and the suspension was then centrifuged on a conventional centrifuge at 150 x g at room temperature for 5 min. The supernatant was then discarded and washed twice with PBS. The cells suspended in PBS were pipetted onto slides and sealed with cover glass. Autophagy was visualized under a fluorescence microscope (magnification, x40; Leica DMIRB; Leica Microsystems GmbH).

Autophagic flux/lysosomal detection

To track and observe the formation of autophagosomes and autophagic flux, 1x106 cells/ml were grown to ~80% confluence, infected with Ad-GFP-LC3B (cat. no. C3006; Beyotime Institute of Biotechnology) at 7 log10 PFU/ml for 24 h and cultured in a 6-well plate on cover glass to monitor autophagy flux. Furthermore, the slides were washed with PBS and 3% paraformaldehyde was added into each well. The plate was then placed in the dark for 20 min at room temperature. The slides were washed three times with PBS before 2 ml PBS was then added to each well. The plate was incubated with shaking at room temperature for 10 min. The coverslips were mounted with an anti-fade mounting solution (cat. no. P0126; Beyotime Institute of Biotechnology) and dried for 1 min at room temperature. Subsequently, the slides were observed with a fluorescence microscope (magnification, x40; Leica DMIRB; Leica Microsystems GmbH). During this procedure, GFP-LC3 was combined with autophagosomes, and detected using fluorescence microscopy. Under the fluorescence microscope, the GFP-LC3 combined autophagosomes were indicated by granular green fluorescence.

ALP staining

BMSCs were inoculated into a 12-well culture plate at a density of 1x104 cells per well at 37˚C in 5% CO2. After 24 h, the medium was replaced with the osteogenic induction medium (cat. no. CTCC-Y001, PH Biomedicine) and cultured at 37˚C in 5% CO2. The medium was changed every 2-3 days and removed after 14 days. The cells were washed twice with PBS and fixed with 4% paraformaldehyde for 30 min at room temperature. The paraformaldehyde was then removed and the cells were washed three times with ddH2O and an ALP staining solution (Shanghai Gefan Biotechnology Co., Ltd.) was added for 30 min at room temperature. The ALP staining solution was removed, the cells were washed three times with ddH2O and visualized under a microscope (magnification, x40; Leica DMIRB; Leica Microsystems GmbH); in addition, images were captured.

Alizarin red staining

BMSCs were cultured with osteogenic induction medium for 14 days before examination of Alizarin red staining. The culture medium was discarded and the cells (1x106) were fixed with 4% paraformaldehyde for 15-20 min at room temperature, following which they were washed three times with PBS. Alizarin red staining solution (ScienCell Research Laboratories, Inc.) was prepared in advance and was added to the culture plate and placed in the incubator for 15 min at room temperature. The staining solution was then discarded, the plate was washed three times with PBS solution and placed under a differential interference contrast microscope (magnification, x40; Leica DMIRB; Leica Microsystems GmbH) to capture images.

Transmission electron microscopy

BMSCs were cultured in 6-well plates and transfected with NF1-pcDNA3.0 for 48 h, and then collected and fixed with a mixture of 2.5% glutaraldehyde and 1% acetic acid for 2 h at room temperature. Samples were then processed following a standard protocol (24). Briefly, samples were dehydrated using ethanol, stained for 2 h using uranyl acetate and alkaline lead citrate at room temperature, embedded using Epon resin at 37˚C overnight, and cut into 500 nm-thick sections using an automatic microwave sample processor (Leica EM AMW; Leica Microsystems GmbH) at room temperature. Observation and imaging were then performed by using a JEM-1400 transmission electron microscope (JEOL, Ltd.).

Statistical analysis

All experiments were repeated ≥ three times. The results are expressed as the mean ± standard deviation. Data were processed using the SPSS 10.0 statistical software (SPSS, Inc.). For between-group comparisons, data were analyzed using an unpaired Student's t-test. One-way analysis of variance followed by a post hoc test of LSD was used to analyze the data among the three groups. P<0.05 was considered to indicate a statistically significant difference.

Results

NF1 regulates the autophagic activity of BMSCs

To detect the effect of NF1 on the autophagic activity of BMSCs, cell models of BMSCs with NF1 knockdown using NF1-siRNA or NF1 overexpression (NF1-pcDNA3.0) o were established. RT-qPCR and western blotting results showed that the mRNA (Fig. 1A) and protein (Fig. 1B and C) expression levels of NF1 were significantly decreased in the NF1-siRNA group compared with those in NC siRNA, but significantly increased in the NF1-pcDNA3.0 group compared with those in the pcDNA3.0 group. Western blotting results indicated that in the NF1-siRNA group, the expression of Beclin-1 was significantly decreased, whereas that of LC3B-I and p62, a marker of autophagosome degradation (25), were significantly increased compared with that in the NC siRNA group (Fig. 1B and C). In addition, in the NF1-pcDNA3.0 group, the expression of autophagy markers Beclin-1, was significantly increased, whereas that of LC3B-I and p62 was significantly decreased compared with that in the pcDNA3.0 group (Fig. 1B and C).

Figure 1

NF1 regulates the autophagic activity of bone mesenchymal stem cells. (A) Reverse transcription-quantitative PCR demonstrated significant downregulation of NF1-mRNA expression in the NF1-siRNA group and upregulation of NF1-mRNA expression in the NF1-pcDNA3.0 group. (B) Western blotting and subsequent (C) quantification indicated that the protein levels of NF1, Beclin-1 were significantly decreased in the NF1-siRNA group and increased in the NF1-pcDNA3.0 group, whereas the changes in the expression of p62 and LC3B-I revealed the opposite pattern. *P<0.05 vs. NC-siRNA; #P<0.05 vs. NF1-pcDNA3.0. NF1, neurofibromin-1; si-, small interfering; NC, negative control.

Furthermore, autophagic activity was detected using transmission electron microscopy. The results revealed that overexpression of NF1(NF1-pcDNA3.0) increased the formation of autophagosomes, whilst inhibiting the expression of NF1(NF1-siRNA) significantly reduced the formation of autophagosomes when compared with groups pcDNA3.0 and NC-siRNA, respectively (Fig. 2). Furthermore, AO staining and autophagic flux/lysosomal detection were performed (Fig. 3A). AO staining demonstrated that the formation of autophagolysosomes (indicated by yellow-red or orange fluorescence in Fig. 3A) was increased in the NF1-pcDNA3.0 group but decreased in the NF1-siRNA group when compared with groups NC-siRNA and pcDNA3.0. The autophagic flux/lysosomal detection assay also revealed similar results (Fig. 3B). During the formation of autophagosomes, GFP-LC3 protein transferred to the membrane of autophagosomes, and the autophagosomes were indicated by green puncta using fluorescence microscopy. The results of the present study indicated that the autophagic flux/lysosomal was significantly increased in the NF1-pcDNA3.0 group but decreased in the NF1-siRNA group when compared with the pcDNA3.0 and NC-siRNA groups, respectively.

Figure 2

Transmission electron microscopy results. It demonstrated that the formation of autophagosomes was decreased in the NF1-siRNA group and increased in the NF1-pcDNA3.0 group (indicated by the arrows). Scale bars, 2 µm. NC, negative control; si-, small interfering; NF1, neurofibromin-1.

Figure 3

AO staining and autophagic flux detection from the Ad-GFP-LC3 visualized under a fluorescence microscope. (A) AO staining, autophagolysosomes were stained orange (indicated by white arrows), (B) GFP-LC3 combined autophagosomes were indicated by granular green fluorescence (indicated by the white arrows). Magnification, x200. AO, acridine orange; NF1, neurofibromin-1; si-, small interfering; NC, negative control.

Collectively, these results suggest that overexpression of NF1 promoted autophagic activity of BMSCs, whilst knockdown of NF1 expression decreased the level of autophagy in BMSCs.

NF1 modulates osteogenic differentiation by influencing the autophagic activity of BMSCs

The results of RT-qPCR and western blotting indicated that the expression levels of osteogenic differentiation markers Osterix, Runx2 and ALP were markedly decreased in the NF1-siRNA group, whereas they were increased in the NF1-pcDNA3.0 group compared with those in the NC siRNA group (Fig. 4A-D). To investigate the effects of autophagy on osteogenic differentiation of BMSCs, an activator (RAPA) and inhibitor (3-MA) of autophagy were added to the NF1-siRNA and NF1-pcDNA3.0 groups, respectively. As a result, the levels of the osteogenic differentiation markers Osterix, Runx2 and ALP increased markedly in the RAPA-treated group compared with that in the NF1-siRNA group alone. By contrast, the expression levels decreased markedly in the 3-MA-treated group compared with those in NF1-pcDNA3.0 group alone (Fig. 4A-D).

Figure 4

Autophagy serves a notable role in NF1-modulated osteogenic differentiation of bone mesenchymal stem cells. Expression levels of osteogenic markers (A) Osterix, (B) Runx2 and (C) ALP measured by reverse transcription-quantitative PCR. (D) Western blotting indicated that the expression levels of these markers were markedly decreased in the NF1-siRNA group and increased in the NF1-pcDNA3.0 group. (A-D) Treatment with RAPA and 3-MA markedly but partially reversed the effects of NF1-siRNA and NF1-pcDNA3.0 transfection, respectively. NF1; neurofibromin-1; si-, small interfering; NC, negative control; Runx2, runt-related transcription factor 2; ALP, alkaline phosphatase; RAPA, rapamycin; 3-MA, 3-methyladenine; ***P<0.05 vs. all other groups; ###P<0.05 vs. all other groups; **P<0.05 vs. NF1-siRNA; ##P<0.05 vs.NF1-pcDNA3.0..

ALP staining indicated that ALP activity was decreased by knocking down NF1 expression (NF1-siRNA) and increased by NF1 overexpression (NF1-pcDNA3.0) when compared with NC-siRNA and pcDNA3.0 groups, respectively. In addition, RAPA and 3-MA treatment reversed the changes in ALP activity in the NF1-siRNA and NF1-pcDNA3.0 groups, respectively (Fig. 5). Alizarin red staining, representing calcium deposition, also revealed similar results (Fig. 6). After application of RAPA and 3-MA, the decreased and increased calcium deposition in the NF1-siRNA and NF1-pcDNA3.0 groups, respectively, were restored to the levels in the control groups (Fig. 6). These results suggest that NF1 could modulate the osteogenic differentiation of BMSCs by regulating the autophagic activity of BMSCs.

Figure 5

Results of ALP staining. Activity of ALP was markedly decreased in the NF1-siRNA group and increased in the NF1-pcDNA3.0 group when compared with NC-siRNA and pcDNA3.0 groups, respectively. However, treatment with RAPA and 3-MA reversed the effects of NF1-siRNA and NF1-pcDNA3.0 transfection, respectively. Scale bars, 50 µm. NF1, neurofibromin-1; si-, small interfering; NC, negative control; ALP, alkaline phosphatase; RAPA, rapamycin; 3-MA, 3-methyladenine.

Figure 6

Alizarin red staining. Calcium deposition was decreased in the NF1-siRNA group and increased in the NF1-pcDNA3.0 group when compared with NC-siRNA and pcDNA3.0 groups, respectively. Treatment with RAPA and 3-MA reversed the effects of NF1-siRNA and NF1-pcDNA3.0 transfection, respectively. Scale bars, 50 µm. NF1, neurofibromin-1; si-, small interfering; NC, negative control; RAPA, rapamycin; 3-MA, 3-methyladenine.

NF1 partially regulates the autophagic activity of BMSCs via the PI3K/AKT/mTOR pathway

The present study verified whether NF1 could regulate autophagy in BMSCs through the PI3K/AKT/mTOR pathway. Western blotting results demonstrated that the PI3K/AKT/mTOR pathway was significantly activated in the NF1-siRNA group, as indicated by increased levels of p-PI3K, p-AKT, p-mTOR and p-p70S6K compared with those in the NC-siRNA group (Fig. 7A-C). By contrast, the PI3K/AKT/mTOR pathway was significantly inhibited in the NF1-pcDNA3.0 group, as indicated by decreased levels of p-PI3K, p-AKT, p-mTOR and p-p70S6K compared with those in the pcDNA3.0 group (Fig. 7A-C). RAPA was used to activate whereas 3-MA was used to inhibit the autophagy of BMSCs in the NF1-siRNA and NF1-pcDNA3.0 groups, respectively. The results of western blot analysis indicated that the autophagic activity was significantly increased in group NF1-siRNA+RAPA and decreased in group NF1-pcDNA3.0+3-MA, compared with the NF1-siRNA and group NF1-pcDNA3.0, respectively (Fig. 7D-F). Transmission electron microscopy, AO staining and autophagic flux/lysosomal detection indicated that the formation of autophagosomes were significantly increased in the NF1-siRNA + RAPA group compared with the NF1-siRNA, whilst it was significantly decreased in the NF1-pcDNA3.0 + 3-MA group compared with that in the NF1-pcDNA3.0 group (Figs. 8 and 9). The levels of p-mTOR, p-p70S6K, p-PI3K, and p-AKT were significantly decreased in the NF1-siRNA + RAPA group compared with those in the NF1-siRNA group (Fig. 7A-C). Additionally, the levels of p-PI3K, p-AKT, p-mTOR and p-p70S6K were all significantly decreased in the NF1-pcDNA3.0 + 3-MA group compared with those in the NF1-pcDNA3.0 group (Fig. 7A-C). These results indicated that NF1 could partially regulate the autophagic activity of BMSCs via the PI3K/AKT/mTOR signaling pathway.

Figure 7

NF1 regulates autophagy in bone mesenchymal stem cells by inhibiting the PI3K/AKT/mTOR pathway. (A-C) Western blotting demonstrated that NF1-siRNA significantly decreased the expression of Beclin-1 and LC3B-II and increased the expression of P62 and LC3B-I, while RAPA reversed the effects of NF1-siRNA. NF1-pcDNA3.0 significantly increased the expression of Beclin-1 and LC3B-II while decreased the expression of P62 and LC3B-I, while 3-MA reversed the effects of NF1-pcDNA3.0. (D-F) Western blotting indicated that the levels of proteins in the PI3K/AKT/mTOR pathway (p-PI3K, p-AKT, p-mTOR and p-P70S6K) were upregulated in the NF1-siRNA group and downregulated in the NF1-pcDNA3.0 group when compared with groups NC-siRNA and pcDNA3.0, respectively. RAPA downregulated PI3K/AKT/mTOR pathway in BMSCs with NF1-siRNA, while 3-MA upregulated PI3K/AKT/mTOR pathway in BMSCs with NF1-pcDNA3.0. Quantified levels of (B) Beclin-1, (C) p62, LC3B-I, LC3B-II, (E, F) p-PI3K, p-AKT, p-mTOR and p-P70S6K. *P<0.05 vs. pcDNA3.0; **P<0.05 vs NC-siRNA; #P<0.05 vs. NF1-siRNA; &P<0.05 vs. NF1-pcDNA3.0. NF1, neurofibromatosis type 1; si-, small interfering; NC, negative control; RAPA, rapamycin; 3-MA, 3-methyladenine; p-, phosphorylated; P70S6K, p70S6 kinase.

Figure 8

Results of transmission electron microscopy. Treatment with RAPA and 3-MA reversed the effects of NF1-siRNA and NF1-pcDNA3.0 transfection, respectively, on the autophagy activity of BMSCs (autophagosome was indicated by the arrows). Scale bars, 2 µm. NF1, neurofibromin-1; si-, small interfering; NC, negative control; RAPA, rapamycin; 3-MA, 3-methyladenine.

Figure 9

AO staining and autophagic flux detection visualized under a fluorescence microscope. Magnification, x200. AO staining and autophagic flux detection visualized under a fluorescence microscope. In AO staining (A), autophagolysosomes were stained orange (indicated by the white arrows). The formation of autophagosomes were significantly increased in the NF1-siRNA + RAPA group compared with the NF1-siRNA, whilst it was significantly decreased in the NF1-pcDNA3.0 + 3-MA group compared with that in the NF1-pcDNA3.0 group. In autophagic flux detection (B), the GFP-LC3 combined autophagosomes were indicated by granular green fluorescence (indicated by the white arrows). Autophagic flux was significantly increased in the NF1-siRNA + RAPA group compared with the NF1-siRNA group, while it was significantly decreased in the NF1-pcDNA3.0 + 3-MA group compared with that in the NF1-pcDNA3.0 group. Results indicated that treatment with RAPA and 3-MA reversed the effects of NF1-siRNA and NF1-pcDNA3.0 transfection, respectively (indicated by the arrows). AO, acridine orange; NF1, neurofibromin 1; si-, small interfering; NC, negative control; RAPA, rapamycin; 3-MA, 3-methyladenine.

Discussion

Data from the present study indicate that NF1 regulated the autophagy of BMSCs. Overexpression of NF1 promoted the autophagic activity of BMSCs, whilst autophagic activity was inhibited by the downregulation of NF1. Several studies have reported the effect of autophagy on NF1-deficient malignant peripheral nerve sheath tumors (MPNSTs) (26,27). In particular, Yang et al (26) found that NF1-deficient MPNST samples exhibit high mobility group protein A2 (HMGA2) expression levels and that HMGA2 knockdown inhibited autophagy, which subsequently promotes MPNST cell death. However, to the best of our knowledge, few studies have reported the effects of NF1 on autophagy in BMSCs. Tan et al (20) revealed that autophagic activity and osteogenic differentiation were significantly enhanced in NF1-overexpressing BMSCs, consistent with the results of the present study. However, Tan et al (20) only established NF1-overexpression BMSC models, which are different from the clinical situation in patients with NF1 mutations, where the function of NF1 is insufficient (8). Therefore, a cell model with inhibited expression of NF1 can simulate the pathological conditions of NF1 more closely compared with one with overexpression of NF1. The present study established cell models of BMSCs with the inhibition or overexpression of NF1, which is more translational for investigating the effects of NF1 on the autophagy of BMSCs (26,27).

The present study also demonstrated that autophagy served a notable role in NF1-modulated osteogenic differentiation of BMSCs. Knockdown of NF1 inhibited the autophagic activity of BMSCs and decreased the osteogenic differentiation of BMSCs whilst overexpression of NF1 resulted in the opposite effects. In addition, an autophagy activator (RAPA) and an autophagy inhibitor (3-MA) reversed the effects of NF1-knockdown and overexpression, respectively, on the osteogenic differentiation of BMSCs. A number of studies have demonstrated the involvement of NF1 in osteogenic differentiation of BMSCs (8,10,11,28). In particular, a previous study demonstrated that downregulation and upregulation of NF1 respectively inhibited and promoted osteogenic differentiation of BMSCs, respectively (13). Leskelä et al (8) cultured mesenchymal stem cells of patients with NF1 and revealed impaired osteoblast differentiation. Conversely, loss of NF1 resulted in increased osteoblast proliferation (10,11). Kolanczyk et al (10) established a mouse model with conditional inactivation of NF1 in the limb skeleton and tested the effect of NF1 on osteoblast proliferation. They revealed that the osteoblast cell division rate was significantly increased in inactivated NF1 mutant cells when compared with that in controls. Additionally, other studies have demonstrated that autophagy can serve an important role in the osteogenic differentiation process (15,16,29-32). Wan et al (15) investigated the lumbar BMSCs of patients with osteoporosis and determined that the autophagy level in these BMSCs was significantly decreased, which was accompanied by inhibited osteogenic differentiation. Furthermore, it was identified that an autophagy activator (RAPA) significantly increased the osteogenic differentiation of BMSCs (15). Ma et al (29) also determined that the autophagy levels in young male mice were higher compared with those in aged male mice. In addition, treatment with an autophagy inhibitor significantly suppressed the osteogenic differentiation of BMSCs (29). Nuschke et al (30) found that autophagy levels in BMSCs were significantly increased during the early stages of osteogenic differentiation, whilst it was significantly decreased after differentiation into mature osteocytes. In addition, Liu et al (31), Gómez-Puerto et al (32) and Zhou et al (16) reported that autophagy served an important role in osteogenic differentiation of BMSCs. In brief, the majority of previous studies aforementioned reported that an increase in autophagic activity promotes osteogenic differentiation of BMSCs. However, the BMSCs used in these previous studies were purchased from patients without NF1 mutation and with a native levels of NF1 expression. The present study used NF1-knockdown and NF1-overexpressing BMSCs and confirmed the involvement of autophagy in NF1-modulated osteogenic differentiation of BMSCs.

The present study also indicated that the autophagic activity of BMSCs was partially regulated by NF1 via the PI3K/AKT/mTOR signaling pathway. The PI3K/AKT/mTOR pathway was activated in NF1-knockdown BMSCs, whilst it was inhibited in NF1-overexpressing BMSCs. It has been previously reported that the PI3K/AKT/mTOR pathway serves a notable role in regulating autophagy (18,33,34). It is a classical signaling pathway for autophagy activation and the main gateway to autophagy (18,19). In particular, various studies have reported activation of the PI3K/AKT/mTOR signaling pathway in NF1-related MPNSTs (35,36). Previous studies by Tan et al (20) and Li et al (13), combined with the present study, demonstrate that regulation of autophagy facilitates NF1-mediated modulation of osteogenic differentiation of BMSCs via the PI3K/AKT/mTOR signaling pathway.

The mTORC1 signaling pathway has been reported to be an important regulator of autophagy (19). Unc-51-like autophagy activating kinase (ULK) is a key initiator of autophagy (37,38). Furthermore, mTORC1 inhibits the ULK complex by phosphorylating its components, including autophagy-related gene 13 and ULK1/2 (37,38). Additionally, mTORC1 regulates the Vps34 class III PI3K complex, which is needed for autophagosome formation (37,38). In the present study, the autophagic activity in the NF1-pcDNA3.0 group was significantly decreased after an autophagy inhibitor (3-MA) was applied. It is known that 3-MA is an inhibitor of PI3K (39) and that it suppresses autophagy by inhibiting the class III PI3K (40). Additionally, 3-MA inhibits AKT by inhibiting the class I PI3K (40,41) and subsequently leads to mTORC1 inactivation (18). As aforementioned, mTORC1 signaling inhibits autophagosome formation (37,38). The inhibition of autophagy and osteogenic differentiation of BMSCs in the NF1-pcDNA3.0 + 3-MA group in the present study suggests that autophagy may partially regulate osteogenic differentiation of BMSCs through other mechanisms that are independent of mTOR signaling. It has been reported that AMP-activated protein kinase and the Wnt//β-catenin signaling pathway may also mediate important roles in regulating autophagy in BMSCs (42,43). Therefore, further study is required to investigate the mechanism by which NF1 modulates osteogenic differentiation of BMSCs through autophagy.

There are still some limitations in the present study. Firstly, our study only established BMSCs models with knockdown or overexpression of NF1 by siRNA or pcDNA3.0, which is different from clinical condition (NF1 mutation). Secondly, the present study is a cell experiment, further animal studies are required to confirm the role of autophagy on NF1-modulated growth of bone.

In conclusion, the present study demonstrated that autophagy played a significant role in NF1-mediated osteogenic differentiation of BMSCs. Downregulation of NF1 inhibited autophagy to decrease osteogenic differentiation of BMSCs, whereas upregulation of NF1 activated autophagy to increase osteogenic differentiation. NF1 may partially regulate the autophagic activity of BMSCs via the PI3K/AKT/mTOR signaling pathway. The present study could guide a new direction for elucidating the etiology of NF1-associated skeletal abnormalities and provide a novel theoretical basis for the treatment of NF1.

Acknowledgements

Not applicable.

Funding

Funding: The present study was supported by funding from Guangzhou Women and Children's Medical Center/Guangzhou Institute of Pediatrics (grant no. IP-2019-001) and The National Nature Science Foundation of China (grant no. 81702116).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

Conceptualization, methodology, supervision and writing (review and editing) were performed by YQL, HWX and XML. Original draft and funding acquisition were performed by YQL. HWX and YQL provided resources. XML, MWZ, JCL, ZY and YHL performed the experiments. YQL and MWZ analyzed the data. YQL and HWX confirm the authenticity of all the raw data. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Anderson JL and Gutmann DH: Neurofibromatosis type 1. Handb Clin Neurol. 132:75–86. 2015.PubMed/NCBI View Article : Google Scholar

2 

Ferner RE and Gutmann DH: Neurofibromatosis type 1 (NF1): Diagnosis and management. Handb Clin Neurol. 115:939–955. 2013.PubMed/NCBI View Article : Google Scholar

3 

Gutmann DH, Ferner RE, Listernick RH, Korf BR, Wolters PL and Johnson KJ: Neurofibromatosis type 1. Nat Rev Dis Primers. 3(17004)2017.PubMed/NCBI View Article : Google Scholar

4 

Ferner RE, Huson SM, Thomas N, Moss C, Willshaw H, Evans DG, Upadhyaya M, Towers R, Gleeson M, Steiger C and Kirby A: Guidelines for the diagnosis and management of individuals with neurofibromatosis 1. J Med Genet. 44:81–88. 2007.PubMed/NCBI View Article : Google Scholar

5 

Feldman DS, Jordan C and Fonseca L: Orthopaedic manifestations of neurofibromatosis type 1. J Am Acad Orthop Surg. 18:346–357. 2010.PubMed/NCBI View Article : Google Scholar

6 

Vitale MG, Guha A and Skaggs DL: Orthopaedic manifestations of neurofibromatosis in children: An update. Clin Orthop Relat Res. 107–118. 2002.PubMed/NCBI View Article : Google Scholar

7 

Shen MH, Harper PS and Upadhyaya M: Molecular genetics of neurofibromatosis type 1 (NF1). J Med Genet. 33:2–17. 1996.PubMed/NCBI View Article : Google Scholar

8 

Leskelä HV, Kuorilehto T, Risteli J, Koivunen J, Nissinen M, Peltonen S, Kinnunen P, Messiaen L, Lehenkari P and Peltonen J: Congenital pseudarthrosis of neurofibromatosis type 1: Impaired osteoblast differentiation and function and altered NF1 gene expression. Bone. 44:243–250. 2009.PubMed/NCBI View Article : Google Scholar

9 

Sharma R, Wu X, Rhodes SD, Chen S, He Y, Yuan J, Li J, Yang X, Li X, Jiang L, et al: Hyperactive Ras/MAPK signaling is critical for tibial nonunion fracture in neurofibromin-deficient mice. Hum Mol Genet. 22:4818–4828. 2013.PubMed/NCBI View Article : Google Scholar

10 

Kolanczyk M, Kossler N, Kuhnisch J, Lavitas L, Stricker S, Wilkening U, Manjubala I, Fratzl P, Sporle R, Herrmann BG, et al: Multiple roles for neurofibromin in skeletal development and growth. Hum Mol Genet. 16:874–886. 2007.PubMed/NCBI View Article : Google Scholar

11 

Wu X, Estwick SA, Chen S, Yu M, Ming W, Nebesio TD, Li Y, Yuan J, Kapur R, Ingram D, et al: Neurofibromin plays a critical role in modulating osteoblast differentiation of mesenchymal stem/progenitor cells. Hum Mol Genet. 15:2837–2845. 2006.PubMed/NCBI View Article : Google Scholar

12 

Wang W, Nyman JS, Ono K, Stevenson DA, Yang X and Elefteriou F: Mice lacking Nf1 in osteochondroprogenitor cells display skeletal dysplasia similar to patients with neurofibromatosis type I. Hum Mol Genet. 20:3910–3924. 2011.PubMed/NCBI View Article : Google Scholar

13 

Li Y, Li J, Zhou Q, Liu Y, Chen W and Xu H: mTORC1 signaling is essential for neurofibromatosis type I gene modulated osteogenic differentiation of BMSCs. J Cell Biochem. 120:2886–2896. 2019.PubMed/NCBI View Article : Google Scholar

14 

Reggiori F and Klionsky DJ: Autophagy in the eukaryotic cell. Eukaryot Cell. 1:11–21. 2002.PubMed/NCBI View Article : Google Scholar

15 

Wan Y, Zhuo N, Li Y, Zhao W and Jiang D: Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae. Biochem Biophys Res Commun. 488:46–52. 2017.PubMed/NCBI View Article : Google Scholar

16 

Zhou Z, Shi G, Zheng X, Jiang S and Jiang L: Autophagy activation facilitates mechanical stimulation-promoted osteoblast differentiation and ameliorates hindlimb unloading-induced bone loss. Biochem Biophys Res Commun. 498:667–673. 2018.PubMed/NCBI View Article : Google Scholar

17 

Lim HJ, Crowe P and Yang JL: Current clinical regulation of PI3K/PTEN/Akt/mTOR signalling in treatment of human cancer. J Cancer Res Clin Oncol. 141:671–689. 2015.PubMed/NCBI View Article : Google Scholar

18 

Heras-Sandoval D, Perez-Rojas JM, Hernandez-Damian J and Pedraza-Chaverri J: The role of PI3K/AKT/mTOR pathway in the modulation of autophagy and the clearance of protein aggregates in neurodegeneration. Cell Signal. 26:2694–2701. 2014.PubMed/NCBI View Article : Google Scholar

19 

Rabanal-Ruiz Y, Otten EG and Korolchuk VI: mTORC1 as the main gateway to autophagy. Essays Biochem. 61:565–584. 2017.PubMed/NCBI View Article : Google Scholar

20 

Tan Q, Wu JY, Liu YX, Liu K, Tang J, Ye WH, Zhu GH, Mei HB and Yang G: The neurofibromatosis type I gene promotes autophagy via mTORC1 signalling pathway to enhance new bone formation after fracture. J Cell Mol Med. 24:11524–11534. 2020.PubMed/NCBI View Article : Google Scholar

21 

Zhao F, Feng G, Zhu J, Su Z, Guo R, Liu J, Zhang H and Zhai Y: 3-Methyladenine-enhanced susceptibility to sorafenib in hepatocellular carcinoma cells by inhibiting autophagy. Anticancer Drugs. 32:386–393. 2021.PubMed/NCBI View Article : Google Scholar

22 

Song C, Song C and Tong F: Autophagy induction is a survival response against oxidative stress in bone marrow-derived mesenchymal stromal cells. Cytotherapy. 16:1361–1370. 2014.PubMed/NCBI View Article : Google Scholar

23 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

24 

Klionsky DJ, Abdelmohsen K, Abe A, Abedin MJ, Abeliovich H, Acevedo Arozena A, Adachi H, Adams CM, Adams PD, Adeli K, et al: Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). Autophagy. 12:1–222. 2016.PubMed/NCBI View Article : Google Scholar

25 

Shibutani ST, Saitoh T, Nowag H, Münz C and Yoshimori T: Autophagy and autophagy-related proteins in the immune system. Nat Immunol. 16:1014–1024. 2015.PubMed/NCBI View Article : Google Scholar

26 

Yang K, Guo W, Ren T, Huang Y, Han Y, Zhang H and Zhang J: Knockdown of HMGA2 regulates the level of autophagy via interactions between MSI2 and Beclin1 to inhibit NF1-associated malignant peripheral nerve sheath tumour growth. J Exp Clin Cancer Res. 38(185)2019.PubMed/NCBI View Article : Google Scholar

27 

Lopez G, Torres K, Liu J, Hernandez B, Young E, Belousov R, Bolshakov S, Lazar AJ, Slopis JM, McCutcheon IE, et al: Autophagic survival in resistance to histone deacetylase inhibitors: Novel strategies to treat malignant peripheral nerve sheath tumors. Cancer Res. 71:185–196. 2011.PubMed/NCBI View Article : Google Scholar

28 

de la Croix Ndong J, Stevens DM, Vignaux G, Uppuganti S, Perrien DS, Yang X, Nyman JS, Harth E and Elefteriou F: Combined MEK inhibition and BMP2 treatment promotes osteoblast differentiation and bone healing in Nf1Osx-/-mice. J Bone Miner Res. 30:55–63. 2015.PubMed/NCBI View Article : Google Scholar

29 

Ma Y, Qi M, An Y, Zhang L, Yang R, Doro DH, Liu W and Jin Y: Autophagy controls mesenchymal stem cell properties and senescence during bone aging. Aging Cell. 17(e12709)2018.PubMed/NCBI View Article : Google Scholar

30 

Nuschke A, Rodrigues M, Stolz DB, Chu CT, Griffith L and Wells A: Human mesenchymal stem cells/multipotent stromal cells consume accumulated autophagosomes early in differentiation. Stem Cell Res Ther. 5(140)2014.PubMed/NCBI View Article : Google Scholar

31 

Liu X, Wang Y, Cao Z, Dou C, Bai Y, Liu C, Dong S and Fei J: Staphylococcal lipoteichoic acid promotes osteogenic differentiation of mouse mesenchymal stem cells by increasing autophagic activity. Biochem Biophys Res Commun. 485:421–426. 2017.PubMed/NCBI View Article : Google Scholar

32 

Gomez-Puerto MC, Verhagen LP, Braat AK, Lam EW, Coffer PJ and Lorenowicz MJ: Activation of autophagy by FOXO3 regulates redox homeostasis during osteogenic differentiation. Autophagy. 12:1804–1816. 2016.PubMed/NCBI View Article : Google Scholar

33 

Chang H, Li X, Cai Q, Li C, Tian L, Chen J, Xing X, Gan Y, Ouyang W and Yang Z: The PI3K/Akt/mTOR pathway is involved in CVB3-induced autophagy of HeLa cells. Int J Mol Med. 40:182–192. 2017.PubMed/NCBI View Article : Google Scholar

34 

Gao Y, Zhang Y and Fan Y: Eupafolin ameliorates lipopolysaccharide-induced cardiomyocyte autophagy via PI3K/AKT/mTOR signaling pathway. Iran J Basic Med Sci. 22:1340–1346. 2019.PubMed/NCBI View Article : Google Scholar

35 

Schulte A, Ewald F, Spyra M, Smit DJ, Jiang W, Salamon J, Jucker M and Mautner VF: Combined targeting of AKT and mTOR inhibits proliferation of human NF1-associated malignant peripheral nerve sheath tumour cells in vitro but not in a xenograft mouse model in vivo. Int J Mol Sci. 21(1548)2020.PubMed/NCBI View Article : Google Scholar

36 

Li XX, Zhang SJ, Chiu AP, Lo LH, Huang J, Rowlands DK, Wang J and Keng VW: Targeting of AKT/ERK/CTNNB1 by DAW22 as a potential therapeutic compound for malignant peripheral nerve sheath tumor. Cancer Med. 7:4791–4800. 2018.PubMed/NCBI View Article : Google Scholar

37 

Kim YC and Guan KL: mTOR: A pharmacologic target for autophagy regulation. J Clin Invest. 125:25–32. 2015.PubMed/NCBI View Article : Google Scholar

38 

Hosokawa N, Hara T, Kaizuka T, Kishi C, Takamura A, Miura Y, Iemura S, Natsume T, Takehana K, Yamada N, et al: Nutrient-dependent mTORC1 association with the ULK1-Atg13-FIP200 complex required for autophagy. Mol Biol Cell. 20:1981–1991. 2009.PubMed/NCBI View Article : Google Scholar

39 

Blommaart EF, Krause U, Schellens JP, Vreeling-Sindelarova H and Meijer AJ: The phosphatidylinositol 3-kinase inhibitors wortmannin and LY294002 inhibit autophagy in isolated rat hepatocytes. Eur J Biochem. 243:240–246. 1997.PubMed/NCBI View Article : Google Scholar

40 

Petiot A, Ogier-Denis E, Blommaart EF, Meijer AJ and Codogno P: Distinct classes of phosphatidylinositol 3'-kinases are involved in signaling pathways that control macroautophagy in HT-29 cells. J Biol Chem. 275:992–998. 2000.PubMed/NCBI View Article : Google Scholar

41 

Wu YT, Tan HL, Shui G, Bauvy C, Huang Q, Wenk MR, Ong CN, Codogno P and Shen HM: Dual role of 3-methyladenine in modulation of autophagy via different temporal patterns of inhibition on class I and III phosphoinositide 3-kinase. J Biol Chem. 285:10850–10861. 2010.PubMed/NCBI View Article : Google Scholar

42 

Li Y, Su J, Sun W, Cai L and Deng Z: AMP-activated protein kinase stimulates osteoblast differentiation and mineralization through autophagy induction. Int J Mol Med. 41:2535–2544. 2018.PubMed/NCBI View Article : Google Scholar

43 

Chen X, Sun K, Zhao S, Geng T, Fan X, Sun S, Zheng M and Jin Q: Irisin promotes osteogenic differentiation of bone marrow mesenchymal stem cells by activating autophagy via the Wnt//β-catenin signal pathway. Cytokine. 136(155292)2020.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li Y, Zhu M, Lin X, Li J, Yuan Z, Liu Y and Xu H: Autophagy is involved in neurofibromatosis type I gene‑modulated osteogenic differentiation in human bone mesenchymal stem cells. Exp Ther Med 22: 1262, 2021.
APA
Li, Y., Zhu, M., Lin, X., Li, J., Yuan, Z., Liu, Y., & Xu, H. (2021). Autophagy is involved in neurofibromatosis type I gene‑modulated osteogenic differentiation in human bone mesenchymal stem cells. Experimental and Therapeutic Medicine, 22, 1262. https://doi.org/10.3892/etm.2021.10697
MLA
Li, Y., Zhu, M., Lin, X., Li, J., Yuan, Z., Liu, Y., Xu, H."Autophagy is involved in neurofibromatosis type I gene‑modulated osteogenic differentiation in human bone mesenchymal stem cells". Experimental and Therapeutic Medicine 22.5 (2021): 1262.
Chicago
Li, Y., Zhu, M., Lin, X., Li, J., Yuan, Z., Liu, Y., Xu, H."Autophagy is involved in neurofibromatosis type I gene‑modulated osteogenic differentiation in human bone mesenchymal stem cells". Experimental and Therapeutic Medicine 22, no. 5 (2021): 1262. https://doi.org/10.3892/etm.2021.10697
Copy and paste a formatted citation
x
Spandidos Publications style
Li Y, Zhu M, Lin X, Li J, Yuan Z, Liu Y and Xu H: Autophagy is involved in neurofibromatosis type I gene‑modulated osteogenic differentiation in human bone mesenchymal stem cells. Exp Ther Med 22: 1262, 2021.
APA
Li, Y., Zhu, M., Lin, X., Li, J., Yuan, Z., Liu, Y., & Xu, H. (2021). Autophagy is involved in neurofibromatosis type I gene‑modulated osteogenic differentiation in human bone mesenchymal stem cells. Experimental and Therapeutic Medicine, 22, 1262. https://doi.org/10.3892/etm.2021.10697
MLA
Li, Y., Zhu, M., Lin, X., Li, J., Yuan, Z., Liu, Y., Xu, H."Autophagy is involved in neurofibromatosis type I gene‑modulated osteogenic differentiation in human bone mesenchymal stem cells". Experimental and Therapeutic Medicine 22.5 (2021): 1262.
Chicago
Li, Y., Zhu, M., Lin, X., Li, J., Yuan, Z., Liu, Y., Xu, H."Autophagy is involved in neurofibromatosis type I gene‑modulated osteogenic differentiation in human bone mesenchymal stem cells". Experimental and Therapeutic Medicine 22, no. 5 (2021): 1262. https://doi.org/10.3892/etm.2021.10697
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team