![Open Access](/resources/images/iconopenaccess.png)
KLF5‑mediated expression of CARD11 promotes the progression of gastric cancer
- Authors:
- Published online on: July 17, 2023 https://doi.org/10.3892/etm.2023.12121
- Article Number: 422
-
Copyright: © Li et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
Abstract
Introduction
Gastric cancer is one of the commonest malignant tumors in the world and one of the four major causes of malignancy-related deaths (1). According to GLOBOCAN 2020 statistics, the incidence of gastric cancer in East Asia, including China, holds the first place. Nearly 1/3 of the patients with gastric cancer have advanced stage when diagnosed and this is usually associated with poor prognosis (2,3). The overall survival rate of patients with gastric cancer is still very low, although various clinical methods are available for the treatment of gastric cancer, such as surgery, chemoradiotherapy and immunotherapy (4,5). Therefore, the identification of new molecular targets of gastric cancer and the investigation of the potential mechanism of action of this disease have become the focus of the current research field in gastric cancer.
Caspase recruitment domain-containing protein (CARD) 11 is an important member of the CARD family of proteins and is mainly present in lymphocytes (6). Phosphorylation of CARD11 by protein kinase C family isoenzymes causes conformational change in the interior of the CARD11 molecule, which leads to recruitment of B-cell lymphoma/leukemia 10 (Bcl-10) to CARD11. Bcl-10 binds to muco-associated lymphoid tissue lymphoma translocation protein 1 (MALT1) to form an oligomeric CARMA/CARD-Bcl-10-MALT1 (CBM) complex (7). In activated B-cell-like diffuse large B cell lymphoma, mutation in the CARD11 gene can activate CARD11 activity and selectively enhance its binding activity towards Bcl-10, further leading to the activation of the NF-κB signaling pathway and the development of tumorigenicity (8). Patients with chronic lymphocytic leukemia and high CARD11 expression exhibit a poor survival rate (9). Furthermore, CTD-2020K17.1 regulates CARD11 expression to promote the migration, invasion and proliferation of ovarian cancer cells (10). In addition, CARD11 is mutated in human skin squamous cell carcinoma, leading to abnormal NF-κB regulation and increased CARD11 mRNA levels in skin squamous cell carcinoma (11). However, the role of CARD11 in gastric cancer has not been previously reported. The encyclopedia of RNA interactomes (ENCORI) database (https://starbase.sysu.edu.cn/index.php, version 3.0) indicated that CARD11 was highly expressed in gastric cancer and that it was associated with poor disease prognosis.
HumanTFDB (http://bioinfo.life.hust.edu.cn/HumanTFDB#!/, version 3.0) predicted the binding of the transcription factor Krüppel-like factor 5 (KLF5) to the CARD11 promoter. Previous studies have shown that KLF5 activates long non-coding RNA DANCR to inhibit autophagy of cancer cells, thereby accelerating the progression of gastric cancer (12). KLF5 is activated by gene amplification in gastric cancer and promotes gastric cancer cell proliferation (13). Therefore, the present study aimed to detect the expression levels of KLF5 and CARD11 in gastric cancer cells and to investigate the underlying mechanism of action.
Materials and methods
Cell culture and cell transfection
Human normal gastric epithelial cells (GES-1) and human gastric cancer cells (MKN-45, KE-39 and AGS) were provided by BioVector NTCC Inc. The cells were cultured in RPMI-1640 medium (Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.), 100 µg/ml streptomycin and 100 units/ml penicillin at 37˚C in the presence of 5% CO2.
Small interfering (si) RNA of CARD11 (si-CARD11#1, AGCTAAAGCACCGGTTGAATAAG; si-CARD11#2, CAGTCTCTAAAACTGAAGAATGA) or siRNA negative control (NC, AAGACAUUGUGUGUCCGCCTT) were synthesized by Guangzhou RiboBio Co., Ltd. The KLF5 overexpression vector pcDNA3.0-KLF5 (oe-KLF5) and the empty plasmid pcDNA3.0 (oe-NC) were obtained from MiaolingBio. AGS cells were seeded into 6-well plates at a density of 2x105 cells/well and cultured until the cell confluence reached 80%. Subsequently, a total of 100 nM plasmids were transfected into AGS cells using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) at 37˚C for 48 h. Following 48 h of culture at 37˚C, the cells were harvested and used for further experiments.
Reverse transcription-quantitative (RT-q) PCR
Following transfection, 1x104 AGS cells were collected and treated with TRIzol® (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions to obtain the total RNA. The first-strand cDNA was reverse transcribed from RNA using the PrimeScript RT Reagent kit (Takara Bio, Inc.) following the manufacturer's instructions and qPCR was carried out by SYBR Real-time PCR kit (Takara Bio, Inc.) on an ABI 7500 system (Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. The thermocycling conditions were: Initial denaturation at 95˚C for 3 min; followed by 40 cycles of denaturation at 95˚C for 30 sec, annealing at 60˚C for 30 sec and extension at 72˚C for 30 sec. The following were the sequences of primers: CARD11 forward primer: 5'-GCTCACAACCGCATCCCAA-3', reverse primer: 5'-CTCCTCATGACCGCCATGTT-3'; KLF5 forward primer: 5'-AGCTACAATACGCTTGGCCT-3', reverse primer: 5'-ATGTGTGTTACGCACGGTCT-3'; GAPDH forward primer: 5'-GGAGCGAGATCCCTCCAAAAT-3', reverse primer: 5'-GGCTGTTGTCATACTTCTCATGG-3'. The mRNA expression levels of CARD11 and KLF5 were quantified using the 2-∆∆Cq method and the internal control used was GAPDH (14). All experiments were replicated three times.
Western blot analysis
Following transfection, total proteins were extracted from AGS cells using RIPA lysis buffer (Beyotime Institute of Biotechnology) and protein concentration was determined using bicinchoninic protein quantification kit (Beyotime Institute of Biotechnology). Equal amounts of protein samples (60 µg/lane) separated by 10% SDS-PAGE were transferred to polyvinylidene fluoride (PVDF) membranes (Millipore). Subsequently, the membranes were blocked with 5% non-fat dry milk at room temperature for 2 h and incubated with primary antibodies, including those against CARD11 (1:1,000; cat. no. ab124730; Abcam), E-cadherin (1:1,000; cat. no. ab40772; Abcam), N-cadherin (1:5,000; cat. no. ab76011; Abcam), vimentin (1:1,000; cat. no. ab92547; Abcam), KLF5 (1:1,000; cat. no. ab137676; Abcam), phosphorylated (p)-mTOR (1:1,000; cat. no. ab109268; Abcam), p-P70S6K (1:1,000; cat. no. ab59208; Abcam), mTOR (1:10,000; cat. no. ab134903; Abcam), P70S6K (1:5,000; cat. no. ab32529; Abcam) and GAPDH (1:2,500; cat. no. ab9485; Abcam) at 4˚C overnight; the following day, the membrane was incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (1:2,000; cat. no. ab6721; Abcam) at room temperature for 1 h. The protein bands were presented using ECL Plus (Thermo Fisher Scientific Inc.) and quantified by ImageJ 1.51 software (National Institutes of Health).
Cell Counting Kit-8 (CCK-8) assay
The cell viability was detected using CCK-8 assay (Beyotime Institute of Biotechnology). Following transfection, AGS cells were cultured for 48 h, seeded into a 96-well plate (3x103 cells/well) and further cultured at 37˚C, in the presence of 5% CO2. Subsequently, 10 µl CCK-8 was added to the cultured cells at 24, 48 and 72 h and further cultured for an additional 1 h. The absorbance value (OD value) of the cells at 490 nm was detected by a microplate reader.
5-ethynyl-2'-deoxyuridine (EdU) staining
An EdU kit (BeyoClick™ EdU Cell Proliferation Kit with Alexa Fluor 488; Beyotime Institute of Biotechnology) was used to detect cell proliferation. Following culture for three days at 37˚C in 24-well plates, AGS cells were incubated with EdU, fixed with 4% paraformaldehyde for 15 min at room temperature and stained with Hoechst 33342 for 2, 0.5 h and 10 min. Finally, the proliferation of the cells was observed and images captured by an inverted fluorescence microscope.
Flow cytometry analysis
Following transfection, AGS cells were incubated into 24-well plates and cultured for 24 h. The cells were centrifuged at 300 x g for 5 min and the medium was discarded. Subsequently, they were washed with pre-chilled PBS twice and fixed with 75% ethanol at 4˚C overnight. Following centrifugation, the cells were fixed with 100 µg/ml RNase A at 37˚C for 30 min and subsequently stained with 50 µg/ml PI (Thermo Fisher Scientific, Inc.) for 5 min in the dark. Finally, the cell cycle was analyzed by flow cytometry (NovoCyte 2060R; ACEA Biosciences, Inc.) with Software NovoExpress 1.4.0 (ACEA Biosciences, Inc.).
Wound healing assay
Following transfection, 2x105 AGS cells were added to the each well of the 6-well plate and was cultured to form a cell monolayer. The cell monolayer was scratched by a sterilized 10-µl pipette tip, followed by PBS washing to remove the detached cells. Subsequently, the obtained cells were cultured in RPMI-1640 medium containing 2% FBS for 24 h at 37˚C. Then, the images of cells were observed under a light microscope (Thermo Fisher Scientific, Inc.) and the migration distance was analyzed by ImageJ software (version 1.8.0; National Institutes of Health).
Transwell assay
Following transfection, AGS cells were collected and 5x104 cells were added to the serum-free medium (200 µl) in the upper chambers coated with Matrigel at 37˚C for 1 h. RPMI-1640 medium containing 10% FBS was added to the lower chambers. Following culture for 24 h at 37˚C, the cells in the upper chamber were removed and the obtained cells were fixed with 95% ethanol, stained with 0.1% crystal violet for 10 min at room temperature and washed by PBS. The observation of the invasive cells was performed using an inverted microscope.
Dual luciferase reporter assay
Wild-type (WT) and mutant (mut) sequences of pleckstrin homology-like domain family A member 3 were cloned and inserted into the pGL4.13 reporter vector (Promega Corporation). Subsequently, AGS cells were transfected with the luciferase reporter, oe-KLF5 and oe-NC using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) for 48 h at 37˚C. At 48 h post-transfection, the Luc-Pair Duo-Luciferase HS Assay kit (cat. no. LF004, GeneCopoeia Expressway to Discovery) was used to calculate the luciferase activity referring to the standard curve of luciferin activity.
Chromatin immunoprecipitation (ChIP) assay
The binding ability of KLF5 to the CARD11 promoter was confirmed by a ChIP assay kit (Beyotime Institute of Biotechnology) according to the manufacturer's protocol. Briefly, 1x106 AGS cells were cultured in 1% formaldehyde at 37˚C for 10 min to cross-link the target protein with the corresponding genomic DNA. Cells were collected via centrifugation at 13,000 x g for 10 min at 4˚C and washed twice with pre-chilled PBS. A high intensity ultrasonic processor (Cole-Parmer; Antylia Scientific) was used to shear the genomic DNA on ice so that its majority was broken into 200-500 bp fragments. An equal amount of chromatin was immunoprecipitated at 4˚C overnight. ChIP was performed using 2 µg anti-KLF5 (1:5,000; cat. no. 21017-1-AP, Proteintech Group, Inc.). Total chromatin was used as the input. Immunoprecipitated products were collected after incubation with magnetic beads coupled with anti-rabbit IgG (1:100; cat. no. 30000-0-AP, Proteintech Group, Inc.). The precipitated chromatin DNA was recovered and analyzed by qPCR. The sequences of primers were as follows: CARD11 forward primer: 5'-CCCAGGAGGAGAGAGAATTTGAG-3', reverse primser: 5'-CGTTCATCAGGAAGTGCGTG-3'. The reaction conditions included an initial pre-denaturation step at 94˚C for 10 min followed by 50 cycles at 94˚C for 20 sec and 60˚C for 1 min. Data were analyzed using the 2-ΔΔCq method and normalized to input samples (14).
Bioinformatics
HumanTFDB was used to predict the binding of the transcription factor KLF5 to the CARD11 promoter.
Statistical analysis
The experimental data were expressed as mean ± standard deviation of at least three independent experiments, which were analyzed using GraphPad Prism 8.0.1 (Dotmatics). An unpaired student's t-tests were used for comparisons between the two groups and one-way ANOVA with Tukey's post hoc test was used for multiple group comparisons. P<0.05 was considered to indicate a statistically significant difference.
Results
CARD11 is highly expressed in gastric cancer and is associated with poor prognosis
First, CARD11expression in patients with gastric cancer evaluated using ENCORI database. As shown in Fig. 1A, CARD11 was highly expressed in tissues of patients with gastric cancer. Additionally, it was also found from ENCORI database that high expression of CARD11 was significantly associated with low overall survival in patients with gastric cancer (Fig. 1B). Additionally, the expression of CARD11 was significantly upregulated in gastric cancer cells (MKN-45, KE-39 and AGS) compared with that in human normal gastric epithelial cell line GES-1 cells (Fig. 1C and D). As the highest CARD11 expression level was observed in AGS cells, this cell line was selected to perform the following experiments. These results indicated the abnormal expression of CARD11 in gastric cancer.
Interference of CARD11 expression inhibits the proliferation of gastric cancer cells and induces cell cycle arrest
To investigate the effects of CARD11 in the progression of gastric cancer, AGS cells were transfected with si-CARD11#1 and si-CARD11#2 to silence CARD11 expression. As shown in Fig. 2A and B, when compared with the si-NC group, the expression levels of CARD11 in AGS cells transfected with si-CARD11#1 and si-CARD11#2 were significantly downregulated. si-CARD11#2 demonstrated a stronger inhibitory effect on CARD11 expression and was therefore selected for subsequent experiments. When AGS cells were transfected with si-CARD11, their viability and proliferation were suppressed (Fig. 2C-E). Furthermore, interference of CARD11 expression increased the proportion of cells at the G0/G1 phase and decreased the proportion of the cells at the S and G2/M phases, indicating that the cell cycle was arrested (Fig. 2F). These data suggested that CARD11 silencing inhibits the proliferation and induces cell cycle arrest of gastric cancer cells.
Interference of CARD11 expression inhibits gastric cancer cell metastasis
To study the effects of CARD11 knockdown on the metastasis of gastric cancer cells, the capacities of cell migration, invasion and epithelial-to-mesenchymal transition (EMT) were determined. The migratory and invasive abilities of AGS cells were apparently suppressed by the downregulation of CARD11 expression compared with those noted in the control and si-NC groups (Fig. 3A and B). Meanwhile, the expression levels of E-cadherin were increased and those of N-cadherin and vimentin were decreased in AGS cells following transfection with si-CARD11 (Fig. 3C). These data revealed that CARD11 silencing suppressed the metastasis of gastric cancer cells.
Transcription factor KLF5 positively regulates the transcription of CARD11 in gastric cancer
To explore the potential mechanism of CARD11 on the progression of gastric cancer, HumanTFDB predicted the binding of the transcription factor KLF5 to the CARD11 promoter (Fig. 4A). The binding sites between the transcription factor KLF5 and CARD11 are shown in Fig. 4B. The expression levels of KLF5 and CARD11 in AGS cells were also upregulated (Fig. 4C and D). When AGS cells were transfected with oe-KLF5, the expression levels of KLF5 and CARD11 were upregulated (Fig. 4E and F). Additionally, the luciferase activity of AGS cells co-transfected with CARD11-WT and oe-KLF5 were increased compared with those in AGS cells co-transfected with CARD11-mut and oe-KLF5 (Fig. 4G). Moreover, ChIP assay indicated that the CARD11 promoter was specifically pulled down by a KLF5-specific antibody; however, this was not noted for the control antibody (Fig. 4H). Furthermore, the expression levels of CARD11 in AGS cells were upregulated following transfection of the cells with oe-KLF5 (Fig. 4I and J). These observations suggested that transcription factor KLF5 positively regulated the transcription of CARD11 in gastric cancer.
KLF5 regulates CARD11 to promote malignant progression of gastric cancer perhaps by activating the mTOR pathway
Subsequently, KLF5 was overexpressed to study the mechanism of KLF5 regulation on CARD11 in the progression of gastric cancer. It was found that KLF5 overexpression improved the viability and proliferation of AGS cells transfected with si-CARD11 (Fig. 5A-C). The proportion of cells at the G0/G1 phase was decreased and that of the cells corresponding to the S and G2/M phases was increased in AGS cells transfected with si-CARD11 and oe-KLF5 (Fig. 5D). Meanwhile, KLF5 overexpression improved the migration and invasion of AGS cells transfected with si-CARD11 (Fig. 5E and F). Additionally, KLF5 overexpression suppressed the expression of E-cadherin, while it promoted the expression levels of N-cadherin and vimentin in AGS cells transfected with si-CARD11 (Fig. 5G). Interference of CARD11 expression downregulated the expression levels of p-mTOR and p-P70S6K, which were activated by KLF5 overexpression (Fig. 5H). Above findings demonstrated that KLF5 regulated CARD11 to promote malignant progression of gastric cancer might by activating the mTOR pathway.
Discussion
At present, the CARD11 protein in mammals has been studied extensively. The CARD11 protein is not only a member of the membrane-associated guanylate kinase (MAGUK) family of enzymes, but also a member of the CARD-MAGUK (CARMA) protein family, which exists in the cytoplasm of the host cell. It is especially abundant in hematopoietic cells and immune organs and is the only member of the MAGUK family specifically expressed in lymphocytes (15). Members of the CARMA family were originally discovered using bioinformatics methods based on the CARD functional domain and named CARD11 (CARMA1), CARD14 (CARMA2) and CARD10 (CARMA3) (16-18). CARMA1 is highly expressed in specific tumor cell lines, such as the chronic myelogenous leukemia cell K562, acute promyelocytic leukocytosis HL-60 and Burkitt's lymphoma cell Raji (16). In addition, CARMA1 can activate NF-κB through the CBM complex to cause excessive cell proliferation, invasion and metastasis and tumor angiogenesis, which is an important cause of autoimmune diseases or of lymphatic hematopoietic system tumors (19-21). Furthermore, high CARD11 expression in uveal melanoma is associated with poor overall survival and CARD11 is associated with autophagy, cell senescence and apoptosis (22). EMT is a cellular process by which epithelial cells gain a mesenchymal phenotype through specific changes in gene expression (23). A number of studies have found that the occurrence of EMT biological behavior plays an important role in the metastasis of malignant tumors (24-26). The epithelial cells undergoing EMT lose epithelial characteristics, such as loss of E-cadherin expression and gain mesenchymal features, such as overexpression of vimentin and N-cadherin (27). The present study found that high CARD11 expression in tissues of patients with gastric cancer was predicted in the ENCORI database and CARD11 expression was increased in gastric cancer cells. Downregulation of CARD11 expression suppressed the proliferation, invasion, migration and EMT of gastric cancer cells and induced their cell cycle arrest.
However, the regulatory models that mediate CARD11 expression and the mechanisms by which it modulates global gene expression have not been well characterized in gastric cancer cells. In the present study, a positive correlation between the KLF5 transcription factor and CARD11 was noted by analyzing HumanTFDB. The results derived from ChIP and luciferase reporter assays confirmed high enrichment of KLF5 in the promoter of CARD11. It was shown that KLF5 could activate CARD11 expression via an interaction with its promoter. KLF5 is a basic transcription element binding protein 2 in eukaryotes and a zinc finger protein transcription factor (28). It can regulate the tissue and time specificity of gene expression by activating or inhibiting the transcription of target genes and serves an important role in cell proliferation, differentiation and apoptosis (28-30). KLF5 expression is markedly upregulated in gastric cancer tissues and knockdown of its expression suppresses proliferation and arrested gastric cancer cell cycle at the G0/G1 phase (31). Upregulation of KLF5 expression attenuated the function of crocin to promote the migration, invasion and EMT of gastric cancer cells (32). Depletion of KLF5 expression reduces gastric cancer proliferation in vitro and in vivo (33). The present study further indicated that KLF5 expression was increased in gastric cancer cells and that its upregulation weakened the function of CARD11 interference to promote the migration, invasion and EMT; it also decreased cell cycle arrest of gastric cancer cells.
CARD11 is activated by phosphorylation and forms the CBM signalosome with the two downstream signaling molecules Bcl-10 and MALT1 (34-36). Following the formation of CBM, the MALT1 protein recruits the downstream signaling molecules to activate NF-κB, JNK and the mTOR signaling pathways (35,37-39). It was hypothesized that CARD11 may regulate the mTOR signaling pathway. mTOR and its upstream PI3K-protein kinase B (Akt) constitutes the PI3K/Akt/mTOR signaling pathway. This pathway is highly activated in gastric cancer and regulates cell proliferation, apoptosis, transcription, translation, metabolism and other important cell biological processes in the occurrence and development of gastric cancer (40). Lang et al (41) also found that the expression of p-mTOR in gastric cancer was closely related to lymphatic infiltration. Another study showed significant differences in the expression of p-mTOR in gastric cancer tissues of different TNM stages, whereas the positive expression of the p-mTOR protein in gastric cancer tissues of stage III-IV is significantly higher than that noted in tissues of stage I-II (42). The present study observed that interference of CARD11 expression suppressed the mTOR expression in gastric cancer cells, which was reversed by upregulation of KLF5 expression.
In conclusion, the present study demonstrated that KLF5-mediated CARD11 promoted the proliferation, migration and invasion of gastric cancer cells possibly by activating the mTOR pathway. To the best of the authors' knowledge, the present study is the first to demonstrate the suppressive role of CARD11 silencing in gastric cancer and the mechanism related to KLF5. Overall, these findings may provide efficient therapeutic target for the treatment of gastric cancer. Nevertheless, the present study has a limitation. The present study only discussed the regulatory effect of CARD11 and KLF5 on the progression of gastric cancer cells. In vivo experiments involving transgenic animals and the in-depth investigation of CARD11 and mTOR pathway will be used in future investigations to support the conclusion obtained in the present study.
Acknowledgements
Not applicable.
Funding
Funding: No funding was received.
Availability of data and materials
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
Authors' contributions
QL conceived and designed the current study. QL, SL and ZL performed the experiments and QL, HX and WZ performed the data analysis. QL wrote the manuscript. ZL and HX confirm the authenticity of all the raw data. All authors have read and approved the final manuscript.
Ethics approval and consent to participate
Not applicable.
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
References
Machlowska J, Baj J, Sitarz M, Maciejewski R and Sitarz R: Gastric cancer: Epidemiology, risk factors, classification, genomic characteristics and treatment strategies. Int J Mol Sci. 21(4012)2020.PubMed/NCBI View Article : Google Scholar | |
Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A and Bray F: Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 71:209–249. 2021.PubMed/NCBI View Article : Google Scholar | |
Wang H, Guo W, Hu Y, Mou T, Zhao L, Chen H, Lin T, Li T, Yu J, Liu H and Li G: Superiority of the 8th edition of the TNM staging system for predicting overall survival in gastric cancer: Comparative analysis of the 7th and 8th editions in a monoinstitutional cohort. Mol Clin Oncol. 9:423–431. 2018.PubMed/NCBI View Article : Google Scholar | |
Feng F, Liu J, Wang F, Zheng G, Wang Q, Liu S, Xu G, Guo M, Lian X and Zhang H: Prognostic value of differentiation status in gastric cancer. BMC Cancer. 18(865)2018.PubMed/NCBI View Article : Google Scholar | |
Zhao B, Mei D, Lv W, Lu H, Bao S, Lin J and Huang B: Clinicopathologic features, survival outcome, and prognostic factors in gastric cancer patients 18-40 years of age. J Adolesc Young Adult Oncol. 9:514–521. 2020.PubMed/NCBI View Article : Google Scholar | |
Desjardins M, Arjunaraja S, Stinson JR, Dorjbal B, Sundaresan J, Niemela J, Raffeld M, Matthews HF, Wang A, Angelus P, et al: A Unique heterozygous CARD11 mutation combines pathogenic features of both gain- and loss-of-function patients in a four-generation family. Front Immunol. 9(2944)2018.PubMed/NCBI View Article : Google Scholar | |
Juilland M and Thome M: Holding all the CARDs: How MALT1 controls CARMA/CARD-dependent signaling. Front Immunol. 9(1927)2018.PubMed/NCBI View Article : Google Scholar | |
Jattani RP, Tritapoe JM and Pomerantz JL: Cooperative control of caspase recruitment domain-containing protein 11 (CARD11) signaling by an unusual array of redundant repressive elements. J Biol Chem. 291:8324–8336. 2016.PubMed/NCBI View Article : Google Scholar | |
Kou Z, Mao M, Liu H, Wang X, Wang Z, Gu Z, Lang T, Nie Y, Wang Y, Huang Q, et al: CARD11 is a novel target of miR-181b that is upregulated in chronic lymphocytic leukemia. Biomark Med. 15:623–635. 2021.PubMed/NCBI View Article : Google Scholar | |
Zhu L, Guo Q, Lu X, Zhao J, Shi J, Wang Z and Zhou X: CTD-2020K17.1, a novel long non-coding RNA, promotes migration, invasion, and proliferation of serous ovarian cancer cells in vitro. Med Sci Monit. 24:1329–1339. 2018.PubMed/NCBI View Article : Google Scholar | |
Watt SA, Purdie KJ, den Breems NY, Dimon M, Arron ST, McHugh AT, Xue DJ, Dayal JH, Proby CM, Harwood CA, et al: Novel CARD11 mutations in human cutaneous squamous cell carcinoma lead to aberrant NF-κB regulation. Am J Pathol. 185:2354–2363. 2015.PubMed/NCBI View Article : Google Scholar | |
Cheng Z, Liu G, Huang C and Zhao X: KLF5 activates lncRNA DANCR and inhibits cancer cell autophagy accelerating gastric cancer progression. NPJ Genom Med. 6(75)2021.PubMed/NCBI View Article : Google Scholar | |
Chen W, Zhang J, Fu H, Hou X, Su Q, He Y and Yang D: KLF5 is activated by gene amplification in gastric cancer and is essential for gastric cell proliferation. Cells. 10(1002)2021.PubMed/NCBI View Article : Google Scholar | |
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar | |
Ramadas RA, Roche MI, Moon JJ, Ludwig T, Xavier RJ and Medoff BD: CARMA1 is necessary for optimal T cell responses in a murine model of allergic asthma. J Immunol. 187:6197–6207. 2011.PubMed/NCBI View Article : Google Scholar | |
Bertin J, Wang L, Guo Y, Jacobson MD, Poyet JL, Srinivasula SM, Merriam S, DiStefano PS and Alnemri ES: CARD11 and CARD14 are novel caspase recruitment domain (CARD)/membrane-associated guanylate kinase (MAGUK) family members that interact with BCL10 and activate NF-kappa B. J Biol Chem. 276:11877–11882. 2001.PubMed/NCBI View Article : Google Scholar | |
McAllister-Lucas LM, Jin X, Gu S, Siu K, McDonnell S, Ruland J, Delekta PC, Van Beek M and Lucas PC: The CARMA3-Bcl10-MALT1 signalosome promotes angiotensin II-dependent vascular inflammation and atherogenesis. J Biol Chem. 285:25880–25884. 2010.PubMed/NCBI View Article : Google Scholar | |
Wang S, Li Y, Hu YH, Song R, Gao Y, Liu HY, Shu HB and Liu Y: STUB1 is essential for T-cell activation by ubiquitinating CARMA1. Eur J Immunol. 43:1034–1041. 2013.PubMed/NCBI View Article : Google Scholar | |
Park Y, Jin HS and Liu YC: Regulation of T cell function by the ubiquitin-specific protease USP9X via modulating the Carma1-Bcl10-Malt1 complex. Proc Natl Acad Sci USA. 110:9433–9438. 2013.PubMed/NCBI View Article : Google Scholar | |
Qu C, Liu Y, Kunkalla K, Singh RR, Blonska M, Lin X, Agarwal NK and Vega F: Trimeric G protein-CARMA1 axis links smoothened, the hedgehog receptor transducer, to NF-κB activation in diffuse large B-cell lymphoma. Blood. 121:4718–4728. 2013.PubMed/NCBI View Article : Google Scholar | |
Blonska M and Lin X: CARMA1-mediated NF-kappaB and JNK activation in lymphocytes. Immunol Rev. 228:199–211. 2009.PubMed/NCBI View Article : Google Scholar | |
Shi X, Xia S, Chu Y, Yang N, Zheng J, Chen Q, Fen Z, Jiang Y, Fang S and Lin J: CARD11 is a prognostic biomarker and correlated with immune infiltrates in uveal melanoma. PLoS One. 16(e0255293)2021.PubMed/NCBI View Article : Google Scholar | |
Chen L, Yang QC, Li YC, Yang LL, Liu JF, Li H, Xiao Y, Bu LL, Zhang WF and Sun ZJ: Targeting CMTM6 suppresses stem cell-like properties and enhances antitumor immunity in head and neck squamous cell carcinoma. Cancer Immunol Res. 8:179–191. 2020.PubMed/NCBI View Article : Google Scholar | |
Hung JJ, Kao YS, Huang CH and Hsu WH: Overexpression of Aiolos promotes epithelial-mesenchymal transition and cancer stem cell-like properties in lung cancer cells. Sci Rep. 9(2991)2019.PubMed/NCBI View Article : Google Scholar | |
Deng L, Zou J, Su Y, Wang M and Zhao L: Resveratrol inhibits TGF-β1-induced EMT in gastric cancer cells through Hippo-YAP signaling pathway. Clin Transl Oncol. 24:2210–2221. 2022.PubMed/NCBI View Article : Google Scholar | |
Odero-Marah V, Hawsawi O, Henderson V and Sweeney J: Epithelial-mesenchymal transition (EMT) and prostate cancer. Adv Exp Med Biol. 1095:101–110. 2018.PubMed/NCBI View Article : Google Scholar | |
Dong D, Na L, Zhou K, Wang Z, Sun Y, Zheng Q, Gao J, Zhao C and Wang W: FZD5 prevents epithelial-mesenchymal transition in gastric cancer. Cell Commun Signal. 19(21)2021.PubMed/NCBI View Article : Google Scholar | |
Gao Y, Ding Y, Chen H, Chen H and Zhou J: Targeting Krüppel-like factor 5 (KLF5) for cancer therapy. Curr Top Med Chem. 15:699–713. 2015.PubMed/NCBI View Article : Google Scholar | |
Marrero-Rodríguez D, la Cruz HA, Taniguchi-Ponciano K, Gomez-Virgilio L, Huerta-Padilla V, Ponce-Navarrete G, Andonegui-Elguera S, Jimenez-Vega F, Romero-Morelos P, Rodriguez-Esquivel M, et al: Krüppel like factors family expression in cervical cancer cells. Arch Med Res. 48:314–322. 2017.PubMed/NCBI View Article : Google Scholar | |
Hart GT, Hogquist KA and Jameson SC: Krüppel-like factors in lymphocyte biology. J Immunol. 188:521–526. 2012.PubMed/NCBI View Article : Google Scholar | |
Chen P, Qian XK, Zhang YF, Sun XG, Shi XJ and Gao YS: KLF5 promotes proliferation in gastric cancer via regulating p21 and CDK4. Eur Rev Med Pharmacol Sci. 24:4224–4231. 2020.PubMed/NCBI View Article : Google Scholar | |
Zhou Y, Xu Q, Shang J, Lu L and Chen G: Crocin inhibits the migration, invasion, and epithelial-mesenchymal transition of gastric cancer cells via miR-320/KLF5/HIF-1α signaling. J Cell Physiol. 234:17876–17885. 2019.PubMed/NCBI View Article : Google Scholar | |
Chia NY, Deng N, Das K, Huang D, Hu L, Zhu Y, Lim KH, Lee MH, Wu J, Sam XX, et al: Regulatory crosstalk between lineage-survival oncogenes KLF5, GATA4 and GATA6 cooperatively promotes gastric cancer development. Gut. 64:707–719. 2015.PubMed/NCBI View Article : Google Scholar | |
Juilland M and Thome M: Role of the CARMA1/BCL10/MALT1 complex in lymphoid malignancies. Curr Opin Hematol. 23:402–409. 2016.PubMed/NCBI View Article : Google Scholar | |
Lork M, Staal J and Beyaert R: Ubiquitination and phosphorylation of the CARD11-BCL10-MALT1 signalosome in T cells. Cell Immunol. 340(103877)2019.PubMed/NCBI View Article : Google Scholar | |
Roche MI, Ramadas RA and Medoff BD: The role of CARMA1 in T cells. Crit Rev Immunol. 33:219–243. 2013.PubMed/NCBI View Article : Google Scholar | |
Gross O, Grupp C, Steinberg C, Zimmermann S, Strasser D, Hannesschläger N, Reindl W, Jonsson H, Huo H, Littman DR, et al: Multiple ITAM-coupled NK-cell receptors engage the Bcl10/Malt1 complex via Carma1 for NF-kappaB and MAPK activation to selectively control cytokine production. Blood. 112:2421–2428. 2008.PubMed/NCBI View Article : Google Scholar | |
Wegener E and Krappmann D: CARD-Bcl10-Malt1 signalosomes: Missing link to NF-kappaB. Sci STKE. 2007(pe21)2007.PubMed/NCBI View Article : Google Scholar | |
Wegener E, Oeckinghaus A, Papadopoulou N, Lavitas L, Schmidt-Supprian M, Ferch U, Mak TW, Ruland J, Heissmeyer V and Krappmann D: Essential role for IkappaB kinase beta in remodeling Carma1-Bcl10-Malt1 complexes upon T cell activation. Mol Cell. 23:13–23. 2006.PubMed/NCBI View Article : Google Scholar | |
Sun D, Toan X, Zhang Y, Chen Y, Lu R, Wang X and Fang J: Mammalian target of rapamycin pathway inhibition enhances the effects of 5-aza-dC on suppressing cell proliferation in human gastric cancer cell lines. Sci China C Life Sci. 51:640–647. 2008.PubMed/NCBI View Article : Google Scholar | |
Lang SA, Gaumann A, Koehl GE, Seidel U, Bataille F, Klein D, Ellis LM, Bolder U, Hofstaedter F, Schlitt HJ, et al: Mammalian target of rapamycin is activated in human gastric cancer and serves as a target for therapy in an experimental model. Int J Cancer. 120:1803–1810. 2007.PubMed/NCBI View Article : Google Scholar | |
Xu DZ, Xia LP, Lin TY, Cai MY, Fan XJ, Zhan YQ, Zhou ZW and Li W: Expression and clinical significance of p-mTOR in gastric cancer. J Sun Yat-Sen Univ (Med Sci). 30:304–307. 2009. |