Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
April 2012 Volume 29 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April 2012 Volume 29 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Novel RS1 mutations associated with X-linked juvenile retinoschisis

  • Authors:
    • Junhui Yi
    • Shiqiang Li
    • Xiaoyun Jia
    • Xueshan Xiao
    • Panfeng Wang
    • Xiangming Guo
    • Qingjiong Zhang
  • View Affiliations / Copyright

    Affiliations: Department of Ophthalmology, The Third Xiangya Hospital, Central-South University, Changsha 410013, P.R. China, State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-Sen University, 54 Xianlie Road, Guangzhou 510060, P.R. China
  • Pages: 644-648
    |
    Published online on: January 10, 2012
       https://doi.org/10.3892/ijmm.2012.882
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

To identify mutations in the retinoschisin (RS1) gene in families with X-linked retinoschisis (XLRS). Twenty families with XLRS were enrolled in this study. All six coding exons and adjacent intronic regions of RS1 were amplified by polymerase chain reaction (PCR). The nucleotide sequences of the amplicons were determined by Sanger sequencing. Ten hemizygous mutations in RS1 were detected in patients from 14 of the 20 families. Four of the ten mutations were novel, including c:176G>A (p:Cys59Tyr) in exon 3, c:531T>G (p:Tyr177X), c:607C>G (p:Pro203Ala) and c:668G>A (p:Cys223Tyr) in exon 6. These four novel mutations were not present in 176 normal individuals. The remaining six were recurrent mutations, including c:214G>A (p:Glu72Lys), c:304C>T (p:Arg102Trp), c:436G>A (p:Glu146Lys), c:544C>T (p:Arg182Cys), c:599G>A (p:Arg200His) and c:644A>T (p:Glu215Val). Our study expanded the mutation spectrum of RS1 and enriches our understanding of the molecular basis of XLRS.

Introduction

X-linked retinoschisis (XLRS, MIM 312700) is a hereditary retinal disease characterized by a splitting of the neurosensory retina, with a prevalence of 1:5,000 to 1:25,000 males worldwide (1). Typical fundus changes include radiating cysteic maculopathy in most cases and peripheral retinoschisis in half of the cases (2). However, the disease has a high degree of phenotypic variability (3–6), in which genetic testing is of value in confirming the diagnosis (4).

XLRS accounts for most congenital retinoschisis (2,7) and is due to mutations in the retinoschisin gene (RS1, OMIM 312700) localized on Xp22.13 (8,9). The encoded protein, retinoschisin, is secreted from photoreceptors and bipolar cells as a functional homo-octameric complex that is thought to play a role in cellular adhesion and cell-to-cell interaction (10).

Gene transference to mouse models of X-linked juvenile retinoschisis, which suggest gene replacement may be a possible future therapy for patients (11–13). Genetic diagnosis is the basis for gene transference in the future. Therefore, we have to fully understand the molecular basis of XLRS. To date, more than 160 different RS1 mutations have been identified in patients with XLRS (http://www.dmd.nl/rs), including small intragenic deletions, nonsense and missense mutations, frame shift insertions and deletions, and splice site mutations. However, there are still some RS1 mutations that remain unknown.

In this study, we analyzed the coding exons and the adjacent regions of RS1 in patients from 20 unrelated Chinese families with XLRS. Ten hemizygous mutations, including 4 novel mutations, were detected in 14 families.

Subjects and methods

Probands with XLRS from 20 unrelated families were enrolled in this study. Written informed consent was obtained from the participating individuals or their guardians prior to the collection of clinical data and genomic samples. This study was approved by the Internal Review Board of the Zhongshan Ophthalmic Center.

Mutation detection

Genomic DNA was prepared from venous leukocytes. Six pairs of primers (Table I) were used to amplify the six coding exons and the adjacent intronic sequence of RS1 (NCBI human genome build 37.2, NG_008659.1 for genomic DNA, NM_000330.3 for mRNA, and NP_000321.1 for protein). Touchdown polymerase chain reaction (PCR) was performed with decreasing 0.5°C per cycle from 64°C for the first 15 cycles then down to 57°C (the annealing temperature) for the remaining 21 cycles. GC buffer was used. DNA sequences of the amplicons were identified with ABI BigDye Terminator cycle sequencing kit version 3.1 (Applied Biosystems, Foster City, CA) on an ABI 3130 Genetic Analyzer (Applied Biosystems). Sequencing results and consensus sequences from the NCBI human genome database were compared by using the SeqMan II program of the Lasergene package (DNA Star, Inc., Madison, WI) and then aligned to identify variations. Each variation was confirmed by bidirectional sequencing. Mutation description followed the recommendation of the Human Genomic Variation Society (HGVS). Variations detected in patients were further evaluated in controls by sequencing 176 normal individuals.

Table I

Primers used for the amplification and sequencing of RS1.

Table I

Primers used for the amplification and sequencing of RS1.

ExonDirectionPrimer sequence (5′-3′)Size of amplified fragment (bp)Annealing temperature (°C)
1F GGTTAACTTGATGGGGCTCA37457
R AACTGGAAAGCCATCCACAC
2F TCTATTTCACTTTTCCATGTAACGA24357
R ACCATGCCCAGCCAAAATA
3F GACGATGCATAAGGACTGAGTG29657
R AGCGTTCAGGGGGTTAATTC
4F GCAAAGCAGATGGGTTTGTT35957
R CCACCACGCCAGTTAATTTT
5F CAGGGGGCTCTTTGGATG38957
R ACAGAGGGCAGTGACAGGAG
6F CACCCGCAAACTGCTTTAAC38457
R TGCGAAATATAGCCCTGTCC

[i] GC buffer was used in all amplifications. F, indicates the forward sequence; R, indicates the reverse sequence.

The Sorting Intolerant From Tolerant (SIFT) program and the Polymorphism Phenotyping (PolyPhen-2) were used to predict whether an amino acid substitution was likely to affect the protein function (14,15).

Results

Mutation analysis

Ten hemizygous mutations in RS1 were detected in patients from 14 of the 20 families with retinoschisis (Table II and Fig. 1), including c:176G>A (p:Cys59Tyr) in exon 3, c:214G>A (p:Glu72Lys) and c:304C>T (p:Arg102Trp) in exon 4, c:436G>A (p:Glu146Lys) in exon 5, c.531T>G (p:Tyr177X), c:544C>T (p:Arg182Cys), c:599G>A (p:Arg200His), c:607C>G (p:Pro203Ala), c:644A>T (p:Glu215Val) and c:668G>A (p:Cys223Tyr) in exon 6. Of the 10, the c:176G>A, c:531T>G, c:607C>G and c:668G>A were novel. These novel mutations occurred in highly conserved regions (Fig. 2) and were predicted to be pathogenic (Table II). They were absent in 176 normal individuals.

Figure 1

Sequence chromatography. Four novel sequence changes detected in the probands with RS are shown (left column) compared with corresponding normal sequences (right column).

Figure 2

Protein sequence alignment of six RS1 orthologs. The regions with the novel p.C59Y and p.P203A mutations are highly conserved, C223Y is comparatively conserved.

Table II

The mutations of the RS1 gene in XLRS.

Table II

The mutations of the RS1 gene in XLRS.

Computational predictionFrequency


ExonPatient IDNucleotide changeAmino acid changeBlosum62PolyPhenSIFTPatientsControlsNoteRef
3QT42, QT335c:176G>Ap:Cys59Tyr9→-20.99602/200/176Novel
4QT221, QT232, QT653c:214G>Ap:Glu72Lys5→10.99803/20Reported(19)
4MD15c:304C>Tp:Arg102Trp5→-3101/20Reported(20)
5RP6c:436G>Ap:Glu146Lys5→10.9610.171/20Reported(21)
6MD30c:531T>Gp:Tyr177X1/200/176Novel
6QT417, QT212c:544C>Tp:Arg182Cys5→-310.012/20Reported(22)
6QT848c:599G>Ap:Arg200His5→0101/20Reported(23)
6QT911c:607C>Gp:Pro203Ala7→-110.131/200/176Novel
6QT219c:644A>Tp:Glu215Val5→-3101/20Reported(31)
6QT758c:668G>Ap:Cys223Tyr9→-20.9960.011/200/176Novel

[i] All mutations are hemizygous.

All 10 probands with hemizygous RS1 mutations (the clinical data of 4 probands were not available) had clinical symptoms and signs of retinoschisis (Table III). The four probands with novel mutations showed macular and peripheral retinoschisis.

Table III

Clinical information on individuals with RS1 variations.

Table III

Clinical information on individuals with RS1 variations.

MutationsAge (years)BCVA



Patient IDNucleotideProteinExamOnsetFamily historyODOSMacular changePeripheral changeRetinal holeStrabismusOCTERG(b/a)
QT042176G>ACys59TyrN/AN/ANoN/AN/AN/AN/AN/AN/AN/AN/A
QT335176G>ACys59Tyr116No0.40.2mRSpRSNoNoRSN/A
QT221214G>AGlu72Lys19ECYes0.10.2mRSPDNoNoN/AN/A
QT232214G>AGlu72Lys188No0.40.2mRSDegenenationNoNoN/AN/A
QT653214G>AGlu72Lys53No0.30.7mRSpRSYesNoN/AReduced
MD015304C>TArg102TrpN/A7No0.20.3PD, FRBNoNoNoN/AN/A
RP006436G>AGlu146Lys54NoFC0.03PD, FRBNoNoNoN/AReduced
MD030531T>GTyr177X65No0.3FCmRSpRSNoYesN/AReduced
QT212544C>TArg182CysN/AN/AN/AN/AN/AN/AN/AN/AN/AN/AN/A
QT417544C>TArg182Cys12ECNo0.30.03NopRSYesNoN/AN/A
QT848599G>AArg200His21ECNo0.60.4mRSNoNoNoN/AReduced
QT911607C>GPro203Ala22ECNo0.20.4mRSpRSNoYesN/AN/A
QT219644A>TGlu215ValN/AN/AN/AN/AN/AN/AN/AN/AN/AN/AN/A
QT758668G>ACys223Tyr96No0.40.3mRSpRSYesNoRSN/A

[i] BCVA, best-corrected visual acuity; mRS, macular retinoschisis; pRS, peripheral retinoschisis; RS retinoschisis; EC, early childhood; N/A, not available; PD, pigmental disorder; FRB, foveal reflex was blunted; FC, figure counting; ERG(b/a), the ratio of b wave amplitude to a wave amplitude.

Discussion

In this study, ten different hemizygous mutations in RS1 were identified in 14 families with XLRS. These mutations are predicted to be pathogenic. All patients with mutations demonstrated typical signs of XLRS. The ten mutations affected different domains of retinoschisin, including the RS1 domain (1 mutation), discoidin domain (8 mutations) and C-terminal segment (1 mutation). These mutations were not randomly distributed over the gene (Fig. 3) because 80% of mutations were clustered in the discoidin domain (16). The two novel mutations, Tyr177X and Pro203Ala in the discoidin domain, may cause a shorter retinoschisin form or protein misfolding (13). The cysteine mutations in the RS1 domain (Cys59Tyr) and C-terminal segment (Cys223Tyr) may cause failure of the discoidin domain to assemble into a normal multisubunit complex (17,18).

Figure 3

Distribution of the mutations detected a linear diagram of RS1 showing the organization of retinoschisin into domains and segments.

Most of RS1 mutation loci were hot mutation spots, while the Cys59, Glu72, Arg102, Glu146, Arg182, Arg200, Pro203, Glu215 and Cys223 could be substituted by 1–2 other kinds of amino acids and be reported more frequently (19–30). However, the mutations in the present study also differed from those reported previously. The RS1 mutations accounts for 70% of the Chinese retinoschisis (14/20) cases in our study. The Cys59Tyr, Tyr177X, Pro203Ala, Glu215Val and Cys223Tyr mutations only are present in the Chinese population (31), and the Cys59Tyr mutation was more common (10% frequency in our retinoschisis cases). The Glu72Lys mutation is the most common among Chinese (15%) as well as other populations (19,32), while another very common mutation, Pro192Ser (33), which was reported from people of different ethnic backgrounds was not found. We do not know whether the spectrum and frequency of RS1 gene in the Chinese is different from others. Our study contributes to the current state of knowledge.

In summary, we identified ten mutations in 14 of 20 families with XLRS. Our results expand the mutation spectrum of RS1 that might enrich our understanding of the molecular basis of XLRS in the Chinese population.

Acknowledgements

The authors thank all of the patients and controls subjects for their participation. This study was supported by the Open Research Fund Program of State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-Sen University, and in part by grant 30725044 from the National Science Fund for Distinguished Young Scholars.

References

1 

IM MacDonaldR SasiMolecular genetics of inherited eye disordersClin Invest Med1747449819947867253

2 

SK SikkinkS BiswasNR ParryPE StangaD TrumpX-linked retinoschisis: an updateJ Med Genet44225232200710.1136/jmg.2006.04734017172462

3 

MA ApushkinGA FishmanAS RajagopalanFundus findings and longitudinal study of visual acuity loss in patients with X-linked retinoschisisRetina25612618200510.1097/00006982-200507000-0001216077359

4 

A TantriTR VrabecA Cu-UnjiengA FrostWH Annesley JrLA DonosoX-linked retinoschisis: a clinical and molecular genetic reviewSurv Ophthalmol49214230200410.1016/j.survophthal.2003.12.00714998693

5 

D ShuklaA RajendranD GibbsB SuganthalakshmiK ZhangP SundaresanUnusual manifestations of X-linked retinoschisis: clinical profile and diagnostic evaluationAm J Ophthalmol144419423200710.1016/j.ajo.2007.05.01617631851

6 

JE KimMS RuttumMJ KoeberlEL HassemerDJ SidjaninGenetic and clinical evaluation of juvenile retinoschisisJ AAPOS13215217200910.1016/j.jaapos.2008.11.00519393523

7 

CG SauerA GehrigR Warneke-WittstockPositional cloning of the gene associated with X-linked juvenile retinoschisisNat Genet17164170199710.1038/ng1097-1649326935

8 

R Mendoza-LondonoKT HiriyannaEL BinghamA Colombian family with X-linked juvenile retinoschisis with three affected females finding of a frameshift mutationOphthalmic Genet203743199910.1076/opge.20.1.37.229910415464

9 

L HuopaniemiA RantalaE TahvanainenA de la ChapelleT AlitaloLinkage disequilibrium and physical mapping of X-linked juvenile retinoschisisAm J Hum Genet601139114919979150161

10 

D BeschG RudolphGenetic diseases of the eyeKlin Monbl Augenheilkd2229559712005(In German)

11 

SH MinLL MoldayMW SeeligerProlonged recovery of retinal structure/function after gene therapy in an Rs1h-deficient mouse model of X-linked juvenile retinoschisisMol Ther12644651200510.1016/j.ymthe.2005.06.00216027044

12 

FM DykaRS MoldayCoexpression and interaction of wild-type and missense RS1 mutants associated with X-linked retinoschisis: its relevance to gene therapyInvest Ophthalmol Vis Sci4824912497200710.1167/iovs.06-146517525175

13 

RS MoldayFocus on molecules: retinoschisin (RS1)Exp Eye Res84227228200710.1016/j.exer.2005.12.01316600216

14 

PC NgS HenikoffPredicting deleterious amino acid substitutionsGenome Res11863874200110.1101/gr.17660111337480

15 

S SunyaevV RamenskyI KochW Lathe IIIAS KondrashovP BorkPrediction of deleterious human allelesHum Mol Genet10591597200110.1093/hmg/10.6.59111230178

16 

LL MoldayD HicksCG SauerBH WeberRS MoldayExpression of X-linked retinoschisis protein RS1 in photoreceptor and bipolar cellsInvest Ophthalmol Vis Sci42816825200111222545

17 

WW WuJP WongJ KastRS MoldayRS1, a discoidin domain-containing retinal cell adhesion protein associated with X-linked retinoschisis, exists as a novel disulfide-linked octamerJ Biol Chem2801072110730200510.1074/jbc.M41311720015644328

18 

WW WuRS MoldayDefective discoidin domain structure, subunit assembly, and endoplasmic reticulum processing of retinoschisin are primary mechanisms responsible for X-linked retinoschisisJ Biol Chem2782813928146200310.1074/jbc.M302464200

19 

Y HottaK FujikiM HayakawaJapanese juvenile retinoschisis is caused by mutations of the XLRS1 geneHum Genet10314214419989760195

20 

JA DoddsAK SrivastavaKR HoldenUnusual phenotypic expression of an XLRS1 mutation in X-linked juvenile retinoschisisJ Child Neurol21331333200610.1177/0883073806021004190116900931

21 

NW KhanJA JamisonJA KempPA SievingAnalysis of photoreceptor function and inner retinal activity in juvenile X-linked retinoschisisVision Res4139313942200110.1016/S0042-6989(01)00188-211738458

22 

Y MashimaK ShinodaS IshidaIdentification of four novel mutations of the XLRS1 gene in Japanese patients with X-linked juvenile retinoschisis. Mutation in brief no 234Online Hum Mutat13338199910.1002/(SICI)1098-1004(1999)13:4%3C338::AID-HUMU16%3E3.0.CO;2-010220153

23 

B LledoJ TenD Rodriguez-ArnedoJ LlacerR BernabeuPreimplantation genetic diagnosis of X-linked retinoschisisReprod Biomed Online16886892200810.1016/S1472-6483(10)60157-518549702

24 

D TuvdendorjY IsashikiN OhbaS SonodaS IzumoTwo Japanese patients with mutations in the XLRS1 geneRetina22354357200210.1097/00006982-200206000-0001712055472

25 

Y InoueS YamamotoT InoueTwo novel point mutations of the XLRS1 gene in patients with X-linked juvenile retinoschisisAm J Ophthalmol134622624200210.1016/S0002-9394(02)01592-112383832

26 

F SimonelliG CennamoC ZivielloClinical features of X linked juvenile retinoschisis associated with new mutations in the XLRS1 gene in Italian familiesBr J Ophthalmol8711301134200310.1136/bjo.87.9.113012928282

27 

S WaliaGA FishmanRS MoldayRelation of response to treatment with dorzolamide in X-linked retinoschisis to the mechanism of functional loss in retinoschisinAm J Ophthalmol147111115200910.1016/j.ajo.2008.07.04118834580

28 

T WangA ZhouCT WatersE O’ConnorRJ ReadD TrumpMolecular pathology of X linked retinoschisis: mutations interfere with retinoschisin secretion and oligomerisationBr J Ophthalmol908186200610.1136/bjo.2005.07804816361673

29 

FM DykaWW WuTA PfeiferLL MoldayTA GrigliattiRS MoldayCharacterization and purification of the discoidin domain-containing protein retinoschisin and its interaction with galactoseBiochemistry4790989106200810.1021/bi800938g18690710

30 

X MaX LiL WangNovel XLRS1 gene mutations cause X-linked juvenile retinoschisis in Chinese familiesJpn J Ophthalmol524851200810.1007/s10384-007-0488-418369700

31 

M ZengC YiX GuoIdentification of novel mutations in the XLRS1 gene in Chinese patients with X-linked juvenile retinoschisisCurr Eye Res32685691200717852193

32 

B LeschV SzaboM KanyaClinical and genetic findings in Hungarian patients with X-linked juvenile retinoschisisMol Vis14232123322008

33 

LC EksandhV PonjavicR AyyagariPhenotypic expression of juvenile X-linked retinoschisis in Swedish families with different mutations in the XLRS1 geneArch Ophthalmol11810981104200010.1001/archopht.118.8.109810922205

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yi J, Li S, Jia X, Xiao X, Wang P, Guo X and Zhang Q: Novel RS1 mutations associated with X-linked juvenile retinoschisis. Int J Mol Med 29: 644-648, 2012.
APA
Yi, J., Li, S., Jia, X., Xiao, X., Wang, P., Guo, X., & Zhang, Q. (2012). Novel RS1 mutations associated with X-linked juvenile retinoschisis. International Journal of Molecular Medicine, 29, 644-648. https://doi.org/10.3892/ijmm.2012.882
MLA
Yi, J., Li, S., Jia, X., Xiao, X., Wang, P., Guo, X., Zhang, Q."Novel RS1 mutations associated with X-linked juvenile retinoschisis". International Journal of Molecular Medicine 29.4 (2012): 644-648.
Chicago
Yi, J., Li, S., Jia, X., Xiao, X., Wang, P., Guo, X., Zhang, Q."Novel RS1 mutations associated with X-linked juvenile retinoschisis". International Journal of Molecular Medicine 29, no. 4 (2012): 644-648. https://doi.org/10.3892/ijmm.2012.882
Copy and paste a formatted citation
x
Spandidos Publications style
Yi J, Li S, Jia X, Xiao X, Wang P, Guo X and Zhang Q: Novel RS1 mutations associated with X-linked juvenile retinoschisis. Int J Mol Med 29: 644-648, 2012.
APA
Yi, J., Li, S., Jia, X., Xiao, X., Wang, P., Guo, X., & Zhang, Q. (2012). Novel RS1 mutations associated with X-linked juvenile retinoschisis. International Journal of Molecular Medicine, 29, 644-648. https://doi.org/10.3892/ijmm.2012.882
MLA
Yi, J., Li, S., Jia, X., Xiao, X., Wang, P., Guo, X., Zhang, Q."Novel RS1 mutations associated with X-linked juvenile retinoschisis". International Journal of Molecular Medicine 29.4 (2012): 644-648.
Chicago
Yi, J., Li, S., Jia, X., Xiao, X., Wang, P., Guo, X., Zhang, Q."Novel RS1 mutations associated with X-linked juvenile retinoschisis". International Journal of Molecular Medicine 29, no. 4 (2012): 644-648. https://doi.org/10.3892/ijmm.2012.882
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team