Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
June-2018 Volume 41 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2018 Volume 41 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Simvastatin induces apoptosis in PTEN‑haploinsufficient lipoma cells

  • Authors:
    • Franziska Kässner
    • Tina Sauer
    • Melanie Penke
    • Sandy Richter
    • Kathrin Landgraf
    • Antje Körner
    • Wieland Kiess
    • Norman Händel
    • Antje Garten
  • View Affiliations / Copyright

    Affiliations: University Hospital for Children and Adolescents, Center for Pediatric Research Leipzig (CPL), D‑04103 Leipzig, Germany
  • Pages: 3691-3698
    |
    Published online on: March 14, 2018
       https://doi.org/10.3892/ijmm.2018.3568
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Adipose tissue tumors (lipomas) frequently develop in patients with heterozygous germ line phosphatase and tensin homolog (PTEN) mutations. simvastatin has been demonstrated to exhibit antitumor effects, and so the aim of the present study was to assess the effects of simvastatin on the growth of human PTEN haploinsufficient lipoma cells. Whether the effects of simvastatin in lipomas are mediated via PTEN upregulation was also assessed. The results of the present study revealed that simvastatin treatment reduced cell viability and induced apoptosis in human lipoma cells. Furthermore, it was demonstrated that the expression of cellular PTEN mRNA and protein was increased following simvastatin stimulation. In addition, the phosphorylation of protein kinase B and downstream targets of mammalian target of rapamycin and 4E‑binding protein (4E‑BP)‑1 was attenuated. It was also demonstrated that simvastatin induced PTEN transcriptional upregulation by increasing peroxisome proliferator‑activated receptor (PPAR)γ expression. The small interfering RNA‑mediated knockdown of PPARγ abrogated the stimulatory effect of simvastatin on the PTEN protein, but did not influence apoptosis. The results of the present study suggest that simvastatin may be beneficial for patients with inoperable PTEN haploinsufficient lipomas.

Introduction

Benign tumors of adipose tissue are often exhibited in humans with rare phosphatase and tensin homolog (PTEN) Hamartoma Tumor Syndrome (PHTS), which is caused by heterozygous germ line mutations within the tumor suppressor PTEN gene (1). Although noncancerous, these lipomas frequently develop to form extended fatty tissue tumors (lipomatosis), which may infiltrate other tissues and cause numerous side effects, including organ obstruction, resulting in loss of function and chronic pain (2). A previous study assessed a child with a severe PHTS phenotype who exhibited abdominal lipomatosis (3). It was demonstrated that an individual treatment attempt using the mammalian target of rapamycin complex (mTOR)1 inhibitor sirolimus led to an improvement in the patient's general condition and a decrease in thymus size; however, lipomatosis regression was not observed (3). At present, no targeted therapies for the treatment of PHTS-associated lipomatosis exist. Surgical excision of the tumor and symptomatic treatment remain the only form of therapy available (4). There is therefore an urgent need to uncover novel therapeutic approaches for patients with PHTS and non-resectable adipose tissue tumors.

Statins, also known as 3-hydroxy-3-methylglutaryl-CoA reductase inhibitors, are widely utilized to decrease serum cholesterol levels (5). Previous studies have demonstrated that statins elicit numerous non-lipid modifying effects, which have been revealed to exhibit anti-tumor effects in vitro, in vivo and in epidemiological studies (6-9). In particular, simvastatin was demonstrated to increase PTEN protein levels and activity, thus downregulating the activation of the phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) signaling pathway (10-13). Furthermore, a case report of a 54-year-old man described a dramatic reduction of an isolated subcutaneous lipoma associated with simvastatin therapy (14).

The aim of the present study was to assess the effects of simvastatin on three lipoma cell lines, termed lipoma PTEN-deficient 1-3 (LipPD1-3), established from the resected lipoma tissue of pediatric patients with heterozygous germ line PTEN deletion or mutations. It was hypothesized that simv-astatin treatment may lead to attenuated cell growth or the induction of apoptosis in these PTEN haploinsufficient lipoma cells by increasing levels of the PTEN protein.

Materials and methods

Informed consent

Written informed consent was provided by the parents of all patients enrolled in the present study. A total of 3 patients (2 male, 1 female) and 2 healthy control patients (1 male, 1 female), aged 0-18 years were enrolled in the present study. All patients were admitted to the Hospital for Child and Adolescent Medicine (Leipzig University, Leipzig, Germany) and samples were collected between July 2007 and December 2016. Patients with morbidities other than PHTS were excluded. One patients received sirolimus following lipoma resection (3). All LipPD cells used in this study were obtained from lipomatous adipose tissue that was resected for diagnostic and therapeutic reasons. Control primary pre-adipocytes were removed from adipose tissue obtained from pediatric or young adult patients during routine surgery. Ethical approval for these studies was obtained from the Ethics Committee of the University of Leipzig (ref. no. 425-12-171220; Leipzig, Germany).

Cell lines, cell culture and treatments

Genetic analyses of PTEN revealed a heterozygous deletion affecting exons 2-9 of 9 of PTEN in LipPD1 cells (3,15). A heterozygous PTEN mutation was detected in LipPD2 (c.404T>A, p.I135K) and LipPD3 (exon 1, c.76A>C, p.T26P). A schematic presentation of the genetic changes in PTEN is presented in Fig. 1A. The following cells were used as PTEN wild-type controls: Simpson-Golabi-Behmel (SGBS, kindly supplied by Dr M. Wabitsch, University Hospital, Ulm, Germany) (16,17) cells and normal primary pre-adipocytes obtained from pediatric or healthy young adult adipose tissue. All cell strains were established according to protocols as described previously (3,17). Cells were maintained in Dulbecco's Modified Eagle's medium (DMEM)/F12 medium supplemented with 10% fetal calf serum, glutamine (2 mM), biotin (33 mM) and pantothenic acid (17 mM; all from Biochrom, Ltd., Cambridge, UK) at 37°C in a humidified atmosphere containing 5% CO2. InSolution™ simvastatin sodium salt was purchased from EMD Millipore (Billerica, MA, USA). Medium was replaced with serum-free DMEM 24 h prior to cell stimulation with 0, 0.1, 1 and 10 µM simvastatin for 6, 12, 24 or 48 h.

Figure 1

AKT phosphorylation is increased with lower PTEN protein levels in lipoma cells compared with PTEN wild-type pre-adipocytes. (A) Schematic representation of the PTEN protein domains and mutation sites. Heterozygous deletion (LipPD1) or mutations (LipPD2 and LipPD3) of the PTEN gene are depicted. PTEN (B) mRNA and (C) protein expression in mutant lipoma cells (LipPD1-3) in comparison with PTEN wild-type control (SGBS, normal primary) pre-adipocytes. mRNA data were normalized to the Tata box binding protein and Glyceraldehyde-3-phosphate dehydrogenase, respectively. (D) Phosphorylation of AKT (threonine 308) in mutant lipoma cells (LipPD1-3) compared with wild-type control cells. Phosphorylation of AKT was normalized to total AKT levels. All data are presented as the mean ± standard error of the mean. Statistical analysis was performed using a Student's t-test. *P<0.05 vs. the mean of all three PTEN wild-type cells. AKT, protein kinase B; PTEN, phosphatase and tensin homolog; LipPD1-3, lipoma PTEN-deficient 1-3; p, phosphorylated; PDZ, Post synaptic density protein (PSD95), Drosophila disc large tumor suppressor (Dlg1) and zonula occludens-1 protein (ZO-1), PEST, proline (P), glutamic acid (E), serine (S) and threonine (T).

Cell viability and apoptosis

The effect of simvastatin on proliferation was measured using a Cell Proliferation Reagent WST-1 (Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer's protocol. Cells were seeded in 96-well plates at a density of 10,000 cells/cm2 and incubated for 48 h with 0, 0.1, 1 and 10 µM simvastatin. Apoptosis was determined using Annexin V-fluorescein isothiocyanate (FITC; BD Pharmingen; BD Bioscience, San Jose, CA, USA)/propidium iodide (PI) staining according to manufacturer's protocol. Briefly, cells were seeded at a density of 5,000 cells/cm2 and incubated for 48 h with 0, 1 or 10 µM simvastatin. Cells were trypsinized and incubated with Annexin V-FITC/PI for 10 min at 4°C in the dark. Annexin V-FITC-positive cells represent early apoptosis and Annexin V-FITC/PI double positive cells indicate late apoptotic cells.

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

For qPCR analysis mRNA was extracted from LipPD1 cells using the RNeasy mini kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's protocol. A total of 1 µg mRNA was reverse transcribed at 39°C for 1 h into cDNA using M-MLV Reverse Transcriptase (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). PCR reactions were performed using Taqman Mastermix FAST qPCR Master Mix Plus Low ROX (Eurogentec, Liege, Belgium) or Absolute qPCR SYBR-Green Low ROX Mix (Thermo Fisher Scientific, Inc.) and the Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). Primers and probes were designed using the PrimerExpress software version 3.0 (Applied Biosystems; Thermo Fisher Scientific, Inc.) and sequences are presented in Table I. The following thermocycling conditions were used: Activation at 95°C for 15 min, 40 cycles of denaturation at 95°C for 15 sec, annealing at 60°C for 30 sec, elongation at 72°C for 30 sec. A standard curve of serial dilutions of plasmid DNA of the respective target gene was included on each plate. The copy number of each sample was calculated from the standard curve and normalised to the mean of the two housekeeping genes Tata box binding protein (TBP) or hypoxanthine phosphoribosyltransferase (HPRT) expression (18).

Table I

Primer and probe sequences.

Table I

Primer and probe sequences.

GeneDirectionSequence
PTENForward GTTTACCGGCTCAAAT
Reverse CCCCCACTTTCACAGT
PPARγForward GATCCAGTGGTTGCAGATTACAA
Reverse GAGGGAGTTGGAAGGCTCTTC
Probe TGACCTGAAACTTCAAGAGTACCAAAGTGCAA
TBPForward TTGTAAACTTGACCTAAAGACCATTGC
Reverse TTCGTGGCTCTCTTATCCTCATG
Probe AACGCCGAATATAATCCCAAGCGGTTTG
HPRTForward GGCAGTATAATCCAAAGATGGTCAA
Reverse GTCTGGCTTATATCCAACACTTCGT
Probe C AAGCTTGCTGGTGAAAAGGACCCC

[i] PTEN, phosphatase and tensin homolog; PPARγ, peroxisome proliferator-activated receptor; TBP, tata box binding protein, HPRT, hypoxanthine phosphoribosyltransferase.

Western blot analysis

For protein analysis, cells were lysed with modified radioimmunoprecipitation assay buffer [50 mM Tris HCl; pH 7.4; 1% NP-40; 0.25% sodium deoxycholate; 1× Roche complete proteases inhibitor cocktail (Roche Diagnostics GmbH); 1 mM EDTA; 1 mM sodium orthovana-date; and 1 mM sodium fluoride], protein concentrations were determined using a DC protein assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA) and proteins (20 µg/lane) were separated by 10% SDS-PAGE. Following semi-dry transfer onto nitrocellulose membranes, membranes were blocked using 5% non-fat dry milk in TBS buffer containing 0.1% Tween-20 (TBST) for 1 h at room temperature. Blots were then incubated overnight at 4°C with the appropriate primary antibody. The antibodies utilized in western blotting are summarized in Table II. Blots were washed three times for 5 min with TBST and incubated with horseradish peroxidase (HRP)-goat anti rabbit (P-0448) or HRP-goat anti mouse (P-0447 antibodies (Dako; Agilent Technologies, Inc., Santa Clara, CA, USA) at a dilution of 1:2,000 for 2 h at room temperature. Protein bands were detected using Luminata Classico Western horseradish peroxidase Substrate (EMD Millipore) or Amersham ECL Prime Western Blotting Detection Reagent (GE Healthcare, Chicago, IL, USA). Glyceraldehyde-3-phosphate dehydrogenase (EMD Millipore) was used as a loading control. ImageJ 1.41 was used for densitometric analysis (National Institutes of Health, Bethesda, MD, USA).

Table II

Primary antibodies utilized in western blotting.

Table II

Primary antibodies utilized in western blotting.

AntibodySupplierCat. no.Dilution
4E-BP1NEB96441:1,000
Phospho-4E-BP1 (Threonine 37/46)NEB28551:1,000
AKTNEB92721:1,000
Phospho-AKT (Threonine 308)NEB40561:1,000
Phospho-AKT (Serine 473)NEB40601:1,000
GAPDHMerck KGaAMAB3741:100,000
p44/42 MAPK (ERK1/2)NEB91021:1,000
Phospho-p44/42 mitogen activated proteinNEB91011:1,000
kinase (ERK1/2) (Threonine 202/Tyrosine 204)
mTORNEB29831:1,000
Phospho-mTOR (Serine 2448)NEB29711:1,000
Peroxisome proliferator-activated receptor γNEB24431:1,000
Phosphatase and tensin homologNEB95591:1,000

[i] NEB is located in Ipswich, MA, USA. Merck KGaA is located in Darmstadt, Germany. 4E-BP1, 4E-binding protein-1; phospho, phosphory-lated; AKT, protein kinase B; ERK, extracellular signal-related kinase; mTOR, mammalian target of rapamycin.

Small interfering (si)RNA-mediated knockdown of PPARγ

LipPD1 cells were microporated using the Neon Transfection System 100 µl kit (Invitrogen; Thermo Fisher Scientific, Inc.) with the PPARγ ON-TARGETplus SMARTpool siRNA reagent and the respective negative control (ON-TARGETplus control pool; GE Healthcare Dharmacon, Inc., Lafayette, CO, USA) as previously described (18). A total of 106 cells were transfected with siRNA at a final concentration of 500 nmol/l, seeded at a density of 105 cells/well in 6 well plates and cultured for 24 h. The following day, the culture medium was replaced with serum-free DMEM for 24 h. Cells were then stimulated using simvastatin (10 µM) as above.

Statistical analysis

Data are presented as the mean ± standard error of the mean of at least three independent experiments. Significant differences were determined using GraphPad Prism 6 software (GraphPad Software, Inc., La Jolla, CA, USA) and the unpaired Student's t-test or one-way analysis of variance followed by a post hoc Bonferroni multiple comparison test. P<0.05 was considered to indicate a statistically significant difference.

Results

Decreased PTEN protein levels and enhanced AKT in PTEN deficient lipoma cells

Basal PTEN mRNA and protein levels were analyzed to assess the impact of the heterozygous PTEN deletions or mutations (Fig. 1A) on lipoma cells. Lipoma cells with a large heterozygous PTEN deletion (3) possessed a significantly lower PTEN mRNA expression compared with PTEN wild-type control pre-adipocytes (P<0.05; Fig. 1B). PTEN mRNA expression was similar in lipoma cells with PTEN point mutations and non-mutant cells (Fig. 1B). However, in all three lipoma cell cultures, PTEN protein levels were lower compared with PTEN wild-type control cells (P<0.05; Fig. 1C). It was then assessed whether reduced PTEN protein levels led to enhanced AKT phosphorylation. Mutation-positive cells exhibited significantly higher levels of phosphorylated AKT (Thr308) compared with control cells (LipPD1 and LipPD3; P<0.05) (Fig. 1D).

Simvastatin treatment induces apoptosis in lipoma cells

The effect of simvastatin on the viability of lipoma cells was determined following incubation for 24, 48 and 72 h (Fig. 2A). Simvastatin at 10 µM significantly decreased the viability of LipPD1, LipPD2 and LipPD3 cells to 67.5±8.3, 68.0±14.3 and 64.0±9.2% at 48 h and to 42.3±8.8%, 43.3±14.0% and 37.2±6.9% at 72 h incubation, (P<0.05; Fig. 2A and B). At the same dose and incubation time, simvastatin induced apoptosis by 28% in LipPD1 compared with LipPD1 cells incubated without simvastatin (Fig. 2C). Following incubation with 10 µM simvastatin, cells were equally distributed between early and late apoptotic phases. No effect on cell viability was observed following an incubation of 24 h (data not shown).

Figure 2

Simvastatin treatment decreased lipoma cell viability and induced apoptosis. LipPD1-3 cells were incubated with increasing doses of simvastatin. Cell viability was measured using a WST-1 assay following (A) 48 and (B) 72 h incubation. Data were normalized to the untreated control. (C) LipPD1 cells were stained with Annexin V/propidium iodide following 48 h incubation with simvastatin and apoptosis was assessed. Data are presented as the mean ± standard error of the mean of three independent experiments. Statistical analysis was performed using one-way analysis of variance and the post-hoc Bonferroni test. *P<0.05 vs. untreated cells. LipPD1-3, lipoma phosphatase and tensin homolog-deficient 1-3.

Simvastatin treatment decreases AKT/mTOR activation

Previous studies have demonstrated that simvastatin upregulates PTEN transcription (8-10), and so PTEN mRNA expression in lipoma cells was assessed following incubation with simvastatin. Stimulation with 10 µM simvastatin resulted in a significant increase in the expression of PTEN mRNA to 1.4±0.1-fold in LipPD1 compared with control cells following a 6 h incubation (P<0.05; data not shown). The effect of simvastatin on the PTEN protein and AKT/mTOR pathway activation following 6, 12, 24 and 48 h of incubation was then assessed. Simvastatin (10 µM) resulted in an increase in phosphorylated and total PTEN protein levels in LipPD1 cells when incubated for 24 h (Fig. 3A–C). In addition, a downregulation in AKT phosphorylation at T308 and S473 (Fig. 3A, D and E) was observed following 24 and 48 h incubation. The activation of mTOR, a downstream target of AKT, was then examined. The results demonstrated that 48 h incubation with 10 µM simvastatin significantly decreased mTOR1 phosphorylation at Ser2448 by 48.8±1.2% (P<0.05; Fig. 3F and G) and phosphorylation of the mTOR target 4E-binding protein-1 (4EBP-1) by 64.9±1.2% (P<0.05; Fig. 3F and H). Increased PTEN protein levels were also observed in LipPD2 and LipPD3 cells following 6 h of incubation with 10 µM simvastatin (both P<0.05; data not shown). These results indicate that simvastatin incubation affects PTEN protein levels and AKT/mTOR activation in a time-dependent manner.

Figure 3

Simvastatin treatment decreased AKT/mTOR activation following prolonged treatment. (A) LipPD1 cells were stimulated with 10 µM simvastatin in culture medium for 6, 12, 24 or 48 h. PTEN mRNA expression was quantified using reverse transcriptase polymerase chain reactions. Data were normalized to TBP and then compared with the expression level exhibited in the untreated controls. Relative expression of (B) phospho PTEN, (C) PTEN, (D) phospho AKT and (E) total AKT. (F) LipPD1 cells were stimulated with 10 µM simvastatin in culture medium for 48 h. Relative expression of (G) mTOR (Ser2448) and (H) 4E-BP1 (Thr37/46) were calculated. All data are presented as the mean ± standard error of the mean. Statistical analysis was performed using a Student's t-test or one-way analysis of variance with a post hoc Bonferroni test. *P<0.05 vs. untreated cells. AKT, protein kinase B; mTOR, mammalian target of rapamycin; PTEN, phosphatase and tensin homolog; phospho, phosphorylated; LipPD1-3, lipoma PTEN-deficient 1-3; TBP, Tata box binding protein; Ser, Serine; Thr, threonine; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; pAKT, phosphorylated AKT; 4E-BP1, 4E-binding protein-1; pmTOR, phosphorylated mTOR; p4E-BP1, phosphorylated 4E-BP1.

PPARγ mediates simvastatin action on PTEN protein expression, but not on apoptosis

The present study aimed to identify the mediators of simvastatin. Previous studies have demonstrated that simvastatin acts through the activation of nuclear factor (NF)κB (9,13,19). However, in the present study, no significant effect on NF-κB phosphorylation was observed following incubation with simvastatin (data not shown). Additionally, no significant upregulation of the NF-κB target protein B-cell lymphoma-2 (13,20,21) was detected (data not shown). Previous studies have indicated the ability of the transcriptional regulator PPARγ to induce PTEN mRNA (22-25). The results of the present study demonstrated that a 6 h simvastatin incubation significantly upregulated LipPD1 cell PPARγ protein expression by 1.88±0.3-fold (P<0.05; Fig. 4A). It was then determined whether knockdown of PPARγ abrogated the stimulatory effect of simvastatin on PTEN levels. siRNA-mediated knockdown of PPARγ to 34.8±1.2% was confirmed at the protein level (Fig. 4B) and this knockdown significantly attenuated the upregulation of PTEN mRNA and protein induced by simvastatin (P<0.05; Fig. 4C). These results indicate that simvastatin induces PTEN expression in a PPARγ-dependent manner in LipPD1 cells. Furthermore, the present study assessed whether PPARγ knockdown would effect simvastatin-induced apoptosis. No significant differences in apoptosis induction or in the distribution of cells between early and late apoptotic phases were identified in PPARγ-knockdown cells compared with control-transfected cells following stimulation with simvastatin (Fig. 4D).

Figure 4

PPARγ knockdown attenuates simvastatin-induced upregulation of the PTEN protein and has no effect on apoptosis. (A) LipPD1 cells were incubated with 10 µM simvastatin in culture medium for 6 h. PPARγ protein levels were quantified using western blot analysis and normalized to GAPDH. LipPD1 cells were then transfected with siRNA against PPARγ (siPPARγ+) or non-targeted control siRNA (scrambled). (B) Knockdown of PPARγ was confirmed using western blot analysis. (C) PTEN protein levels of cells transfected with PPARγ siRNA or non-targeted control siRNA following incubation with simvastatin or vehicle were assessed. (D) Induction of apoptosis following transfection with PPARγ siRNA or non-targeted control siRNA. Apoptosis was detected using Annexin V/propidium iodide staining. Data are presented as the mean ± standard error of the mean. Statistical analysis was performed using Student's t-test. *P<0.05 vs. control cells; #P<0.05 vs. simvastatin-treated cells. PPARγ, peroxisome proliferator-activated receptor; PTEN, phosphatase and tensin homolog; LipPD1, lipoma PTEN-deficient 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; siRNA, small interfering RNA.

Discussion

At present, treatment options for patients with non-resectable PHTS-associated lipomatosis are limited. Sirolimus, an inhibitor of mTOR1, was successfully used to treat patients with other PHTS-associated complications (23-25). However, it was not effective at reducing lipoma growth in a patient with PHTS due to the heterozygous germ line deletion of PTEN (3). The aim of the present study was to test the effects of simvastatin on the growth of human lipoma cells derived from tumors with heterozygous mutations or deletions of PTEN. Simvastatin was selected for use as it has been demonstrated to exert anti-proliferative and growth-inhibitory actions on a number of cancer cell lines and tumor animal models (6,7,10,18,22,26-30). In accordance with these results, the present study demonstrated that simvastatin reduced the viability of PTEN mutant lipoma cells by inducing apoptosis in a time- and dose-dependent manner.

A potential mechanism of simvastatin action is the increase of PTEN protein levels and consequent suppression of AKT/mTOR signaling. This has been addressed by previous studies in various tissues, cancer cell lines and cancer xenograft animal models (8-10). In accordance with previous studies using tissues harvested from patients with PHTS (28,34), the results of the present study demonstrated that PTEN protein levels are reduced and AKT activation is increased in PTEN mutant lipoma cell cultures compared with PTEN wild-type cells. Furthermore, decreased PTEN mRNA levels were only identified in lipoma cells with a large heterozygous PTEN deletion (LipPD1 cells) and not in lipoma cells with heterozygous PTEN mutations (LipPD2 and LipPD3 cells). This contrast between normal mRNA expression and low protein levels may indicate the occurrence of a post-transcriptional event, such as increased protein degradation, due to mutations in PTEN.

Simvastatin treatment resulted in a transient upregulation of PTEN mRNA and protein levels in lipoma cells. In the present study, it was investigated by which mechanism simvastatin mediated this effect. The transcriptional regulator PPARγ has previously been reported to upregulate the transcription of PTEN and thereby influence AKT phosphorylation in non-malignant and cancer cells (10,19-22). The results of the present study demonstrate that PPARγ exhibits a similar expression pattern to PTEN following simvastatin stimulation of lipoma cells. However, the transient knockdown of PPARγ abrogated the increase in lipoma cell PTEN protein levels following simvastatin treatment. Additionally, PPARγ knockdown had no effect on simvastatin-mediated induction of apoptosis. This is in contrast to previous studies, which demonstrated that the induction of apoptosis by PPARγ agonists occurs via the upregulation of PTEN (10,19,22,32-34).

Previous studies have reported various pathways by which simvastatin affects cell viability that are dependent on the inhibition of the cholesterol biosynthesis pathway, including the attenuation of NF-κB activation by a decrease in intracellular isoprenoid concentrations followed by impaired inner membrane attachment and Ras, Rac or Rho protein function (32,33). However, the lipoma cells used in the present study did not exhibit a decrease in NF-κB phosphorylation following incubation with simvastatin. The action of simvas-tatin in prostate cancer cells may be associated with decreasing cellular cholesterol levels, leading to altered membrane lipid raft structures, causing a reduction in AKT phosphorylation and thus resulting in apoptosis (38). This effect of simvastatin on caveolar raft structures has also been demonstrated in adipocytes (39). In accordance with this, the present study detected a decrease in AKT, mTOR and the mTOR target 4EBP-1 phosphorylation following prolonged treatment with simvastatin.

In conclusion, the results of the present study support the hypothesis that simvastatin treatment reduces the growth of lipoma cells and may be a promising candidate for the treatment of lipomatosis associated with PTEN haploinsufficiency. However, the effects of simvastatin are not mediated by PPARγ-facilitated upregulation of PTEN in lipoma cells. Further studies in suitable animal models are required to evaluate the use of simvastatin treatment in patients with lipomatosis associated with PTEN haploinsufficiency.

Acknowledgments

Not applicable.

Abbreviations:

4E-BP-1

4E-binding protein

mTOR

mammalian target of rapamycin

PTEN

phosphatase and tensin homologue

PHTS

PTEN hamartoma tumor syndrome

PI3K

phosphatidylinositol 3-kinase

PPARγ

peroxisome proliferator-activated receptor gamma

siRNA

small interfering RNA

Notes

[1] Funding

The present study was supported by the Mitteldeutsche Kinderkrebsforschung (to FK), the European Union's Horizon 2020 research and innovation program under the Marie Sklodowska-Curie agreement (grant no. 705869; to AG) and from Deutsche Forschungsgemeinschaft/Collaborative Research Centre SFB1052/B10 (to AG and WK).

[2] Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

[3] Authors' contributions

AG and NH conceived the study. AG, NH and FK designed the study and provided a major contribution to writing the manuscript. AG, NH, FK, TS and MP analysed data. WK interpreted patient data and discussed results. KL and AK provided expertise on adipocyte culture and knockdown experiments. FK, TS and SR performed experiments. All authors read and approved the final manuscript.

[4] Ethics approval and consent to participate

Ethical approval for these studies was obtained from the Ethics Committee of the University of Leipzig (ref. no. 425-12-171220; Leipzig, Germany). Written informed consent was provided by the parents of all patients enrolled in the present study.

[5] Consent for publication

Not applicable.

[6] Competing interests

The authors declare that they have no competing interests.

References

1 

Eng C: PTEN: One gene, many syndromes. Hum Mutat. 22:183–98. 2003. View Article : Google Scholar : PubMed/NCBI

2 

Tan MH, Mester JL, Ngeow J, Rybicki LA, Orloff MS and Eng C: Lifetime cancer risks in individuals with germline PTEN mutations. Clin Cancer Res. 18:400–407. 2012. View Article : Google Scholar :

3 

Schmid GL, Kässner F, Uhlig HH, Körner A, Kratzsch J, Händel N, Zepp FP, Kowalzik F, Laner A, Starke S, et al: Sirolimus treatment of severe PTEN hamartoma tumor syndrome: Case report and in vitro studies. Pediatr Res. 75:527–534. 2014. View Article : Google Scholar

4 

Hollander MC, Blumenthal GM and Dennis PA: PTEN loss in the continuum of common cancers, rare syndromes and mouse models. Nat Rev Cancer. 11:289–301. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Mauro VF and MacDonald JL: Simvastatin: A review of its pharmacology and clinical use. DICP. 25:257–64. 1991. View Article : Google Scholar : PubMed/NCBI

6 

Desai CS, Martin SS and Blumenthal RS: Non-cardiovascular effects associated with statins. BMJ. 349:g37432014. View Article : Google Scholar : PubMed/NCBI

7 

Zhong S, Zhang X, Chen L, Ma T, Tang J and Zhao J: Statin use and mortality in cancer patients: Systematic review and meta-analysis of observational studies. Cancer Treat Rev. 41:554–567. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Nielsen SF, Nordestgaard BG and Bojesen SE: Statin use and reduced cancer-related mortality. N Engl J Med. 367:1792–1802. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Campbell MJ, Esserman LJ, Zhou Y, Shoemaker M, Lobo M, Borman E, Baehner F, Kumar AS, Adduci K, Marx C, et al: Breast cancer growth prevention by statins. Cancer Res. 66:8707–8714. 2006. View Article : Google Scholar : PubMed/NCBI

10 

Fang Z, Tang Y, Fang J, Zhou Z, Xing Z, Guo Z, Guo X, Wang W, Jiao W, Xu Z and Liu Z: Simvastatin inhibits renal cancer cell growth and metastasis via AKT/mTOR, ERK and JAK2/STAT3 pathway. PLoS One. 8:e628232013. View Article : Google Scholar : PubMed/NCBI

11 

Wang T, Seah S, Loh X, Chan CW, Hartman M, Goh BC and Lee SC: Simvastatin-induced breast cancer cell death and deactivation of PI3K/Akt and MAPK/ERK signalling are reversed by metabolic products of the mevalonate pathway. Oncotarget. 7:2532–2544. 2016.

12 

Chen YQ, Zhao LY, Zhang WZ and Li T: Simvastatin reverses cardiomyocyte hypertrophy via the upregulation of phosphatase and tensin homolog expression. Exp Ther Med. 10:797–803. 2015. View Article : Google Scholar : PubMed/NCBI

13 

Ghosh-Choudhury N, Mandal CC, Ghosh-Choudhury N and Ghosh Choudhury G: Simvastatin induces derepression of PTEN expression via NFkappaB to inhibit breast cancer cell growth. Cell Signal. 22:749–58. 2010. View Article : Google Scholar : PubMed/NCBI

14 

Self TH and Akins D: Dramatic reduction in lipoma associated with statin therapy. J Am Acad Dermatol. 58(2 Suppl): S30–S31. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Wilhelm F, Kässner F, Schmid G, Kratzsch J, Laner A, Wabitsch M, Körner A, Kiess W and Garten A: Phosphatidylinositol 3-kinase (PI3K) signalling regulates insulin-like-growth factor binding protein-2 (IGFBP-2) production in human adipocytes. Growth Horm IGF Res. 25:115–120. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Fischer-Posovszky P, Newell FS, Wabitsch M and Tornqvist HE: Human SGBS cells-a unique tool for studies of human fat cell biology. Obes Facts. 1:184–189. 2008. View Article : Google Scholar

17 

Wabitsch M, Brenner RE, Melzner I, Braun M, Möller P, Heinze E, Debatin KM and Hauner H: Characterization of a human preadipocyte cell strain with high capacity for adipose differentiation. Int J Obes Relat Metab Disord. 25:8–15. 2001. View Article : Google Scholar : PubMed/NCBI

18 

Bernhard F, Landgraf K, Klöting N, Berthold A, Büttner P, Friebe D, Kiess W, Kovacs P, Blüher M and Körner A: Functional relevance of genes implicated by obesity genome-wide association study signals for human adipocyte biology. Diabetologia. 56:311–322. 2013. View Article : Google Scholar

19 

Tu J, Li W, Zhang Y, Wu X, Song Y, Kang L, Liu W, Wang K, Li S, Hua W and Yang C: Simvastatin inhibits IL-1β-induced apoptosis and extracellular matrix degradation by suppressing the NF-κB and MAPK pathways in nucleus pulposus cells. Inflammation. 40:725–734. 2017. View Article : Google Scholar : PubMed/NCBI

20 

Spampanato C, De Maria S, Sarnataro M, Giordano E, Zanfardino M, Baiano S, Cartenì M and Morelli F: Simvastatin inhibits cancer cell growth by inducing apoptosis correlated to activation of Bax and downregulation of BCL-2 gene expression. Int J Oncol. 40:935–941. 2012. View Article : Google Scholar

21 

Åberg M, Wickström M and Siegbahn A: Simvastatin induces apoptosis in human breast cancer cells in a NFκB-dependent manner and abolishes the anti-apoptotic signaling of TF/FVIIa and TF/FVIIa/FXa. Thromb Res. 122:191–202. 2008. View Article : Google Scholar

22 

Pi WF, Guo XJ, Su LP and Xu WG: Troglitazone upregulates PTEN expression and induces the apoptosis of pulmonary artery smooth muscle cells under hypoxic conditions. Int J Mol Med. 32:1101–1109. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Farrow B and Evers BM: Activation of PPARgamma increases PTEN expression in pancreatic cancer cells. Biochem Biophys Res Commun. 301:50–53. 2003. View Article : Google Scholar : PubMed/NCBI

24 

Vella V, Nicolosi ML, Giuliano S, Bellomo M, Belfiore A and Malaguarnera R: PPAR-γ agonists as antineoplastic agents in cancers with dysregulated IGF axis. Front Endocrinol (Lausanne). 8:312017.

25 

Wang G, Cao R, Wang Y, Qian G, Dan HC, Jiang W, Ju L, Wu M, Xiao Y and Wang X: Simvastatin induces cell cycle arrest and inhibits proliferation of bladder cancer cells via PPARγ signalling pathway. Sci Rep. 6:357832016. View Article : Google Scholar

26 

Marsh DJ, Trahair TN, Martin JL, Chee WY, Walker J, Kirk EP, Baxter RC and Marshall GM: Rapamycin treatment for a child with germline PTEN mutation. Nat Clin Pract Oncol. 5:357–361. 2008.PubMed/NCBI

27 

Iacobas I, Burrows PE, Adams DM, Sutton VR, Hollier LH and Chintagumpala MM: Oral rapamycin in the treatment of patients with hamartoma syndromes and PTEN mutation. Pediatr Blood Cancer. 57:321–323. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Heindl M, Händel N, Ngeow J, Kionke J, Wittekind C, Kamprad M, Rensing-Ehl A, Ehl S, Reifenberger J, Loddenkemper C, et al: Autoimmunity, intestinal lymphoid hyperplasia, and defects in mucosal B-cell homeostasis in patients with PTEN hamartoma tumor syndrome. Gastroenterology. 142:1093–1096.e6. 2012. View Article : Google Scholar : PubMed/NCBI

29 

Relja B, Meder F, Wilhelm K, Henrich D, Marzi I and Lehnert M: Simvastatin inhibits cell growth and induces apoptosis and G0/G1 cell cycle arrest in hepatic cancer cells. Int J Mol Med. 26:735–741. 2010. View Article : Google Scholar : PubMed/NCBI

30 

Liang Z, Li W, Liu J, Li J, He F, Jiang Y, Yang L, Li P, Wang B, Wang Y, et al: Simvastatin suppresses the DNA replication licensing factor MCM7 and inhibits the growth of tamoxifen-resistant breast cancer cells. Sci Rep. 7:417762017. View Article : Google Scholar : PubMed/NCBI

31 

Wang ST, Ho HJ, Lin JT, Shieh JJ and Wu CY: Simvastatin-induced cell cycle arrest through inhibition of STAT3/SKP2 axis and activation of AMPK to promote 27 and 21 accumulation in hepatocellular carcinoma cells. Cell Death Dis. 8:e26262017. View Article : Google Scholar

32 

Cafforio P, Dammacco F, Gernone A and Silvestris F: Statins activate the mitochondrial pathway of apoptosis in human lymphoblasts and myeloma cells. Carcinogenesis. 26:883–891. 2005. View Article : Google Scholar : PubMed/NCBI

33 

Denoyelle C, Vasse M, Körner M, Mishal Z, Ganné F, Vannier JP, Soria J and Soria C: Cerivastatin, an inhibitor of HMG-CoA reductase, inhibits the signaling pathways involved in the invasiveness and metastatic properties of highly invasive breast cancer cell lines: An in vitro study. Carcinogenesis. 22:1139–1148. 2001. View Article : Google Scholar : PubMed/NCBI

34 

Chen HH, Händel N, Ngeow J, Muller J, Hühn M, Yang HT, Heindl M, Berbers RM, Hegazy AN, Kionke J, et al: Immune dysregulation in patients with PTEN hamartoma tumor syndrome: Analysis of FOXP3 regulatory T cells. J Allergy Clin Immunol. 139:607–620.e15. 2017. View Article : Google Scholar

35 

Lin CF, Young KC, Bai CH, Yu BC, Ma CT, Chien YC, Chiang CL, Liao CS, Lai HW and Tsao CW: Rosiglitazone regulates anti-inflammation and growth inhibition via PTEN. Biomed Res Int. 2014:7879242014.PubMed/NCBI

36 

Aiello A, Pandini G, Frasca F, Conte E, Murabito A, Sacco A, Genua M, Vigneri R and Belfiore A: Peroxisomal proliferator-activated receptor-gamma agonists induce partial reversion of epithelial-mesenchymal transition in anaplastic thyroid cancer cells. Endocrinology. 147:4463–4475. 2006. View Article : Google Scholar : PubMed/NCBI

37 

Han S and Roman J: Rosiglitazone suppresses human lung carcinoma cell growth through PPARgamma-dependent and PPARgamma-independent signal pathways. Mol Cancer Ther. 5:430–437. 2006. View Article : Google Scholar

38 

Zhuang L, Kim J, Adam RM, Solomon KR and Freeman MR: Cholesterol targeting alters lipid raft composition and cell survival in prostate cancer cells and xenografts. J Clin Invest. 115:959–968. 2005. View Article : Google Scholar : PubMed/NCBI

39 

Khan T, Hamilton MP, Mundy DI, Chua SC and Scherer PE: Impact of simvastatin on adipose tissue: Pleiotropic effects in vivo. Endocrinology. 150:5262–5272. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Kässner F, Sauer T, Penke M, Richter S, Landgraf K, Körner A, Kiess W, Händel N and Garten A: Simvastatin induces apoptosis in PTEN‑haploinsufficient lipoma cells. Int J Mol Med 41: 3691-3698, 2018.
APA
Kässner, F., Sauer, T., Penke, M., Richter, S., Landgraf, K., Körner, A. ... Garten, A. (2018). Simvastatin induces apoptosis in PTEN‑haploinsufficient lipoma cells. International Journal of Molecular Medicine, 41, 3691-3698. https://doi.org/10.3892/ijmm.2018.3568
MLA
Kässner, F., Sauer, T., Penke, M., Richter, S., Landgraf, K., Körner, A., Kiess, W., Händel, N., Garten, A."Simvastatin induces apoptosis in PTEN‑haploinsufficient lipoma cells". International Journal of Molecular Medicine 41.6 (2018): 3691-3698.
Chicago
Kässner, F., Sauer, T., Penke, M., Richter, S., Landgraf, K., Körner, A., Kiess, W., Händel, N., Garten, A."Simvastatin induces apoptosis in PTEN‑haploinsufficient lipoma cells". International Journal of Molecular Medicine 41, no. 6 (2018): 3691-3698. https://doi.org/10.3892/ijmm.2018.3568
Copy and paste a formatted citation
x
Spandidos Publications style
Kässner F, Sauer T, Penke M, Richter S, Landgraf K, Körner A, Kiess W, Händel N and Garten A: Simvastatin induces apoptosis in PTEN‑haploinsufficient lipoma cells. Int J Mol Med 41: 3691-3698, 2018.
APA
Kässner, F., Sauer, T., Penke, M., Richter, S., Landgraf, K., Körner, A. ... Garten, A. (2018). Simvastatin induces apoptosis in PTEN‑haploinsufficient lipoma cells. International Journal of Molecular Medicine, 41, 3691-3698. https://doi.org/10.3892/ijmm.2018.3568
MLA
Kässner, F., Sauer, T., Penke, M., Richter, S., Landgraf, K., Körner, A., Kiess, W., Händel, N., Garten, A."Simvastatin induces apoptosis in PTEN‑haploinsufficient lipoma cells". International Journal of Molecular Medicine 41.6 (2018): 3691-3698.
Chicago
Kässner, F., Sauer, T., Penke, M., Richter, S., Landgraf, K., Körner, A., Kiess, W., Händel, N., Garten, A."Simvastatin induces apoptosis in PTEN‑haploinsufficient lipoma cells". International Journal of Molecular Medicine 41, no. 6 (2018): 3691-3698. https://doi.org/10.3892/ijmm.2018.3568
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team