Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
December-2018 Volume 42 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2018 Volume 42 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

In vitro free radical scavenging capacity of dimethylglycine sodium salt and its protective ability against oleic acid hydroperoxide-induced oxidative damage in IPEC-J2 cells

  • Authors:
    • Kaiwen Bai
    • Luyi Jiang
    • Ligen Zhang
    • Yongwei Zhao
    • Yi Lu
    • Jingya Zhu
    • Jie Cai
    • Lili Zhang
    • Tian Wang
  • View Affiliations / Copyright

    Affiliations: College of Animal Science and Technology, Nanjing Agricultural University, Nanjing, Jiangsu 210095, P.R. China, College of Animal Science, Zhejiang University, Hangzhou, Zhejiang 310000, P.R. China
  • Pages: 3447-3458
    |
    Published online on: September 13, 2018
       https://doi.org/10.3892/ijmm.2018.3876
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The aim of the present study was to evaluate the in vitro free radical scavenging capacity of dimethylglycine sodium (DMG‑Na) and its protective ability against oleic acid hydroperoxide (OAHPx)‑induced oxidative damage in IPEC‑J2 cells. Initially, the free radical scavenging activities of water‑soluble pigments (DMG‑Na, betalain, capsanthin and cyanidin‑3‑rutinoside) were measured and compared with those of Trolox. Subsequently, freshly collected swine blood was mixed with heparin and centrifuged to obtain erythrocytes. In order to induce the free radical chain oxidation in erythrocytes, the aqueous peroxyl radicals were generated by thermal decomposition of 2,2'‑azobis(2‑amidinopropane) dihydrochloride (AAPH) in oxygen. A 2% suspension of porcine erythrocytes in PBS buffer were pre‑incubated for 30 min at 37˚C with DMG‑Na (32 µM), followed by incubation with or without AAPH (75 mM) for 5 h with gentle shaking. Additionally, IPEC‑J2 cells were randomly assigned to four groups (n=6 per group): Cells treated with phosphate buffered saline (PBS); cells treated with DMG‑Na (32 µM); cells treated with oleic acid hydroperoxides (OAHPx, 20 µM; TO group); cells treated with DMG‑Na (32 µM) followed by OAHPx (20 µM; DTO group). The cells were cultured in Dulbecco's modified Eagle's medium, Ham's F‑12 mixture, 1.5 mM HEPES, 5% (v/v) fetal bovine serum, 1% (v/v) insulin‑transferrin‑selenium mixture, 1% (v/v) penicillin‑streptomycin mixture and 2.5 µg/ml fungizone (37˚C, 5% CO2). The results showed that DMG‑Na exerted the strongest free radical scavenging capacity at 0.32 M from 0.08‑0.64 M, and that it could prevent AAPH‑induced porcine erythrocyte hemolysis by increasing its antioxidant capacity (P<0.05). The results also demonstrated that antioxidant capacity and antioxidant‑associated gene expression increased in the DTO group relative to the TO group (P<0.05), indicating that DMG‑Na prevented the OAHPx‑induced oxidative damage in IPEC‑J2 cells by improving the antioxidant capacity and antioxidant‑associated gene expression.

Introduction

Dimethylglycine sodium (DMG-Na) has the ability to improve cellular antioxidant capacity; thus, treatment with DMG-Na may prevent intracellular oxidative damage by scavenging excess free radicals in cells (1,2). Indeed, previous studies have indicated that DMG can reduce oxidative damage and improve animal growth performance (3). Oxidative damage induced by the imbalance of the antioxidant and free radical generation systems can increase the level of reactive oxygen species (ROS), leading to tissue damage (4). Previous studies have indicated that the generation of free radicals is likely one mechanism that leads to the development of diseases, including cancer and neuronal disorders (5,6). ROS, specifi-cally, are generated along with adenosine triphosphate in the mitochondria (7). The production of excess ROS results in an imbalance in cellular redox states, which leads to a decrease in the mitochondrial membrane potential (MMP) and a disorder in mitochondrial functioning (8). There is a complex system of natural enzymatic and non-enzymatic antioxidants in the human body that defend against oxidative damage caused by free radicals and oxidative materials. Recent studies have suggested that dietary supplementation with antioxidants may be beneficial in preventing diseases and improving quality of life (2). Antioxidant enzymes or natural products can reduce oxidative damage via their antioxidation capabilities.

The small intestine is the most important digestive organ, and is the first organ damaged when oxidative stress occurs (9). Previous studies have indicated that the generation of free radicals is one of the main mechanisms that lead to many diseases, including gastrointestinal diseases (4). Lipid peroxi-dation is one of the major causes of oxidative damage, which can contribute to the development of oxygen radical-related damages via increasing level of ROS. Oxidative stress often leads to serious damage to the gastrointestinal tract; therefore, it was proposed that oxidative stress is associated with the clinical risk of gastrointestinal damage failure (10,11). It has been suggested that dietary supplementation with non-enzymatic antioxidants may be beneficial in preventing diseases and improving quality of life. Few studies have focused on the effects of DMG-Na on the small intestine due to the complexity of designing and developing proper human trials. The use of cell cultures is a valid method to overcome this challenge. Particularly, IPEC-J2 cells, which exhibit the properties of normal intestinal epithelium, have been widely used as a suitable model to simulate the gastrointestinal system (12-14). The present study was designed to evaluate the protective effects of DMG-Na against oxidative damage in IPEC-J2 cells, which would provide a potential solution for the prevention and treatment of intestinal damage via enhancing the antioxidant capacity, increasing the antioxidant-associated gene expression, relieving mitochondrial dysfunction and suppressing apoptosis.

Materials and methods

Radical scavenging assay

1,1-diphenyl-2-pierylhydrazy (DPPH) radical scavenging activity was calculated according to the method described by Moon and Shibamoto (15). The absorbance was determined with a spectrophotometer at 517 nm and the formula is as follows: DPPH radical scavenging activity (%) = (Acontrol-Asample)/Acontrol x100; where Acontrol was the absorbance of control and Asample was the absorbance of water-soluble pigments (DMG-Na, betalain, capsanthin, and cyanidin-3-rutinoside) or Trolox.

2,2'-Azinobis-(3-ethylbenzthiazoline-6-sulphonate) (ABTS+) assay

The ABTS+ radical scavenging activity was measured according to the method of Siddhuraju and Manian (16). The absorbance was recorded with a spectrophotometer at 534 nm and the formula is as follows: ABTS+ radical scavenging activity (%) = (Acontrol-Asample)/Acontrol x100. Where Acontrol was the absorbance of control and Asample was the absorbance of water-soluble pigments or Trolox.

Superoxide radical (O2-) assay

O2- scavenging activity was determined using the method of Chen and Yen (17). The absorbance was determined with a spectrophotometer at 560 nm and the formula is as follows: O2- scavenging activity (%) = (Acontrol-Asample)/Acontrol x100. Where Acontrol was the absorbance of control and Asample was the absorbance of water-soluble pigments or Trolox.

Hydrogen peroxide (H2O2) assay

The H2O2 scavenging activity was performed following the procedure of Zhang et al (18). The absorbance was recorded with a spectrophotometer at 230 nm and the formula is as follows: H2O2 scavenging activity (%) = (Acontrol-Asample)/Acontrol x100. Where Acontrol was the absorbance of control and Asample was the absorbance of water-soluble pigments or Trolox.

Ferric-reducing antioxidant power (FRAP) assay

The ferric reducing antioxidant power of water-soluble pigments or Trolox was measured according to the method described by Benzie and Strain (19). The absorbance at 593 nm was calculated with a spectrophotometer. The reducing power was expressed as µmol Fe(II)/g fresh weight. A standard curve of FeSO4·7H2O was used for calibration.

Assay for hemolysis of porcine erythrocytes

Freshly collected swine blood, obtained from a single genetic line [swine from Yangzhou Fangling Agricultural and Pastoral Co., Ltd. (Yangzhou, China); all procedures were approved by the Institutional Animal Care and Use Committee of Nanjing Agricultural University (Nanjing, China)], was mixed with heparin and then centrifuged at 1,500 x g for 10 min at 4°C. Following removal of plasma, erythrocytes were washed three times with cool PBS buffer (pH 7.4) and finally resuspended in this PBS buffer. In order to induce the free radical chain oxidation in erythrocytes, the aqueous peroxyl radicals were generated by thermal decomposition of 2,2'-azobis(2-amidino-propane) dihydrochloride (AAPH; an azo compound) in oxygen. Briefly, a 2% suspension of porcine erythrocytes in PBS buffer were pre-incubated for 30 min at 37°C with DMG-Na (32 µM), followed by incubation with or without AAPH (75 mM) for 5 h with gentle shaking. Hemolysis of erythrocytes was determined spectrophotometrically as described by Magalhães et al (20). The hemolysis percentage (%) was calculated using the formula: Absorbance of supernatant/complete hemolysis x100.

Measurement of erythrocyte antioxidant activity and ROS level

Following repeated sonication (three times), superoxide dismutase (SOD; cat. no. A001-2-1), glutathione peroxidase (GSH-Px; cat. no. A005), glutathione (GSH; cat. no. A006-1) activity and malondialdehyde (MDA; cat. no. A003-4) level in erythrocytes were measured using the corresponding kits (Nanjing Jiancheng Institute of Bioengineering, Nanjing, China) (21,22). The ROS level was detected using a ROS assay kit (cat. no. E004; Nanjing Jiancheng Institute of Bioengineering) (23).

Experimental design of IPEC-J2 cells

DMG-Na was obtained from Qilu Sheng Hua Pharmaceutical Co., Ltd. (Jinan, China). All other chemicals were commercially available and of reagent grade. The non-transformed intestinal cell line IPEC-J2 (Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Braunschweig, Germany) was derived from the jejunum, and cultured as described previously (12). Namely, the IPEC-J2 cells were cultured in Dulbecco's modified Eagle medium, Ham's F-12 mixture, 1.5 mM HEPES, 5% (v/v) fetal bovine serum, 1% (v/v) insulin-transferrin-selenium mixture, 1% (v/v) penicillin-streptomycin mixture and 2.5 µg/ml fungizone (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) (37°C, 5% CO2). Cells were harvested by scraping them into 200 ml sodium chloride-tris-ethylenediaminetetraacetic acid (EDTA) buffer (250 mM sucrose, 3.59 mM Trizma®-base, 16.4 mM tris-HCl, 2 mM EDTA and 40 mM KCl). Subsequently, cells were lysed by sonication at 40% amplitude for 10 sec (three times) and centrifuged at 600 x g for 10 min at 4°C to remove cell debris.

Oxidative damage was induced by exposing IPEC-J2 cells to 20 µM oleic acid hydroperoxides (OAHPx) in lipopolysaccharide, supplemented with 1% L-glutamine and 1% non-essential amino acids on the 4th day of culturing when confluency had been reached (24,25). IPEC-J2 cells were randomly assigned to four groups (n=6 per group): i) Cells treated with PBS (T); ii) cells treated with 32 µM DMG-Na (TD); iii) cells treated with 20 µM OAHPx (TO); iv) cells treated with 32 µM DMG-Na followed by 20 µM OAHPx (DTO).

Culture medium was removed at 24 h, and the cells were harvested via brief trypsinization following washing with PBS. Cell suspensions were then centrifuged at 200 x g for 5 min and washed with PBS, the cell supernatant was discarded, and the cell pellets were re-suspended in PBS on ice. Cells were lysed using a mini-bead beater for 10 sec at 2,800 x g, and the cell lysates were obtained via centrifugation at 14,000 x g for 10 min at 4°C.

Assay for cell viability of IPEC-J2 cells

The cells were pre-treated with or without DMG-Na (8-56 µM) overnight for 18 h. Neutral red dye (Janssen Pharmaceutica NV, Beerse, Belgium) was prepared as a 0.1% (w/v) stock solution and diluted 1/10 with washing buffer. After removing the culture medium, 100 µl washing buffer plus 50 µl 0.01% (w/v) neutral red dye was added to each well, and incubated for 2 h (37°C, 5% CO2). Afterwards, the cells were washed twice with PBS. The neutral red dye is re- tained in lysosomes of living cells (26). This dye was then extracted from the cells using 100 µl 50% (v/v) ethanol solution (in 0.05 M NaH2PO4). The absorbance was measured at 550 nm using a spectrophotometer (Table II).

Table II

Cell viability of IPEC-J2 cells.

Table II

Cell viability of IPEC-J2 cells.

DMG-Na (µM)Cell viability (%)
0100.00±2.17
898.35±2.54
1698.32±3.28
2498.44±2.65
3299.07±3.02
4097.24±3.87
4897.57±3.51
5697.33±2.79

[i] The experiment was repeated three times, and six repetitions per group. Values are presented as the mean ± standard error. The values of 0 µM DMG-Na group was as to 100% viability. DMG-Na, dimeth-ylglycine sodium salt.

Antioxidant capacity assay

The culture supernatants and cell lysate of IPEC-J2 cells at 24 h were obtained to measure the activity SOD (cat. no. A001-2-1), GSH-Px (cat. no. A005), GSH (cat. no. A006-1) and glutathione reductase (GR; cat. no. A062) using their corresponding assay kits (Nanjing Jiancheng Institute of Bioengineering, Nanjing, China) (21,22).

Assay for mitochondrial isolation

The mitochondria were prepared according to the method described previously by Tang et al (27). Mitochondria were lysed and protein concentration was measured using an BCA assay kit (cat. no. A045-3; Nanjing Jiancheng Institute of Bioengineering) (27).

Mitochondrial antioxidant capacity assay

Manganese superoxide dismutase (MnSOD; cat. no. A001-2-1), GSH-Px (cat. no. A005), GSH (cat. no. A006-1), GR (cat. no. A062), γ-glutamylcysteine ligase (γ-GCL; cat. no. A120) activity, and protein concentration (BCA assay kit; cat. no. A045-4) of mitochondria were calculated using their corresponding assay kits (Nanjing Jiancheng Institute of Bioengineering) (21,28,29).

Assay for lipid peroxidation, protein oxidation and 8-hydroxy-2-deoxyguanosine assay

Lipid peroxidation, expressed as MDA concentration, was determined using an MDA assay kit (cat. no. A003-4; Nanjing Jiancheng Bioengineering Institute) according to the instructions of the manufacturer. The results were expressed in nmol/100 mg protein. Protein oxidation of mitochondria was expressed as the concentration of protein carbonyls (PC), which was calculated according to the method described previously (30), and the results were presented in nmol/mg protein. The content of 8-hydroxy-2-deoxyguanosine (8-OhdG) in mitochondria was measured using an ELISA assay kit (cat. no. H165; Nanjing Jiancheng Institute of Bioengineering) and the results were presented as ng/mg protein.

Assay for ROS, MMP and cell apoptosis

The ROS level was detected using a ROS assay kit (cat. no. E004; Nanjing Jiancheng Institute of Bioengineering) (23). Briefly, the mitochondria were incubated with dichlorodihydrofluorescein diacetate (DCFH-DA; 10 µM) and DNA stain Hoechst 33342 (10 mmol/l) at 37°C for 30 min. Then the DCFH fluorescence of the mitochondria was measured at an emission wavelength of 530 nm and an excitation wavelength of 485 nm with a fluorescence reader (FACS Aria III; BD Biosciences, Franklin Lakes, NJ, USA). The results were expressed as the mean DCFH-DA fluorescence intensity over that of the control.

The MMP level was calculated according to a method described previously (31). In brief, the mitochondria were loaded with 1 X JC-1 dye at 37°C for 20 min, and then analyzed, after washing, by flow cytometry (FACS Aria III). The MMP was calculated as the increase in ratio of green and red fluorescence. When the MMP levels are low, JC-1 exists mainly as a monomer, which emits green fluorescence (excitation wavelength of 490 nm and emission wavelength of 540 nm). However, when the MMP levels are high, JC-1 exists mainly as a polymer, which emits red fluorescence (excitation wavelength of 525 nm and emission wavelength of 590 nm). The results were calculated in triplicate as the ratio of the fluorescence of aggregates (red) to that of the monomers (green).

Phosphatidylserine exposure on the outer leaflet of the cell membrane was measured using an Alexa Fluor® 488 Annexin V/Dead Cell Apoptosis kit (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions (16). Briefly, following the preincubation of AAPH and DMG-Na, the cells were washed twice with cool PBS buffer (pH=7.4, containing 150 mM NaCl, 1.9 mM Na2HPO4 and 8.1 mM NaH2PO4) and resuspended (2% suspension) in 1 X Annexin-binding buffer. Then, the cell density was determined and diluted in 1 X Annexin-binding buffer to ~1x106 cells/ml. A sufficient volume of the above cell suspension was stained with Annexin V-fluorescein isothiocyanate and propidium iodide (1:9 dilution) staining solution in dark for 15 min at room temperature. After incubation, the forward scatter of cells was determined, and Annexin V fluorescence intensity was measured in FL-1 with 488 nm excitation wavelength and 530 nm emission wavelength on a FACS caliber (BD Biosciences).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) assay

Total RNA was obtained from the cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and then reverse-transcribed using a commercial kit (Perfect Real Time, SYBR® PrimeScript™; Thermo Fisher Scientific, Inc.) following the instructions of the manufacturer. The gene expression levels were quantified via qPCR, using SYBR1 Premix Ex Taq II (Tli RNaseH Plus; Thermo Fisher Scientific, Inc.) and an ABI 7300 Fast Real-Time PCR detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The SYBR-Green PCR reaction mixture consisted of 10 µl SYBR1 Premix Ex Taq (2 X), 0.4 µl forward and reverse primers, 0.4 µl ROX reference dye (50 X), 6.8 µl ddH2O and 2 µl cDNA template. The cycling conditions were as follows: Pre-run at 95°C for 30 sec, 40 cycles of denaturation at 95°C for 5 sec, followed by a 60°C annealing step for 30 sec. Each sample was run in triplicate. The fold-expression of each gene (Table I) was calculated according to the 2-ΔΔCq method (32), in which β-actin was used as an internal standard.

Table I

Primer sequences used for reverse transcription-quantitative polymerase chain reaction.

Table I

Primer sequences used for reverse transcription-quantitative polymerase chain reaction.

GeneSequence (5'-3')GenBank accession number
β-actinForward: CTGTCCCTGTATGCCTCTGNM_007393.3
Reverse: ATGTCACGCACGATTTCC
Nrf2Forward: GATGTCACCCTGCCCTTAGNM_205117.1
Reverse: CTGCCACCATGTTATTCC
HO1Forward: GGTCCCGAATGAATGCCCTTGHM237181.1
Reverse: ACCGTTCTCCTGGCTCTTGG
Cu/ZnSODForward: CCGGCTTGTCTGATGGAGATNM_205064.1
Reverse: TGCATCTTTTGGTCCACCGT
GSH-PxForward: GACCAACCCGCAGTACATCANM_001277853.1
Reverse: GAGGTGCGGGCTTTCCTTTA
MnSODForward: AGGAGGGGAGCCTAAAGGAGANM_204211.1
Reverse: CCAGCAATGGAATGAGACCTG
Sirt1Forward: TGCAGACGTGGTAATGTCCAAACNM_019812.2
Reverse: ACATCTTGGCAGTATTTGTGGTGAA
γ-GCLcForward: TGCGGTTCTGCACAAAATGGXM_419910.3
Reverse: TGCTGTGCGATGAATTCCCT
γ-GCLmForward: CCAGAACGTCAAAGCACACGNM_001007953.1
Reverse: TCCTCCCATCCCCCAGAAAT
Trx2Forward: AGTACGAGGTGTCAGCAGTGNM_001031410.1
Reverse: CACACGTTGTGAGCAGGAAG
Trx-R2Forward: CCGGGTCCCTGACATCAAANM_001122691.1
Reverse: TAGCTTCGCTGGCATCAACA
Prx3Forward: ACCTCGTGCTCTTCTTCTACCXM_004942320.1
Reverse: ACCACCTCGCAGTTCACATC
OCLNForward: CCGTAACCCCGAGTTGGATNM_205128.1
Reverse: ATTGAGGCGGTCGTTGATG
CLDN2Forward: CCTGCTCACCCTCATTGGAGNM_001277622.1
Reverse: GCTGAACTCACTCTTGGGCT
CLDN3Forward: CCCGTCCCGTTGTTGTTTTGNM_204202.1
Reverse: CCCCTTCAACCTTCCCGAAA
ZO1Forward: TGTAGCCACAGCAAGAGGTGXM_413773.4
Reverse: CTGGAATGGCTCCTTGTGGT

[i] Nrf2, nuclear factor erythroid 2-related factor 2; HO1, heme oxygenase 1; Cu/ZnSOD, copper and zinc superoxide dismutase; GSH-Px, glutathione peroxidase; MnSOD, manganese superoxide dismutase; Sirt1, sirtuin 1; γ-GCLc, γ-glutamylcysteine ligase c; γ-GCLm, γ-glutamylcysteine ligase m; Trx2, thioredoxin 2; Trx-R2, thioredoxin reductase 2; Prx3, peroxiredoxin 3; OCLN, occludin; CLDN2, claudin 2; CLDN3, claudin 3; ZO1, zonula occludens-1.

Western blotting

Antibodies against nuclear factor erythroid 2 like 2 (Nrf2), heme oxygenase 1 (HO1) and sirtuin 1 (Sirt1) were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). Cells were lysed using Laemmli sample buffer [2% SDS, 62 mM Tris, 10% glycerol, 5% β-mercaptoethanol, 0.005% bromphenol blue (pH 6.8)] The cellular protein content was measured using a bicinchoninic protein assay kit (Beyotime Institute of Biotechnology, Haimen, China). For western blotting analysis, 50 µg protein from each sample was subjected to SDS-PAGE (10%). Following electrophoresis, the separated proteins were transferred to polyvinylidene difluoride membranes, which were blocked with blocking buffer (5% nonfat dry milk) for 12 h at 4°C. The membranes were then probed with an appropriate primary antibody for 10 h at 4°C [Nrf2 (cat. no. 12721; 1:1,000), HO1 (cat. no. 82206; 1:1,000), Sirt1 (cat. no. 9475; 1:1,000), and β-actin (cat. no. 4970;1:1,000), respectively] and a secondary antibody for 2 h at 4°C [goat-anti-rabbit secondary antibody (1:1,000)] purchased from Cell Signaling Technology, Inc. The blots were detected using enhanced chemiluminescence reagents (ECL-Kit; Beyotime Institute of Biotechnology, Haimen, China) followed by autoradiography. Images of the membranes were taken using a Luminescent Image Analyzer-4000 system (Fujifilm, Tokyo, Japan) and quantified with ImageJ 1.42 q software (National Institutes of Health, Bethesda, MD, USA).

Statistical analysis

All the data were statistically analyzed by one-way analysis of variance procedure of Statistical Analysis System (SAS 2003, v. 9.1; SAS Institute, Inc., Cary, NC, USA). This was followed by the Tukey's test, when significant differences were found. Experiments were repeated three times, and the sample size was six. The data are expressed as the mean ± standard error. P<0.05 was considered to indicate a statistically significant different.

Results

Free radicals scavenging capacity of DMG-Na

The free radical scavenging capacity of the water-soluble pigments (DMG-Na, betalain, capsanthin and cyanidin-3-rutinoside) in comparison to that of the synthetic antioxidant Trolox is presented in Fig. 1. The free radical scavenging capacity of DMG-Na was measured relative to Trolox, which was set as 100% at all concentrations measured (from 0.08-0.64 M). DMG-Na exhibited the highest free radical scavenging capacity (DPPH, ABTS+, O2-, H2O2 and FRAP) at a concentration of 0.32 M, from the concentrations of 0.08-0.64 M that were tested.

Figure 1

Free radical scavenging capacity of DMG-Na. DPPH, ABTS+, O2- and H2O2 radical scavenging activity, and FRAP activity were measured. The values of Trolox are set to 100%. The experiment was repeated three times, and six repetitions per group. Values are presented as the mean ± standard error. DPPH, 1,1-diphenyl-2-pierylhydrazy; ABTS+, 2,2'-azinobis-(3-ethylbenzthiazoline-6-sulphonate); O2-, superoxide radical; H2O2, hydrogen peroxide; FRAP, ferric-reducing antioxidant power; DMG-Na, dimethylglycine sodium salt.

Hemolysis and antioxidant system of porcine erythrocytes

Fig. 2 demonstrates the effects of DMG-Na on porcine erythrocytes exposed to the water-soluble radical initiator AAPH. When AAPH was added to the suspension, hemolysis induction increased in a time-dependent manner. DMG-Na prevented hemolysis in AAPH-challenged erythrocytes (P<0.05). As demonstrated in Fig. 2, DMG-Na protected the porcine erythrocytes from AAPH damage by increasing the cellular antioxidant enzyme activity (P<0.05) while inhibiting intracellular MDA and ROS formation (P<0.05).

Figure 2

Effects of DMG-Na on the hemolysis, antioxidant capacity and ROS level of AAPH-induced porcine erythrocytes. The experiment was repeated three times, and six repetitions per group. Values are presented as the mean ± standard error. Groups with different letters were significantly different to each other (P<0.05). SOD, superoxide dismutase; GSH-Px, glutathione peroxidase; GSH, glutathione; MDA, malondialdehyde; ROS, reactive oxygen species.

Antioxidant system of IPEC-J2 cells

The effects of DMG-Na on the antioxidant capacity (SOD, GSH-Px, GSH, GR and MDA) of IPEC-J2 cells are presented in Figs. 3 and 4. The culture supernatant and cell lysate in the DTO group had greater antioxidant enzyme levels (P<0.05) and lower MDA concentrations in comparison to those in the TO group (P<0.05). Compared with the TO group, the DTO group also exhibited increased enzyme activity of MnSOD, GPx, GSH, GR and γ-GCL (P<0.05; Fig. 5).

Figure 3

Effects of DMG-Na on the antioxidant capacity of OAHPx-damaged IPEC-J2 cells culture supernatants. The experiment was repeated three times, and six repetitions per group. Values are presented as the mean ± standard error. Groups with different letters were significantly different to each other (P<0.05). OAHPx, oleic acid hydroperoxides; T, PBS group; TD, 32 µM DMG-Na; TO, 20 µM OAHPx; DTO, 32 µM DMG-Na followed by 20 µM OAHPx; SOD, superoxide dismutase; GSH-Px, glutathione peroxidase; GSH, glutathione; GR, glutathione reductase; MDA, malondialdehyde.

Figure 4

Effects of DMG-Na on the antioxidant capacity of OAHPx-damaged IPEC-J2 cell lysates. The experiment was repeated three times, and six repetitions per group. Values are presented as the mean ± standard error. Groups with different letters were significantly different to each other (P<0.05). OAHPx, oleic acid hydroperoxides; T, PBS group; TD, 32 µM DMG-Na; TO, 20 µM OAHPx; DTO, 32 µM DMG-Na followed by 20 µM OAHPx; SOD, superoxide dismutase; GSH-Px, glutathione peroxidase; GSH, glutathione; GR, glutathione reductase; MDA, malondialdehyde.

Figure 5

Effects of DMG-Na on the mitochondrial antioxidant capacity of OAHPx-damaged IPEC-J2 cells. The experiment was repeated three times, and six repetitions per group. Values are presented as the mean ± standard error. Groups with different letters were significantly different to each other (P<0.05). OAHPx, oleic acid hydroperoxides; T, PBS group; TD, 32 µM DMG-Na; TO, 20 µM OAHPx; DTO, 32 µM DMG-Na followed by 20 µM OAHPx; MnSOD, manganese superoxide dismutase; GPx, glutathione peroxidase; GSH, glutathione; GR, glutathione reductase; γ-GCL, γ-glutamylcysteine ligase.

The effect of DMG-Na on the oxidative damage (ROS, PC, 8-OHdG, MMP, apoptosis and necrosis level) of IPEC-J2 cells is presented Fig. 6. Compared with the TO group, the DTO group exhibited lower ROS, PC, 8-OHdG, apoptosis and necrosis levels (P<0.05), along with higher MMP levels (P<0.05).

Figure 6

Effects of DMG-Na on the oxidative damage of OAHPx-damaged IPEC-J2 cells. The experiment was repeated three times, and six repetitions per group. Values are presented as the mean ± standard error. Groups with different letters were significantly different to each other (P<0.05). OAHPx, oleic acid hydroperoxides; T, PBS group; TD, 32 µM DMG-Na; TO, 20 µM OAHPx; DTO, 32 µM DMG-Na followed by 20 µM OAHPx; ROS, reactive oxygen species; PC, protein carbonyls; 8-OHdG, 8-hydroxy-2-deoxyguanosine; MMP, mitochondrial membrane potential.

Anti-oxidant gene and protein expression in IPEC-J2 cells

The effects of DMG-Na on gene expression levels in IPEC-J2 cells are demonstrated in Fig. 7. Compared with the TO group, the DTO group exhibited greater levels of the genes copper and zinc superoxide dismutase, GSH-Px, MnSOD, Sirt1, γ-GCLc, γ-GCLm, thioredoxin 2 (Trx2), thioredoxin reductase 2 (Trx-R2), peroxiredoxin 3 (Prx3), occludin (OCLN) and zonula occludens-1 (ZO1; P<0.05), and lower levels of the genes Nrf2, HO-1, claudin 2 and claudin 3 (P<0.05). The DTO group also exhibited a higher protein level of Sirt1 (P<0.05), and lower (P<0.05) levels of the proteins Nrf2 and HO-1 compared with the TO group (Fig. 8).

Figure 7

Effects of DMG-Na on gene expression in OAHPx-damaged IPEC-J2 cells. The experiment was repeated three times, and six repetitions per group. Values are presented as the mean ± standard error. Groups with different letters were significantly different to each other (P<0.05). OAHPx, oleic acid hydroperoxides; T, PBS group; TD, 32 µM DMG-Na; TO, 20 µM OAHPx; DTO, 32 µM DMG-Na followed by 20 µM OAHPx; Nrf2, nuclear factor ery-throid 2-related factor 2; HO1, heme oxygenase 1; Cu/ZnSOD, copper and zinc superoxide dismutase; GSH-Px, glutathione peroxidase; MnSOD, manganese superoxide dismutase; Sirt1, sirtuin 1; γ-GCLc, γ-glutamylcysteine ligase c; γ-GCLm, γ-glutamylcysteine ligase m; Trx2, thioredoxin 2; Trx-R2, thioredoxin reductase 2; Prx3, peroxiredoxin 3; OCLN, occludin; CLDN2, claudin 2; CLDN3, claudin 3; ZO1, zonula occludens-1.

Figure 8

Effects of DMG-Na on Nrf2, HO1, and Sirt1 protein level of OAHPx-damaged IPEC-J2 cells. The experiment was repeated three times, and six repetitions per group. Values are presented as the mean ± standard error. Groups with different letters were significantly different to each other (P<0.05). OAHPx, oleic acid hydroperoxides; T, PBS group; TD, 32 µM DMG-Na; TO, 20 µM OAHPx; DTO, 32 µM DMG-Na followed by 20 µM OAHPx; Nrf2, nuclear factor erythroid 2-related factor 2; Sirt1, sirtuin 1; HO1, heme oxygenase 1.

Discussion

DPPH and ABTS+ radicals have excellent reproducibility and stability, and for these reasons, are the two chromogenic compounds most commonly used to determine the capacity of a compound to inhibit free radicals. Reaction with the antioxidant DPPH neutralizes excess free radicals by transferring either an electron or a hydrogen atom (33). The ABTS+ decol-orization assay is used for the rapid measurement of the total antioxidant activity of individual chemical compounds (34). In the case of cellular oxidation reactions, O2- and H2O2 are two of the most common free radicals produced, that then produce other cell-damaging free radicals and oxidizing agents in vivo (35,36). Of all the antioxidant capacity detection assays, the FRAP assay is the only one that directly measures antioxidants in samples and is useful in the measurement of oxidative damage (37). In the present study, Trolox was used as a standard substance that exerts strong free radical scavenging capacity in vitro. DMG-Na exhibited the greatest free radical scavenging activity at a concentration of 0.32 M, indicating the potential of DMG-Na as a free radical scavenger. Similar to our results, Hariganesh and Prathiba (2) reported the free radical scavenging potential of orally-administered DMG-Na in rats subjected to oxidative stress. As DMG-Na exerts a strong free radical scavenging capacity in vitro, whether DMG-Na could prevent oxidative damage in a cell model was assessed in the current study.

Based on the results of free radical scavenging assays, DMG-Na was selected for further evaluation of its protective effect against hemolysis in AAPH-challenged porcine erythrocytes. Erythrocytes possess a high membrane concentration of polyunsaturated fatty acids, have a specific role as oxygen carriers and are considered to be the major targets for free radical attacks (38). In the present study, DMG-Na prevented AAPH-induced hemolysis of erythrocyte membranes. It has been reported that DMG, a raw material used in the synthesis of glutathione, is an important antioxidant that can protect the body from oxidative damage (1). Thus, the powerful protection of DMG-Na against AAPH-induced hemolysis in the porcine erythrocyte model may be explained by its strong free radical scavenging capacity. Erythrocyte membrane lipids can lose a hydrogen atom from an unsaturated fatty acyl chain when they are subjected to oxidative damage (39).

This step initiates lipid peroxidation, which then propagates as a chain reaction. Oxidative damage can destroy the lipid bilayer membrane structure, alter membrane permeability, disrupt ion channels and ultimately lead to dysfunction of whole erythrocytes (40). In erythrocytes, oxidative damage induced by free radicals can be prevented by the SOD enzyme, which protects cells by dismutating the highly reactive O2- species to H2O2, which is then neutralized by GSH-Px and GSH (41,42). These results are consistent with those reported by Deng et al (43) and Tedesco et al (44) that reported the protective roles of antioxidant substances against oxidative damage in human erythrocytes. The results of the present study suggest that DMG-Na exerted strong protective effects against lipid peroxidation and indicates that it could reduce the MDA and ROS levels in AAPH-challenged porcine erythrocytes. The present results provide strong evidence for DMG-Na application in oxidative damage-associated diseases; however, further study regarding the specific mechanisms involved is still required.

The small intestine is the main organ that digests and absorbs nutrients, and is the first line of defense against foreign pathogenic microorganisms and toxins. The ability of foreign substances to cross the cell membrane into intestinal cells depends on either diffusion or active transport (45). Oxidative damage is caused by enhanced levels of ROS, which can destroy the mitochondrial structure and decrease antioxidant capacity. Previous studies have indicated that DMG is an important antioxidant that can prevent oxidative damage in the body by scavenging excess free radicals (1). In cells, oxidative damage induced by free radicals can be prevented by the enzyme, SOD, which catalyzes the conversion of endogenous superoxide anions to hydrogen peroxide through disproportionation; hydrogen peroxide is then neutralized by the intracellular GSH-Px enzyme (41). The mitochondrial antioxidant system is composed of enzymatic and non-enzymatic antioxidants that protect the body from oxidative damage (46). It has been reported that the MnSOD enzyme and GSH-associated metabolic enzymes are important members of the mitochondrial antioxidant system and are crucial in suppressing oxidative damage by neutralizing excess ROS and acting as a substrate for various other antioxidant enzymes (27). γ-GCL is an important rate-limiting enzyme that is involved in the synthesis of γ-glutamylcysteine and is crucial for relieving oxidative damage (28). A previous study reported that DMG-Na acts as an important component in relieving oxida-tive damage by enhancing antioxidant capacity (1,47). Results from the present study suggest that DMG-Na may improve the total antioxidant capacity by scavenging excess ROS, so as to maintain the intracellular redox balance.

When oxidative damage occurs, the blockade of oxidative phosphorylation reactions can increase the levels of ROS (48). The excess ROS harms biological macromolecular substances, and exacerbates the oxidative damage through lipid peroxidation and protein oxidation reactions (49). Mitochondria are also prone to becoming damaged by the excess ROS (50). This information is supported by the findings of the present study, where the damaged IPEC-J2 cells exhibited higher concentrations of MDA, PC, 8-OHdG and ROS compared with those in the T group. It has been reported that DMG, a natural antioxidant, can effectively neutralize free radicals to alleviate oxidative damage in the body (2). It was hypothesized that pre-treatment with DMG-Na could minimize lipid peroxidation and protein oxidation reactions by scavenging excess ROS in cells. MMP expression is negatively associated with ROS concentration, and acts as an indicator for the beginning of mitochondria-dependent apoptosis. When MMP levels are reduced, there is uncoupling of oxidative phosphorylation in the mitochondria, which results in an increase in ROS levels and inevitably leads to apoptosis (46). The present study indicates that the administration of DMG-Na may lead to relief of oxidative damage. This is supported by previous studies demonstrating that natural antioxidants could inhibit apoptosis by protecting cells from oxidative damage (1,51). We hypothesize that there is a correlation between the anti-apoptotic effect of DMG-Na and the protective effects of DMG-Na on mitochondrial function in damaged IPEC-J2 cells; however, further study is still required.

The activation of the genes Nrf2, HO-1 and SIRT1 is important in relieving oxidative damage, and is also crucial in regulating the gene expressions of certain important antioxidant enzymes (52-55). Mitochondria are rich in Trx2, Trx-R2 and Prx3, which together compose a unique antioxidant system that prevents oxidative stress by scavenging free radicals and regulating mitochondrial-dependent apoptotic pathways (56). The gene ZO1 is correlated with paracellular permeability, and together with the genes OCLN and CLDN from the same gene family, it is a key regulator of intestinal permeability (57). A previous study suggested that a natural antioxidant was beneficial in the regulation of antioxidant-associated gene expression (47,51). The current study indicated that the regulation of antioxidant-associated genes may be one mechanism used by IPEC-J2 cells to prevent oxidative stress and maintain mitochondrial function.

The present study indicates that DMG-Na is a strong free radical quencher. Furthermore, DMG-Na reduced lipid peroxidation, increased antioxidant enzyme activity and attenuated hemolysis in AAPH-challenged porcine erythrocytes. The present study also demonstrated that DMG-Na effectively prevented the oxidative damage of IPEC-J2 cells by scavenging excess ROS, preventing mitochondrial dysfunction and inhibiting cell apoptosis. Based on these results, it is speculated that DMG-Na may directly neutralize excess free radicals, and act indirectly on the improvement of antioxidant enzyme activity and inhibit the abnormal expression of stress-associated factors.

Acknowledgements

Not applicable

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

KB and LJ analyzed and interpreted the IPEC- J2 cell data. KB, LigenZ, YZ, YL, JZ, JC, LiliZ and TW performed the whole experiment, and LJ was a major contributor in writing the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

All procedures were approved by the Institutional Animal Care and Use Committee of Nanjing Agricultural University (Nanjing, China)

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Abbreviations:

DMG-Na

dimethylglycine sodium salt

OAHPx

oleic acid hydroperoxides

ROS

reactive oxygen species

DPPH

1,1-diphenyl-2-pierylhydrazy

ABTS+

2,2'-azinobis- (3-ethylbenzthiazoline-6-sulphonate)

O2-

superoxide radical

H2O2

hydrogen peroxide

FRAP

ferric-reducing antioxidant power

SOD

superoxide dismutase

GSH-Px

glutathione peroxidase

GSH

glutathione

GR

glutathione reductase

MDA

malondialdehyde

MnSOD

manganese superoxide dismutase

GPx

glutathione peroxidase

γ-GCL

γ-glutamylcysteine ligase

PC

protein carbonyls

8-OHdG

8-hydroxy-2-deoxyguanosine

MMP

mitochondrial membrane potential

References

1 

Friesen RW, Novak EM, Hasman D and Inniset SM: Relationship of dimethylglycine, choline, and betaine with oxoproline in plasma of pregnant women and their newborn infants. J Nutr. 137:2641–2646. 2007. View Article : Google Scholar : PubMed/NCBI

2 

Hariganesh K and Prathiba J: Effect of dimethylglycine on gastric ulcers in rats. J Pharm Pharmacol. 52:1519–1522. 2000. View Article : Google Scholar

3 

Clapes P and Infante MR: Amino acid-based surfactants: Enzymatic synthesis, properties and potential applications. J Biocatalys Biotransformation. 20:215–233. 2002. View Article : Google Scholar

4 

Giacco F and Brownlee M: Oxidative stress and diabetic complications. Circ Res. 107:1058–1070. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Grune T: Oxidative stress, aging and the proteasomal system. Biogerontology. 1:31–40. 2000. View Article : Google Scholar

6 

Ma K, Zhang Y, Zhu D and Lou Y: Protective effects of asiatic acid against D-galactosamine/lipopolysaccharide-induced hepa-totoxicity in hepatocytes and kupffer cells co-cultured system via redox-regulated leukotriene C4 synthase expression pathway. Eur J Pharmacol. 603:98–107. 2009. View Article : Google Scholar

7 

Balaban RS, Nemoto S and Finkel T: Mitochondria, oxidants, and aging. Cell. 120:4832005. View Article : Google Scholar : PubMed/NCBI

8 

Andreyev AY, Kushnareva YE and Starkov AA: Mitochondrial metabolism of reactive oxygen species. Biochemistry (Mosc). 70:200–214. 2005. View Article : Google Scholar

9 

Dong L, Zhong X, He J, Zhang L, Bai K, Xu W, Wang T and Huang X: Supplementation of tributyrin improves the growth and intestinal digestive and barrier functions in intrauterine growth-restricted piglets. Clin Nutr. 35:399–407. 2016. View Article : Google Scholar

10 

Inoue J, Miki I, Tanahashi T, Kawauchi S, Azuma T and Mizuno S: Mo2016 effect of ghrelin on indomethacin-induced small intestinal injury in mice. Gastroenterology. 144:S-7192013. View Article : Google Scholar

11 

Konaka A, Kato S, Tanaka A, Kunikata T, Korolkiewicz R and Takeuchi K: Roles of enterobacteria, nitric oxide and neutrophil in pathogenesis of indomethacin-induced small intestinal lesions in rats. Pharmacol Res. 40:517–524. 1999. View Article : Google Scholar

12 

Liu F, Li G, Wen K, Bui T, Cao D, Zhang Y and Yuan L: Porcine small intestinal epithelial cell line (IPEC-J2) of rotavirus infection as a new model for the study of innate immune responses to rota-viruses and probiotics. Viral Immunol. 23:135–149. 2010. View Article : Google Scholar : PubMed/NCBI

13 

Brosnahan AJ and Brown DR: Porcine IPEC-J2 intestinal epithelial cells in microbiological investigations. Vet Microbiol. 156:229–237. 2012. View Article : Google Scholar :

14 

Arce C, Ramírez-Boo M, Lucena C and Garrido JJ: Innate immune activation of swine intestinal epithelial cell lines (IPEC-J2 and IPI-2I) in response to LPS from salmonella typhimurium. Comp Immunol Microbiol Infect Dis. 33:161–174. 2010. View Article : Google Scholar

15 

Moon JK and Shibamoto T: Antioxidant assays for plant and food components. J Agric Food Chem. 57:1655–1666. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Siddhuraju P and Manian S: The antioxidant activity and free radical-scavenging capacity of dietary phenolic extracts from horse gram (Macrotyloma uniflorum (Lam) Verdc) seeds. Food Chem. 105:950–958. 2007. View Article : Google Scholar

17 

Chen HY and Yen GC: Antioxidant activity and free radical-scavenging capacity of extracts from guava (Psidium guajava L.) leaves. Food Chem. 101:686–694. 2007. View Article : Google Scholar

18 

Zhang J, Hou X, Ahmad H, Zhang H, Zhang L and Wang T: Assessment of free radicals scavenging activity of seven natural pigments and protective effects in AAPH-challenged chicken erythrocytes. Food Chem. 145:57–65. 2014. View Article : Google Scholar

19 

Benzie IF and Strain JJ: The ferric reducing ability of plasma (FRAP) as a measure of ‘antioxidant power’: The frap assay. Anal Biochem. 239:70–76. 1996. View Article : Google Scholar : PubMed/NCBI

20 

Magalhães AS, Silva BM, Pereira JA, Andrade PB, Valentão P and Carvalho M: Protective effect of quince (cydonia oblonga miller) fruit against oxidative hemolysis of human erythrocytes. Food Chem Toxicol. 47:1372–1377. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Lawrence RA and Burk RF: Glutathione peroxidase activity in selenium-deficient rat liver. Biochem Biophys Res Commun. 71:952–958. 1976. View Article : Google Scholar : PubMed/NCBI

22 

Panchenko LF, Brusov OS, Gerasimov AM and Loktaeva TD: Intramitochondrial localization and release of rat liver superoxide dismutase. FEBS Lett. 55:84–87. 1975. View Article : Google Scholar : PubMed/NCBI

23 

Sang H, Zhang L and Li J: Anti-benzopyrene-7,8-diol-9,10-epoxide induces apoptosis via mitochondrial pathway in human bronchiolar epithelium cells independent of the mitochondria permeability transition pore. Food Chem Toxicol. 50:2417–2423. 2012. View Article : Google Scholar : PubMed/NCBI

24 

AOAC: Official Methods of Analysis. 14th edition. Association of Official Analytical Chemists; Washington, DC: 1985

25 

Aw TY, Williams MW and Gray L: Absorption and lymphatic transport of peroxidized lipids by rat small intestine in vivo: Role of mucosal GSH. Am J Physiol. 262:G99–G106. 1992.PubMed/NCBI

26 

Repetto G, Peso AD and Zurita JL: Neutral red uptake assay for the estimation of cell viability/cytotoxicity. Nat Protoc. 3:1125–1131. 2008. View Article : Google Scholar : PubMed/NCBI

27 

Tang X, Gao J, Wang Y, Fan YM, Xu LZ, Zhao XN, Xu Q and Qian ZM: Effective protection of terminalia catappa l. Leaves from damage induced by carbon tetrachloride in liver mitochondria. J Nutr Biochem. 17:177–182. 2006. View Article : Google Scholar

28 

Langston JW, Li W, Harrison L and Aw TY: Activation of promoter activity of the catalytic subunit of γ-glutamylcysteine ligase (GCL) in brain endothelial cells by insulin requires antioxidant response element 4 and altered glycemic status: Implication for GCL expression and GSH synthesis. Free Radic Biol Med. 51:1749–1757. 2011. View Article : Google Scholar : PubMed/NCBI

29 

Van Remmen H, Ikeno Y, Hamilton M, Pahlavani M, Wolf N, Thorpe SR, Alderson NL, Baynes JW, Epstein CJ, Huang TT, et al: Life-long reduction in MnSOD activity results in increased DNA damage and higher incidence of cancer but does not accelerate aging. Physiol Genomics. 16:29–37. 2003. View Article : Google Scholar : PubMed/NCBI

30 

Wei QY, Chen WF, Zhou B, Yang L and Liu ZL: Inhibition of lipid peroxidation and protein oxidation in rat liver mitochondria by curcumin and its analogues. Biochim Biophys Acta. 1760:70–77. 2006. View Article : Google Scholar

31 

Zhang Q, Zou P, Zhan H, Zhang M, Zhang L, Ge RS and Huang Y: Dihydrolipoamide dehydrogenase and cAMP are associated with cadmium-mediated leydig cell damage. Toxicol Lett. 205:183–189. 2011. View Article : Google Scholar : PubMed/NCBI

32 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative pcr and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

33 

Naik GH, Priyadarsini KI, Satav JG, Banavalikar MM, Sohoni DP, Biyani MK and Mohan H: Comparative antioxidant activity of individual herbal components used in ayurvedic medicine. Phytochemistry. 63:97–104. 2003. View Article : Google Scholar : PubMed/NCBI

34 

JiSang K and YoungSoon L: Antioxidant activity of Maillard reaction products derived from aqueous glucose/glycine, diglycine, and triglycine model systems as a function of heating time. Food Chem. 116:227–232. 2009. View Article : Google Scholar

35 

Rollet-Labelle E, Grange MJ, Elbim C, Marquetty C, Gougerot-Pocidalo MA and Pasquier C: Hydroxyl radical as a potential intracellular mediator of polymorphonuclear neutrophil apoptosis. Free Radic Biol Med. 24:563–572. 1998. View Article : Google Scholar : PubMed/NCBI

36 

Wang J, Yuan X, Jin Z, Tian Y and Song H: Free radical and reactive oxygen species scavenging activities of peanut skins extract. Food Chem. 104:242–250. 2007. View Article : Google Scholar

37 

Bernaert N, De Paepe D, Bouten C, De Clercq H, Stewart D, Van Bockstaele E, De Loose M and Van Droogenbroeck B: Antioxidant capacity, total phenolic and ascorbate content as a function of the genetic diversity of leek (Allium ampeloprasum var. porrum) Food Chem. 134:669–677. 2012. View Article : Google Scholar

38 

Ajila CM and Prasada Rao UJ: Protection against hydrogen peroxide induced oxidative damage in rat erythrocytes by mangifera indica L. peel extract. Food Chem Toxicol. 46:303–309. 2008. View Article : Google Scholar

39 

Mendes L, de Freitas V, Baptista P and Carvalho M: Comparative antihemolytic and radical scavenging activities of strawberry tree (Arbutus unedo L.) leaf and fruit. Food Chem Toxicol. 49:2285–2291. 2011. View Article : Google Scholar : PubMed/NCBI

40 

Lang F, Lang KS, Lang PA, Huber SM and Wieder T: Mechanisms and significance of eryptosis. Antioxid Redox Signal. 8:1183–1192. 2006. View Article : Google Scholar : PubMed/NCBI

41 

Bayrak O, Uz E, Bayrak R, Turgut F, Atmaca AF, Sahin S, Yildirim ME, Kaya A, Cimentepe E and Akcayet A: Curcumin protects against ischemia/reperfusion injury in rat kidneys. World J Urol. 26:285–291. 2008. View Article : Google Scholar : PubMed/NCBI

42 

Forman HJ, Zhang H and Rinna A: Glutathione: Overview of its protective roles, measurement, and biosynthesis. Mol Aspects Med. 30:1–12. 2009. View Article : Google Scholar :

43 

Deng SL, Chen WF, Zhou B, Yang L and Liu ZL: Protective effects of curcumin and its analogues against free radical-induced oxidative haemolysis of human red blood cells. Food Chem. 98:112–119. 2006. View Article : Google Scholar

44 

Tedesco I, Luigi Russo G, Nazzaro F, Russo M and Palumbo R: Antioxidant effect of red wine anthocyanins in normal and catalase-inactive human erythrocytes. J Nutr Biochem. 12:505–511. 2001. View Article : Google Scholar

45 

Nusrat A, Parkos CA, Verkade P, Foley CS, Liang TW, Innis-Whitehouse W, Eastburn KK and Madara JL: Tight junctions are membrane microdomains. J Cell Sci. 113:1771–1781. 2000.PubMed/NCBI

46 

Kowaltowski AJ and Vercesi AE: Mitochondrial damage induced by conditions of oxidative stress. Free Radic Biol Med. 26:463–471. 1999. View Article : Google Scholar : PubMed/NCBI

47 

Bai K, Xu W, Zhang J, Kou T, Niu Y, Wan X, Zhang L, Wang C and Wang T: Assessment of free radical scavenging activity of dimethylglycine sodium salt and its role in providing protection against lipopolysaccharide-induced oxidative stress in mice. PLoS One. 11:e01553932016. View Article : Google Scholar : PubMed/NCBI

48 

Lee HJ, Oh YK, Rhee M, Lim JY, Hwang JY, Park YS, Kwon Y, Choi KH, Jo I, Park SI, et al: The role of STAT1/IRF-1 on synergistic ROS production and loss of mitochondrial transmembrane potential during hepatic cell death induced by LPS/d-GalN. J Mol Biol. 369:967–984. 2007. View Article : Google Scholar : PubMed/NCBI

49 

Wilhelm EA, Jesse CR, Roman SS, Nogueira CW and Savegnago L: Hepatoprotective effect of 3-alkynyl selenophene on acute liver injury induced by D-galactosamine and lipopoly-saccharide. Exp Mol Pathol. 87:20–26. 2009. View Article : Google Scholar : PubMed/NCBI

50 

Chen JJ and Yu BP: Alterations in mitochondrial membrane fluidity by lipid peroxidation products. Free Radic Biol Med. 17:411–418. 1994. View Article : Google Scholar : PubMed/NCBI

51 

Zhang J, Xu L, Zhang L, Ying Z, Su W and Wang T: Curcumin attenuates D-galactosamine/lipopolysaccharide-induced liver injury and mitochondrial dysfunction in mice. J Nutr. 144:1211–1218. 2014. View Article : Google Scholar : PubMed/NCBI

52 

Chiu H, Brittingham JA and Laskin DL: Differential induction of heme oxygenase-1 in macrophages and hepatocytes during acetaminophen-induced hepatotoxicity in the rat: Effects of hemin and biliverdin. Toxicol Appl Pharmacol. 181:106–115. 2002. View Article : Google Scholar : PubMed/NCBI

53 

Chung S, Yao H, Caito S, Hwang JW, Arunachalam G and Rahman I: Regulation of SIRT1 in cellular functions: Role of polyphenols. Arch Biochem Biophys. 501:79–90. 2010. View Article : Google Scholar : PubMed/NCBI

54 

Hwang JW, Yao H, Caito S, Sundar IK and Rahman I: Redox regulation of SIRT1 in inflammation and cellular senescence. Free Radic Biol Med. 61:95–110. 2013. View Article : Google Scholar : PubMed/NCBI

55 

Lee JM and Johnson JA: An important role of Nrf2-are pathway in the cellular defense mechanism. J Biochem Mol Biol. 37:139–143. 2004.PubMed/NCBI

56 

Michelet L, Zaffagnini M, Massot V, Keryer E, Vanacker H, Miginiac-Maslow M, Issakidis-Bourguet E and Lemai SD: Thioredoxins, glutaredoxins, and glutathionylation: New crosstalks to explore. Photosynth Res. 89:225–245. 2006. View Article : Google Scholar : PubMed/NCBI

57 

Gu L, Li N, Gong J, Li Q, Zhu W and Li J: Berberine ameliorates intestinal epithelial tight-junction damage and down-regulates myosin light chain kinase pathways in a mouse model of endotoxinemia. J Infect Dis. 203:1602–1612. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Bai K, Jiang L, Zhang L, Zhao Y, Lu Y, Zhu J, Cai J, Zhang L and Wang T: In vitro free radical scavenging capacity of dimethylglycine sodium salt and its protective ability against oleic acid hydroperoxide-induced oxidative damage in IPEC-J2 cells. Int J Mol Med 42: 3447-3458, 2018.
APA
Bai, K., Jiang, L., Zhang, L., Zhao, Y., Lu, Y., Zhu, J. ... Wang, T. (2018). In vitro free radical scavenging capacity of dimethylglycine sodium salt and its protective ability against oleic acid hydroperoxide-induced oxidative damage in IPEC-J2 cells. International Journal of Molecular Medicine, 42, 3447-3458. https://doi.org/10.3892/ijmm.2018.3876
MLA
Bai, K., Jiang, L., Zhang, L., Zhao, Y., Lu, Y., Zhu, J., Cai, J., Zhang, L., Wang, T."In vitro free radical scavenging capacity of dimethylglycine sodium salt and its protective ability against oleic acid hydroperoxide-induced oxidative damage in IPEC-J2 cells". International Journal of Molecular Medicine 42.6 (2018): 3447-3458.
Chicago
Bai, K., Jiang, L., Zhang, L., Zhao, Y., Lu, Y., Zhu, J., Cai, J., Zhang, L., Wang, T."In vitro free radical scavenging capacity of dimethylglycine sodium salt and its protective ability against oleic acid hydroperoxide-induced oxidative damage in IPEC-J2 cells". International Journal of Molecular Medicine 42, no. 6 (2018): 3447-3458. https://doi.org/10.3892/ijmm.2018.3876
Copy and paste a formatted citation
x
Spandidos Publications style
Bai K, Jiang L, Zhang L, Zhao Y, Lu Y, Zhu J, Cai J, Zhang L and Wang T: In vitro free radical scavenging capacity of dimethylglycine sodium salt and its protective ability against oleic acid hydroperoxide-induced oxidative damage in IPEC-J2 cells. Int J Mol Med 42: 3447-3458, 2018.
APA
Bai, K., Jiang, L., Zhang, L., Zhao, Y., Lu, Y., Zhu, J. ... Wang, T. (2018). In vitro free radical scavenging capacity of dimethylglycine sodium salt and its protective ability against oleic acid hydroperoxide-induced oxidative damage in IPEC-J2 cells. International Journal of Molecular Medicine, 42, 3447-3458. https://doi.org/10.3892/ijmm.2018.3876
MLA
Bai, K., Jiang, L., Zhang, L., Zhao, Y., Lu, Y., Zhu, J., Cai, J., Zhang, L., Wang, T."In vitro free radical scavenging capacity of dimethylglycine sodium salt and its protective ability against oleic acid hydroperoxide-induced oxidative damage in IPEC-J2 cells". International Journal of Molecular Medicine 42.6 (2018): 3447-3458.
Chicago
Bai, K., Jiang, L., Zhang, L., Zhao, Y., Lu, Y., Zhu, J., Cai, J., Zhang, L., Wang, T."In vitro free radical scavenging capacity of dimethylglycine sodium salt and its protective ability against oleic acid hydroperoxide-induced oxidative damage in IPEC-J2 cells". International Journal of Molecular Medicine 42, no. 6 (2018): 3447-3458. https://doi.org/10.3892/ijmm.2018.3876
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team