Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
July-2020 Volume 46 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2020 Volume 46 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Cyclopamine functions as a suppressor of benign prostatic hyperplasia by inhibiting epithelial and stromal cell proliferation via suppression of the Hedgehog signaling pathway

  • Authors:
    • Yi‑Feng Yuan
    • Wen‑Xiong Zhu
    • Tao Liu
    • Ju‑Qiao He
    • Qing Zhou
    • Xing Zhou
    • Xi Zhang
    • Jing Yang
  • View Affiliations / Copyright

    Affiliations: Department of Andrology, The First Hospital of Hunan University of Chinese Medicine, Changsha, Hunan 410007, P.R. China, College of Pharmacy, Hunan University of Chinese Medicine, Changsha, Hunan 410208, P.R. China
    Copyright: © Yuan et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 311-319
    |
    Published online on: April 8, 2020
       https://doi.org/10.3892/ijmm.2020.4569
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Stromal‑epithelial interaction serves a pivotal role in normal prostate growth, as well as the onset of benign prostatic hyperplasia (BPH). The present study aimed to explore the role of cyclopamine in the proliferation and apoptosis of epithelial and stromal cells in rats with BPH by blocking the Hedgehog signaling pathway. Cyclopamine (an inhibitor of the Hedgehog signaling pathway) was administered in a rat model of BPH, and the expression of Ki67 (proliferation factor) was determined by immunohistochemistry. In addition, epithelial and stromal cells were separated and cultured in order to investigate the role of cyclopamine in the progression of BPH. The expression of Hedgehog signaling pathway‑ and apoptosis‑related genes, including basic fibroblastic growth factor (b‑FGF) and transforming growth factor β (TGF‑β), was evaluated using reverse transcription‑quantitative polymerase chain reaction and western blot analysis. Cell proliferation, cell cycle and apoptosis were analyzed using an MTT assay and flow cytometry. We identified upregulated Ki67 expression and activated Hedgehog signaling pathway in rats with BPH. Cyclopamine inhibited the activation of the Hedgehog signaling pathway. In response to cyclopamine treatment, epithelial and stromal cell proliferation was inhibited; this was concomitant with decreased Ki67, TGF‑β, and b‑FGF expression. On the other hand, epithelial cell apoptosis was enhanced, which was associated with increased Bax and reduced Bcl‑2 expression. Based on these findings, we proposed that cyclopamine may serve as a potential therapeutic agent in the treatment of BPH. Cyclopamine could inhibit epithelial and stromal cell proliferation, and induce epithelial cell apoptosis by suppressing the Hedgehog signaling pathway.

Introduction

Benign prostatic hyperplasia (BPH), an urologic and chronic disease, has been regarded as one of the most frequently occurring diseases among old-aged males, with proportions reaching ≤80% in males aged >70 years old (1,2). Symptoms of BPH commonly include proliferation of smooth muscle and epithelial cells inside the prostatic transition area (3). BPH frequently begins as a simple micronodular hyperplasia that gradually develops into a macroscopic nodular growth; it can also cause urinary tract symptoms, such as increased urinary urgency and frequency, nocturia, and weak flow (2,4). At present, there is an increased focus on treatments for BPH, such as transurethral resection of the prostate, pharmacotherapy and phytotherapy, particularly in western countries (5,6).

Hedgehog refers to a group of proteins that were first detected in Drosophila, and serves significant roles in embryonic development (7). Additionally, the Hedgehog signaling pathway has been highlighted as crucial not only for maintaining the stem cell compartment, but also for cell proliferation and differentiation during embryonic tissue patterning (8). This signaling pathway, once activated, can also enhance oncogenesis due to its ability to promote tumor invasion and metastasis in a number of diseases, such as in prostate and pancreatic cancer, and gastric carcinoma (9). Gli1, Gli2 and Gli3 are important transcription factors in the Hedgehog signaling pathway, and when the Hedgehog signaling pathway is inactivated, the transcription of Gli1 is inhibited (10). In addition, β transducing repeat containing 2 mediates the degradation of Gli2, and Gli3 is cleaved into small fragments in vivo, consequently, Gli proteins cannot enter the nucleus and exert their function as transcription factors (11). When Sonic Hedgehog (Shh) binds to cell membrane receptors and activates the Hedgehog signaling pathway, Gli proteins translocate into the nucleus, and mediates the transcription and expression of downstream target genes (12-14). A previous study revealed that blocking of Hedgehog signaling could suppress Shh-induced cell angiogenesis and migration (8). Cyclopamine is a powerful hedgehog signaling antagonist, and mainly targets the Smoothened (Smo) proteins (15).

The inhibitory effects of cyclopamine on the Hedgehog signaling pathway is achieved as follows: Cyclopamine binds directly to Smo, which affects its function and interferes with Shh signaling. Cyclopamine also inhibits the Hedgehog signaling pathway in a Ptch-independent manner and acts to suppress carcinogenesis. Additionally, it converts Smo into its active form (16). The mechanism by which cyclopamine specifically inhibits Shh activation is currently unclear. It was proposed that cyclopamine interferes with the reception of Hedgehog signaling in vertebrates; this process involves receptors with multiple transmembrane domains, namely, Ptch and Smo (17).

BPH is caused by a non-malignant proliferation of epithelial and stromal cells in the prostate gland areas (18). It has been reported that stromal-epithelial associations play central modulator roles in prostate growth and in homeostasis of the adult prostate (19). Previously, various studies have demonstrated close associations between cyclopamine and the Hedgehog signaling pathway, and this compound is commonly employed in the treatment of prostate cancer (13,14). To further determine its functions and roles in regulating BPH, the present study investigated the effects of cyclopamine on the proliferation and apoptosis of epithelial and stromal cells in rats with BPH by blocking the Hedgehog signaling pathway.

Materials and methods

Study subjects

A total of 15 normal male SD rats and 50 SD rats with BPH (6-8 weeks, weighing 400-450 g) were purchased from the Hunan SLAC Laboratory Animal Co., Ltd. (Changsha, China) and housed under a 12 h light/dark cycle at 22±2°C with relative humidity at 50±10%. Following 1 week of acclimatization, rats were fasted overnight with free access to water prior to experiments. Cyclopamine (0, 10, 20 and 30 mg/kg) was intraperitoneally injected into rats with BPH (n=5), and BPH tissues was collected for western blot analysis of Smo protein. The remaining 45 rats were assigned into the normal group (normal rats, n=15), the BPH group (BPH rats, n=15) and the cyclopamine group (BPH rats, n=15). Rats in the cyclopamine group were intraperitoneally injected with 20 mg/kg cyclopamine. Rats in the normal and BPH groups were fed normally. After 1 week, rats were sacrificed via CO2 overdose; prostate tissues were obtained to determine the indexes described below. Wet weight was measured using an analytical balance, prostate volume was measured by the volumetric method (20), and prostate index (PI) was calculated using the formula: PI=wet weight of prostate/total body weight. All rats were fed in specific-pathogen-free grade chambers, which was compliant with the Laboratory Animal Requirements of Environment and Housing Facilities Guidelines (GB 14925-2010).

Hematoxylin and eosin (H&E) staining

Tissues were sectioned (5-µm thick), laid out at 45°C, selected and dried at 60°C for 1 h. They were then deparaffinized with xylene and stained with the H&E solution (Beijing Solarbio Science & Technology Co., Ltd. Beijing, China). Then, tissue sections were dehydrated with an ethanol gradient (50, 70, 80 and 95%), cleared with xylene, mounted using neutral gum, and observed under a Zeiss fluorescence microscope (magnification ×400; Axio Observer A1/D1/Z1, Zeiss AG to analyze histopathological changes in prostate tissues.

Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) staining

Triton X-100 (0.1%) was added to tissue sections, which were then placed on ice for 4 min and washed three times with PBS (2 min each time). TUNEL reaction solution (50 µl, ZK-8005, Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.) was added for 1 h at 37°C; tissues were then washed three times with PBS. Diaminobenzidine/H2O2 solution (cat. no. 2014, Invitrogen; Thermo Fisher Scientific, Inc.) was then added for 5 min at room temperature, after which it was terminated by washing the sections with PBS. Hematoxylin was applied for re-staining at 37°C for 10 sec, and sections were dehydrated, cleared, sealed with anti-fluorescence quenching sealing solution and observed under a fluorescence microscope (magnification ×400; BX43; Olympus Optical Co., Ltd.) with five high power fields randomly selected to count the number of TUNEL positive cells.

Immunohistochemistry

Tissues were fixed using formaldehyde, paraffin-embedded, and sectioned into 4 µm slices. They were then dried in a 60°C incubator for 1 h, deparaffinized by xylene (Mingtou Industry and Trade Co., Ltd., Shanghai, China), dehydrated an ethanol gradient (50, 70, 80 and 95%), incubated with 3% H2O2 for 10 min, and finally washed with PBS. Antigen retrieval was performed under high pressure for 90 sec, after which samples were cooled down to room temperature. Non-specific binding was blocked with 5% bovine serum albumin (BSA; Shanghai Sangon Biological Engineering Technology & Services Co., Ltd.) blocking buffer at 37°C for 30 min. Tissue sections were then incubated with the primary antibody (1:200, Ki67 monoclonal antibody, Biogot Technology, Inc., Nanjing, China) at 4°C overnight. Goat anti-mouse IgG secondary antibody labeled by biotin (1:1,000, ab6759, Abcam Inc., Cambridge, MA, USA) was added at 37°C for 30 min. Subsequently, streptavidin solution (Zhongshan Goldenbridge Biotechnology, Co. Ltd., Beijing, China) was added at 37°C for 30 min. This was followed by addition of 3,3′-diaminobenzidine (Bioss Biotechnology Co., Ltd., Beijing, China) for 5 min at room temperature. Tissues were washed with water for 5 min, and were immersed in the hematoxylin solution (Yinggong Reagent Co., Ltd., Shanghai, China) for 5 min at 37°C. Lastly, tissues were washed with running water. PBS was used in place of the primary antibody in the negative control group. Tissue sections with positive expression were included in the positive control group. Tissue sections were observed and imaged under an optical microscope (XSP-36, Boshida Optical Instrument Co., Shenzhen, China). A total of five high power fields (magnification, ×200) were randomly selected, and 100 prostate cells in each field were analyzed. If the percentage of cells with positive expression was <10, ≥10 but <50%, or ≥50%, the staining result is negative, positive, or strongly positive, respectively (15).

Cell treatment

A region of the anterior lobe on the right side and ventral lobe of the prostate were collected, washed twice with the D-Hanks solution, and cut into pieces. Any visible macro-vascular tissue was removed, and the lobes were digested with 2% trypsin at room temperature for 30 min. Following a 5-min centrifugation at 1,789 × g at 25°C, tissues were digested with 0.06% collagenase type II at room temperature for 15 min, and were then filtered. The filtrate was mixed evenly with culture suspension of epithelial cells, which was then inoculated in a culture flask embedded with fibronectin (Shanghai Sangon Biological Engineering Technology & Services Co., Ltd.). Cells were cultured with 10% fetal bovine serum (FCS500, Excell Bio Company, Shanghai, China) at 5% CO2 and 37°C. A mixture composed of insulin-transferrin-selenium (with a volume ratio of 1:100), 0.5 µg/l β-endothelial cell growth factor and 100×103 U/l penicillin-streptomycin double-antibody (B540732; Shanghai Sangon Biological Engineering Technology & Services Co., Ltd.) was added.

MTT assay

Epithelial and stromal cells (2.5×105 cells/ml) were seeded into a 96-well plate. Cells were maintained in an incubator at 5% CO2 and 37°C. The plate was removed on days 1, 2, 3, 4 and 5 for the MTT assay. Briefly, 10 µl MTT solution (5 g/l) (GD-Y1317, Guduo Biotechnology Company, Shanghai, China) was added into each well. Cells were then further incubated at 37°C for 24 h. This was followed by the addition of 100 µl dimethyl sulfoxide (D2650, Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). The plate was then slightly shaken and mixed evenly for 10 min. An automatic enzymelabelled reading meter (BS-1101, Detielab Co., Ltd., Nanjing, China) was used to measure the optical density value at 490 nm.

Flow cytometry

Cells were collected by 0.25% trypsin at 37°C for 30 min, washed with PBS, and re-centrifuged at 1,145 × g for 5 min at room temperature. Cell precipitates were fixed using pre-cooled 70% ethanol at 4°C overnight, and washed twice with PBS. Cell suspension (100 µl, total number of cells no less than 106 cells/ml) was obtained, to which 1 ml of 50 mg/l propidium iodide (containing RNAase, Sigma-Aldrich; Merck KGaA) was added. Staining was conducted for 30 min in the dark. A nylon net with 100 pores was used for filtration; flow cytometry was performed with an excitation wavelength of 488 nm for cell cycle analysis (ModFit LT; version 4.1; Verity Software House, Inc.).

Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide double staining was used to examine cell apoptosis; cells were treated aforementioned for cell cycle analysis. Cells were then incubated for 48 h at 37°C with 5% CO2. Subsequently, cells were collected, washed twice with PBS, centrifuged at 1,145 × g for 5 min at room temperature, and resuspended in 200 µl binding buff er. As per the instructions of the Annexin-V-FITC cell apoptosis detection kit (K201-100, BioVision, Mountain View, CA, USA), Annexin V-FITC, PI and HEPES were used to make up the Annexin V-FITC/propidium iodide cocktail in a 1:2:50 ratio. Cells were then incubated in the dark at room temperature for 20 min. Flow cytometry was used to detect cell apoptosis at an excitation wavelength of 488 nm. The experiment was repeated three times.

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

Total RNA in prostate cells of all rats were extracted with TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.). RT-qPCR was carried out according to the instructions provided by the TaqMan MicroRNA Assays Reverse Transcription kit (cat. no. 4427975, Applied Biosystems Inc.; Thermo Fisher Scientific, Inc.) using an ABI7500 quantitative PCR instrument (7500, ABI Company, Oyster Bay, N.Y., USA). The qPCR reaction conditions were as follows: Pre-denaturation (95°C) for 5 min, denaturation (94°C) for 10 sec, annealing for 30 sec at 30°C, and DNA strand extension for 15 sec at 72°C; 40 cycles were performed in total. GAPDH was used as the internal reference gene, and relative mRNA expression was determined by the 2-∆∆Cq method (21), where ΔCt=Cttargeted gene-CtGAPDH. The experiment was repeated three times. Primer sequences of RT-qPCR are listed in Table I.

Table I

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

Table I

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

GenePremier sequence (5′-3′)
ShhForward: ACCGAGGGCTGGGACGAAGA
Reverse: ATTTGGCCGCCACCGAGTT
Ptch1Forward: TTTGGACTGCTTCTGGGAAGGG
Reverse: TTTTTGTTGGGGGCTGTGGC
Gli1Forward: GAAGGTGAAGGTCGGAGT
Reverse: GTCCAGGCTGGCATCCGACA
b-FGFForward: GAGGAGTTGTGTCTATCAAAG
Reverse: GTTCGTTTCAGTGCCACATACC
TGF-βForward: CAAGAGGCTGTGTTGVTGTGAATC
Reverse: GTTGGTTTGAGAAAATCCATCGG
BaxForward: GACCAGGGTGGCTGGGAAGG
Reverse: GATGGTGAGCGAGGCGGTGA
Bcl-2Forward: CCGGCATCTGCACACCTGG
Reverse: CACAACTTTGTTTCATGGTCCATCC
GAPDHForward: AACGGATTTGGTCGTATTGGG
Reverse: TCGCTCCTGGAAGATGGTGAT

[i] Shh, sonic hedgehog; Ptch1, Patched-1; Gli1, glioma-associated oncogene homolog 1; b-FGF, basic fibroblastic growth factor, TGF-β, transforming growth factor β; GAPDH, glyceraldehyde-phosphate dehydrogenase.

Western blot analysis

Protein was detected using the bicinchoninic acid kit (cat. no. 20201ES76; Yeason Biotechnology Co. Ltd.); samples were diluted in deionized water to achieve a loading quantity of 30 µg protein per lane. Proteins were separated via SDS-PAGE (12% gel) transferred onto a nitrocellulose membrane, which was sealed using 5% skim milk powder at 4°C and kept overnight. Diluted primary anti-rabbit polyclonal antibodies were added to the cells, and included Shh (1:1,000, ab53281, Abcam), Gli1 (1:1,500, ab151796, Abcam), Ptch1 (1:1,500, ab53715, Abcam), basic fibroblastic growth factor (b-FGF; 1:200, ab99979, Abcam), transforming growth factor β (TGF-β; ab31013, Abcam), B-cell lymphoma-2 (Bcl-2)-associated X protein (Bax; 1:2,000, ab32503, Abcam), Bcl-2 (1:500, ab692, Abcam), and GAPDH (1:2,500, ab9485, Abcam). The rabbit anti-human monoclonal secondary antibody (1:200, bs-0361R-HRP, BIOSS Company, Beijing, China) was used then added. Subsequently, protein bands were visualized using electrochemical luminescence (ECL808-25, Biomiga, Inc., San Diego, CA, USA) and analyzed by Image J software (version 2.1.4.7; National Institutes of Health Inc.).

Statistical analysis

All data were analyzed with the SPSS 21.0 software (IBM Corp., Armonk, NY, USA). Data were presented as the mean ± standard deviation. Comparisons among multiple groups were determined by one-way analysis of variance. Pairwise comparison of mean values was analyzed by the Least Significant Difference method. P<0.05 was considered to indicate a statistically significant difference.

Results

Cyclopamine decreases wet weight, volume, and PI of prostate in rats with BPH

In our study, we administered 0, 10, 20 and 30 mg/kg cyclopamine to rats with BPH rats (n=5), and BPH tissues were collected for determination of wet weight, volume, and PI of prostate in rats with BPH. The wet weight, volume and PI of prostate tissues in rats among the three groups were observed following establishment of the BPH model (Fig. 1). As compared with those in the normal group, the wet weight, volume and PI of the prostate were significantly increased in the BPH and cyclopamine groups (P<0.05). As compared with the BPH group, these parameters in the cyclopamine group were significantly decreased (P<0.05).

Figure 1

Wet weight, volume, and PI of prostate were reduced in BPH rats in response to cyclopamine treatment. BPH, benign prostatic hyperplasia; PI, prostate index. *P<0.05 vs. normal group. #P<0.05 vs. BPH group. PI, prostate index; BPH, benign prostatic hyperplasia.

Histopathological alterations in the prostate tissues after BPH model establishment and in response to cyclopamine treatment

H&E staining was conducted to observe the histopathological changes in rat prostate tissues. As presented in Fig. 2, prostatic epithelial cells in the normal group showed regular alignment as a columnar monolayer. Glands were of similar size, and were regularly arranged; the prostatic cavity was not expanded. In the BPH group, prostatic epithelia were observed to exhibit papillary hyperplasia and protrusion into the prostatic cavity in a zigzag fashion. The mesenchyme and surrounding vessels were expanded, with accompanying hyperemia and edema. Few glands were expanded, and the prostatic cavity was also enlarged. Regarding the cyclopamine group, prostatic epithelial cells were arranged in a columnar monolayer. The mesenchyme and the surrounding vessels were also expanded, along with hyperemia and slight edema. Few glands exhibited expanded cavities with hyperplasia.

Figure 2

H&E staining (magnification, ×400) of prostate tissues in BPH rats in response to cyclopamine treatment. In the normal group, glands were of the same size, and were regularly arranged; the prostatic cavity was not expanded. In the BPH group, the number of glands was increased and densely aligned; some glands were expanded, and the prostatic cavity was also enlarged. In the cyclopamine group, only a few of the glands exhibited cavity expansion with hyperplasia. BPH, benign prostatic hyperplasia.

Cyclopamine increases apoptotic body formation in BPH rats

A TUNEL assay was performed to investigate the effects of cyclopamine on prostate tissue cell apoptosis in BPH rats (Fig. 3). Compared with that of the normal group, apoptotic body formation was significantly reduced in the BPH and cyclopamine groups (P<0.05). Additionally, compared with that of the BPH group, apoptotic body formation was significantly increased in the cyclopamine group (P<0.05).

Figure 3

TUNEL assay indicates that cyclopamine promotes apoptotic body formation in BPH rats (A) TUNEL staining (magnification, ×400) of apoptotic body formation in the normal, BPH and cyclopamine groups. (B) Formation rate of apoptotic bodies was increased in BPH rats upon cyclopamine treatment; *P<0.05 vs. normal group. #P<0.05 vs. BPH group. BPH, benign prostatic hyperplasia; TUNEL, terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling.

As TUNEL staining was enhanced and apoptotic body formation was increased in the cyclopamine group, these parameters may serve as indicators in evaluating BPH. Our results suggested that cyclopamine could upregulate apoptotic body formation in BPH rats, as presented in Fig. 3B.

Cyclopamine reduces rate of Ki67 positive expression in BPH rats

The effects of cyclopamine on Ki67 expression in BPH rats was assessed by immunohistochemistry (Fig. 4A). As compared with that of the normal group, the positive Ki67 expression in the BPH and cyclopamine groups was significantly increased (P<0.05), which suggested Ki67 as an indicator for evaluating BPH. Compared with the BPH group, positive Ki67 expression was significantly decreased in the cyclopamine group (P<0.05). The results further suggested that cyclopamine could inhibit Ki67 protein expression (Fig. 4B). Collectively, our results suggested that cyclopamine inhibited BPH in rats by suppressing the expression of the cell proliferation marker Ki67 in BPH tissues.

Figure 4

Ki67 expression downregulated in the prostatic of BPH rat administered cyclopamine. (A) Immunohistochemical staining (magnification, ×400) for Ki67 expression in the normal, BPH and cyclopamine groups. (B) Quantitative analysis of positive Ki67 expression. *P<0.05 vs. normal group. #P<0.05 vs. BPH group. BPH, benign prostatic hyperplasia.

Cyclopamine hinders epithelial and stromal cell proliferation in BPH rats

An MTT assay was performed to determine the effects of cyclopamine on the proliferation of stromal (Fig. 5A) and epithelial cells (Fig. 5B) in BPH rats. As compared with the control group, cell proliferation in the BPH and cyclopamine groups was significantly increased (P<0.05). Compared with the BPH group, cell proliferation in the BPH group was significantly decreased (P<0.05). These findings suggested that cyclopamine could inhibit proliferation of epithelial and stromal cells in the prostate. The numbers of epithelial and stromal cells in prostate tissues were recorded via the cell counting method (Fig. 5C and D). Changes in the numbers of epithelial and stromal cells were comparable between the MTT assay and the cell counting method. Hence, cyclopamine contributed to repressed epithelial and stromal cell proliferation in BPH rats.

Figure 5

MTT assay and cell counting methods reveal that cyclopamine inhibits stromal and epithelial cell proliferation. Proliferation potential of (A) stromal cells and (B) epithelial cells in each group as detected by an MTT assay. Changes in the number of (C) stromal cells and (D) epithelial cells in each group; *P<0.05 vs. normal group. #P<0.05 vs. BPH group. BPH, benign prostatic hyperplasia.

Cyclopamine inhibits epithelial cell cycle progression and promotes epithelial cell apoptosis in BPH rats

Propidium iodide staining was adopted to detect epithelial cell cycle distribution (Fig. 6A-D). As compared with the normal group, the proportion of cells arrested at the G0/G1 phase in the BPH and cyclopamine groups was significantly reduced, while the proportion of cells at arrested the S phase was increased (P<0.05). Compared with the BPH group, the proportion of cells arrested at the G0/G1 phase in the cyclopamine group was significantly increased, while that of cells arrested at the S phase were reduced (P<0.05). Results indicated that cyclopamine could suppress cell proliferation and arrest cells at the G0/G1 phase.

Figure 6

Flow cytometry indicates that cyclopamine suppresses epithelial cell cycle progression and promotes their apoptosis in BPH rats. (A) PI single staining indicated epithelial cell cycle distribution in the normal, BPH and cyclopamine groups. (B) Quantitative analysis of epithelial cell cycle distribution. (C) Annexin V-FITC/PI double staining. (D) Quantitative analysis of epithelial cell apoptosis. *P<0.05 vs. normal group. #P<0.05 vs. BPH group. BPH, benign prostatic hyperplasia; FITC, fluorescein isothiocyanate; PI, propidium iodide.

Annexin V-FITC/propidium iodide double staining was adopted to assess epithelial cell apoptosis. The number of apoptotic cells in the BPH and cyclopamine groups were significantly reduced compared with the control group (P<0.05). Conversely, the number of apoptotic cells in the cyclopamine group was significantly increased (P<0.05) than that of the BPH group. These results suggested that cyclopamine could induce the apoptosis of epithelial cells in BPH rats.

Cyclopamine decreases the expression of Shh, Ptch1, Gli1, b-FGF, TGF-β and Bcl-2, but increases that of Bax in BPH rats

Finally, RT-qPCR (Fig. 7) and western blot analysis (Fig. 8) were used to measure mRNA and protein levels of Hedgehog signaling pathway- and apoptosis-associated genes, as well as b-FGF and TGF-β. Compared with the normal group, the mRNA and protein levels of Shh, Ptch1, Gli1, b-FGF, TGF-β, and Bcl-2 were significantly increased in the BPH and cyclopamine groups; conversely, Bax mRNA and protein levels were significantly decreased (P<0.05). In addition, as compared with those of the BPH group, the protein levels of Shh, Ptch1, Gli1, b-FGF, TGF-β and Bcl-2 were greatly reduced in the cyclopamine group, while Bax mRNA and protein levels were greatly increased (P<0.05). These results indicated that cyclopamine blocks the Hedgehog signaling pathway to inhibit cell proliferation and enhances apoptosis in BPH rats.

Figure 7

Effect of cyclopamine on mRNA expression of Shh, Ptch1, Gli1, b-FGF, TGF-β, and Bcl-2 in the normal, BPH and cyclopamine groups. *P<0.05 vs. normal group. #P<0.05 vs. BPH group. Shh, sonic hedgehog; Ptch1, Patched-1; Gli1, glioma-associated oncogene homolog 1; Bcl-2, B-cell lymphoma 2; Bax, Bcl-2-associated X protein; b-FGF, basic fibroblastic growth factor, TGF-β, transforming growth factor β; BPH, benign prostatic hyperplasia.

Figure 8

Western blot showing protein levels of Shh, Ptch1, Gli1, b-FGF, TGF-β and Bcl-2 in BPH rats. (A) Protein bands of Shh, Ptch1, Gli1, b-FGF, TGF-β, Bax, and Bcl-2. (B) Quantitative analysis of the relative protein expression levels of Shh, Ptch1, Gli1, b-FGF, TGF-β, Bax and Bcl-2. *P<0.05 vs. normal group. #P<0.05 vs. BPH group. Shh, sonic hedgehog; Ptch1, Patched-1; Gli1, glioma-associated oncogene homolog 1; Bcl-2, B-cell lymphoma 2; Bax, Bcl-2-associated X protein; b-FGF, basic fibroblastic growth factor, TGF-β, transforming growth factor β; BPH, benign prostatic hyperplasia.

Discussion

In recent years, BPH has become a disease that affects an increasing number of males >50 years old across the world due to its poorly understood pathogenesis (4). Studies have reported that the Hedgehog signaling pathway is activated in prostate cancers (16,22). As an inhibitor of the Hedgehog signaling pathway, cyclopamine serves a crucial role in suppressing prostate cancer and improving survival (13); however, the underlying mechanism of action in BPH remains uncertain. Thus, the present study aimed to investigate the effects of cyclopamine on the proliferation and apoptosis of epithelial and stromal cells in BPH rats by blocking the Hedgehog signaling pathway.

Initially, our results demonstrated that cyclopamine could decrease the wet weight, the volume and PI of prostate in BPH rats. In addition, the formation of nodular overgrowth in the epithelium and fibromuscular tissues inside the transition zone and the periurethral areas have also been observed (23). Glandular hyperplasia and interstitial hyperplasia can contribute to enlarged prostates (24). BPH rats exhibited higher wet weight and volume of prostate glands in the present study. Based on the evaluation of these variables, we hypothesized that cyclopamine may suppress BPH.

Immunohistochemistry analysis showed that cyclopamine could reduce the rate of positive Ki67 expression in BPH rats. Ki67 antigen has been reported as an effective tool in diagnosing and evaluating proliferative activity in normal prostate tissues, prostatic intraepithelial neoplasia and prostatic tumors (25,26). Ki67 is associated with the proliferative phase of cell cycle, and its overexpression can lead to a robust increase in the number of prostatic cells (27). Therefore, we evaluated Ki67 expression in proliferating prostate cells in all three groups. Our study revealed that cyclopamine could suppress cell proliferation and promote cell apoptosis in prostate tissues in BPH rats. Despite its uncertain pathogenesis, the progression of BPH is highly associated with decreased cell apoptosis, which leads to an elevated number of stromal and epithelial cells (28). The Hedgehog signaling pathway has been reported to be a positive regulator and a proliferative stimulus during prostate cell growth (29). Inhibition of this signaling cascade by cyclopamine can lead to increased cell apoptosis (30,31), which is in consistent with our findings. BPH is characterized by the hyper-proliferation of epithelial and stromal prostatic cells, which results in complex cellular alterations (32). The development of BPH is concomitant with a decline in stromal and epithelial cell apoptosis (28). As cyclopamine can inhibit the Hedgehog signaling pathway, which is a crucial participator in prostatic cell progression, it may ultimately inhibit the apoptosis of epithelial cells (15).

Finally, our results indicated that expression of Shh, Ptch1, Gli1, b-FGF, TGF-β and Bcl-2 increased significantly, while Bax expression reduced substantially in rat models of BPH. This was also associated with activated Hedgehog signaling, increased proliferation and reduced cell apoptosis. In response to cyclopamine administration, the Hedgehog signaling pathway was inhibited, cell proliferation was suppressed, and cell apoptosis was enhanced. Shh/Ptch1/Gli1 are three essential members in the Hedgehog signaling pathway that can exert notable effects on the progression of BPH (33). As a gene encoding angiogenic cytokine, b-FGF was reported to induce epithelial cell proliferation, which can further promote BPH (34). A previous study has confirmed the role of TGF-β in aggravating BPH (23). Bcl-2 and Bax belong to the Bcl-2 family of proteins, with the former serving as an anti-apoptotic member, while the latter acts as a pro-apoptotic molecule (28,35). When Bcl-2 expression was reduced and Bax expression was increased, BPH progression was inhibited (36).

Taken together, the present study is the first to explore the functional role of cyclopamine in BPH to the best of our knowledge. Prior to this, clinical research studies have shown that α1 antagonists, 5α reductase inhibitors, and a combination of these two molecules can inhibit BPH (37). In addition, silencing of upregulated gene 11 can also inhibit the proliferation and epithelial-mesenchymal transition of BPH cells (38). In addition, Wang et al (39) showed that metformin could suppress BPH epithelial cell proliferation by inhibiting the secretion of insulin-like growth factor (IGF)-1 receptor and IGF-1 in stromal cells.

This study demonstrated that cyclopamine reduced the proliferation of epithelial and stromal cells, and promoted epithelial cell apoptosis by blocking the Hedgehog signaling pathway in BPH rats. Future studies are still required to investigate the mechanism by which inhibition of Hedgehog signaling by cyclopamine can restrict the progression of BPH. This may also provide novel insights into potential treatments BPH with cyclopamine.

Funding

The present study was supported by the Clinical Medical Technological Innovation Guidance Project of Technological Innovation Guidance Plan in Hunan Province (grant no. 2017SK50305), the Scientific Research Project of Traditional Chinese Medicine in Hunan Province (grant no. 201832), the General Program of National Natural Science Foundation of China (grant no. 81673984), and the Construction Project of He Juqiao's National Traditional Chinese Medicine Expert Inheritance Studio. The authors thank the reviewers for their helpful comments.

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author upon reasonable request.

Authors' contributions

YY, WZ, TL and JQH wrote the paper and conceived and designed the experiments. XZha collected the data, and QZ and XZho analyzed the data. YY and JY obtained the results and validated them. YY, WZ and TL contributed to drafting the manuscript. All authors have read and approved the final published version of this manuscript.

Ethics approval and consent to participate

The present study was approved by the Ethics Committee of Hunan University of Chinese Medicine (Changsha, China) and conducted in accordance with the Laboratory animal-Requirements of Environment and Housing Facilities Guidelines (approval no. GB 14925-2010).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Acknowledgments

Not applicable.

References

1 

Kristal AR, Arnold KB, Schenk JM, Neuhouser ML, Goodman P, Penson DF and Thompson IM: Dietary patterns, supplement use, and the risk of symptomatic benign prostatic hyperplasia: Results from the prostate cancer prevention trial. Am J Epidemiol. 167:925–934. 2008. View Article : Google Scholar : PubMed/NCBI

2 

De Nunzio C, Kramer G, Marberger M, Montironi R, Nelson W, Schröder F, Sciarra A and Tubaro A: The controversial relationship between benign prostatic hyperplasia and prostate cancer: The role of inflammation. Eur Urol. 60:106–117. 2011. View Article : Google Scholar : PubMed/NCBI

3 

McVary KT, Roehrborn CG, Avins AL, Barry MJ, Bruskewitz RC, Donnell RF, Foster HE Jr, Gonzalez CM, Kaplan SA, Penson DF, et al: Update on AUA guideline on the management of benign prostatic hyperplasia. J Urol. 185:1793–1803. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Neuhouser ML, Schenk J, Song YJ, Tangen CM, Goodman PJ, Pollak M, Penson DF, Thompson IM and Kristal AR: Insulin-like growth factor-I, insulin-like growth factor binding protein-3 and risk of benign prostate hyperplasia in the prostate cancer prevention trial. Prostate. 68:1477–1486. 2008. View Article : Google Scholar : PubMed/NCBI

5 

Kaplan SA, Walmsley K and Te AE: Tolterodine extended release attenuates lower urinary tract symptoms in men with benign prostatic hyperplasia. J Urol. 174:2273–2275; discussion 2275-2276. 2005. View Article : Google Scholar : PubMed/NCBI

6 

Keehn A, Taylor J and Lowe FC: Phytotherapy for benign prostatic hyperplasia. Curr Urol Rep. 17:532016. View Article : Google Scholar : PubMed/NCBI

7 

Ok CY, Singh RR and Vega F: Aberrant activation of the hedgehog signaling pathway in malignant hematological neoplasms. Am J Pathol. 180:2–11. 2012. View Article : Google Scholar :

8 

Yoo YA, Kang MH, Kim JS and Oh SC: Sonic hedgehog signaling promotes motility and invasiveness of gastric cancer cells through TGF-beta-mediated activation of the ALK5-Smad 3 pathway. Carcinogenesis. 29:480–490. 2008. View Article : Google Scholar : PubMed/NCBI

9 

Chen Q, Gao G and Luo S: Hedgehog signaling pathway and ovarian cancer. Chin J Cancer Res. 25:346–353. 2013.PubMed/NCBI

10 

Taylor R, Long J, Yoon JW, Childs R, Sylvestersen KB, Nielsen ML, Leong KF, Iannaccone S, Walterhouse DO, Robbins DJ and Iannaccone P: Regulation of GLI1 by cis DNA elements and epigenetic marks. DNA Repair (Amst). 79:10–21. 2019. View Article : Google Scholar

11 

Skoda AM, Simovic D, Karin V, Kardum V, Vranic S and Serman L: The role of the Hedgehog signaling pathway in cancer: A comprehensive review. Bosn J Basic Med Sci. 18:8–20. 2018. View Article : Google Scholar :

12 

Bar EE, Chaudhry A, Lin A, Fan X, Schreck K, Matsui W, Piccirillo S, Vescovi AL, DiMeco F, Olivi A and Eberhart CG: Cyclopamine-mediated hedgehog pathway inhibition depletes stem-like cancer cells in glioblastoma. Stem Cells. 25:2524–2533. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Kumar SK, Roy I, Anchoori RK, Fazli S, Maitra A, Beachy PA and Khan SR: Targeted inhibition of hedgehog signaling by cyclopamine prodrugs for advanced prostate cancer. Bioorg Med Chem. 16:2764–2768. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Atkins D, Reiffen KA, Tegtmeier CL, Winther H, Bonato MS and Störkel S: Immunohistochemical detection of EGFR in paraffin-embedded tumor tissues: Variation in staining intensity due to choice of fixative and storage time of tissue sections. J Histochem Cytochem. 52:893–901. 2004. View Article : Google Scholar : PubMed/NCBI

15 

Zhang X, Harrington N, Moraes RC, Wu MF, Hilsenbeck SG and Lewis MT: Cyclopamine inhibition of human breast cancer cell growth independent of Smoothened (Smo). Breast Cancer Res Treat. 115:505–521. 2009. View Article : Google Scholar

16 

Slusarz A, Shenouda NS, Sakla MS, Drenkhahn SK, Narula AS, MacDonald RS, Besch-Williford CL and Lubahn DB: Common botanical compounds inhibit the hedgehog signaling pathway in prostate cancer. Cancer Res. 70:3382–3390. 2010. View Article : Google Scholar : PubMed/NCBI

17 

Chen JK, Taipale J, Cooper MK and Beachy PA: Inhibition of Hedgehog signaling by direct binding of cyclopamine to Smoothened. Genes Dev. 16:2743–2748. 2002. View Article : Google Scholar : PubMed/NCBI

18 

Palumbo A, Casanova LM, Corrêa MFP, Da Costa NM, Nasciutti LE and Costa SS: Potential therapeutic effects of underground parts of Kalanchoe gastonis-bonnieri on benign prostatic hyperplasia. Evid Based Complement Alternat Med. 2019:63407572019. View Article : Google Scholar :

19 

Kogan-Sakin I, Cohen M, Paland N, Madar S, Solomon H, Molchadsky A, Brosh R, Buganim Y, Goldfinger N, Klocker H, et al: Prostate stromal cells produce CXCL-1, CXCL-2, CXCL-3 and IL-8 in response to epithelia-secreted IL-1. Carcinogenesis. 30:698–705. 2009. View Article : Google Scholar : PubMed/NCBI

20 

Liu XY, Liu X, Xu L, Gui B, Yang QY, Yan JY and Sun ZY: A mathematical model for predicting putative association between E2/T ratio and the development of benign prostate hyperplasia in rats. Biol Reprod. 100:133–138. 2019. View Article : Google Scholar

21 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

22 

Shaw A and Bushman W: Hedgehog signaling in the prostate. J Urol. 177:832–838. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Wang L, Yang JR, Yang LY and Liu ZT: Chronic inflammation in benign prostatic hyperplasia: Implications for therapy. Med Hypotheses. 70:1021–1023. 2008. View Article : Google Scholar

24 

Kobayashi S, Tomiyama Y, Tatemichi S, Hoyano Y, Kobayashi M and Yamazaki Y: Effects of silodosin and tamsulosin on the urethra and cardiovascular system in young and old dogs with benign prostatic hyperplasia. Eur J Pharmacol. 613:135–140. 2009. View Article : Google Scholar : PubMed/NCBI

25 

Adisa JO, Egbujo EC, Ibrahim B, Musa B and Madukwe J: Expression of some selected cytokeratins and Ki67 protein in prostatic tumor: Can these be used as tumor markers. Pan Afr Med J. 20:462015. View Article : Google Scholar : PubMed/NCBI

26 

Seligson DB, Yu H, Tze S, Said J, Pantuck AJ, Cohen P and Lee KW: IGFBP-3 nuclear localization predicts human prostate cancer recurrence. Horm Cancer. 4:12–23. 2013. View Article : Google Scholar :

27 

Fonseca-Alves CE, Kobayashi PE, Palmieri C and Laufer-Amorim R: Investigation of c-KIT and Ki67 expression in normal, preneoplastic and neoplastic canine prostate. BMC Vet Res. 13:3802017. View Article : Google Scholar : PubMed/NCBI

28 

Zheng H, Xu W, Lin J, Peng J and Hong Z: Qianliening capsule treats benign prostatic hyperplasia via induction of prostatic cell apoptosis. Mol Med Rep. 7:848–854. 2013. View Article : Google Scholar : PubMed/NCBI

29 

Vezina CM and Bushman AW: Hedgehog signaling in prostate growth and benign prostate hyperplasia. Curr Urol Rep. 8:275–280. 2007. View Article : Google Scholar

30 

Wang X, Fan G, Wei F, Bu Y and Huang W: Hyperoside protects rat ovarian granulosa cells against hydrogen peroxide-induced injury by sonic hedgehog signaling pathway. Chem Biol Interact. 310:1087592019. View Article : Google Scholar : PubMed/NCBI

31 

Sharma A, De R, Javed S, Srinivasan R, Pal A and Bhattacharyya S: Sonic hedgehog pathway activation regulates cervical cancer stem cell characteristics during epithelial to mesenchymal transition. J Cell Physiol Feb. 4:Epub ahead of print.

32 

Penna G, Fibbi B, Amuchastegui S, Corsiero E, Laverny G, Silvestrini E, Chavalmane A, Morelli A, Sarchielli E, Vannelli GB, et al: The vitamin D receptor agonist elocalcitol inhibits IL-8-dependent benign prostatic hyperplasia stromal cell proliferation and inflammatory response by targeting the RhoA/Rho kinase and NF-kappaB pathways. Prostate. 69:480–493. 2009. View Article : Google Scholar

33 

Oue T, Yoneda A, Uehara S, Yamanaka H and Fukuzawa M: Increased expression of the hedgehog signaling pathway in pediatric solid malignancies. J Pediatr Surg. 45:387–392. 2010. View Article : Google Scholar : PubMed/NCBI

34 

Lin J, Zhou J, Xu W, Hong Z and Peng J: Qianliening capsule inhibits benign prostatic hyperplasia angiogenesis via the HIF-1α signaling pathway. Exp Ther Med. 8:118–124. 2014. View Article : Google Scholar : PubMed/NCBI

35 

Iacopino F, Angelucci C, Lama G, Zelano G, La Torre G, D'Addessi A, Giovannini C, Bertaccini A, Macaluso MP, Martorana G and Sica G: Apoptosis-related gene expression in benign prostatic hyperplasia and prostate carcinoma. Anticancer Res. 26:1849–1854. 2006.PubMed/NCBI

36 

Shariat SF, Ashfaq R, Roehrborn CG, Slawin KM and Lotan Y: Expression of survivin and apoptotic biomarkers in benign prostatic hyperplasia. J Urol. 174:2046–2050. 2005. View Article : Google Scholar : PubMed/NCBI

37 

Shum CF, Lau W and Teo CPC: Medical therapy for clinical benign prostatic hyperplasia: α-1 antagonists, 5α reductase inhibitors and their combination. Asian J Urol. 4:185–190. 2017. View Article : Google Scholar : PubMed/NCBI

38 

Zhang G, Zhu F, Han G, Li Z, Yu Q, Li Z and Li J: Silencing of URG11 expression inhibits the proliferation and epithelial-mesenchymal transition in benign prostatic hyperplasia cells via the RhoA/ROCK1 pathway. Mol Med Rep. 18:391–398. 2018.PubMed/NCBI

39 

Wang Z, Xiao X, Ge R, Li J, Johnson CW, Rassoulian C and Olumi AF: Metformin inhibits the proliferation of benign prostatic epithelial cells. PLoS One. 12:e01733352017. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yuan YF, Zhu WX, Liu T, He JQ, Zhou Q, Zhou X, Zhang X and Yang J: Cyclopamine functions as a suppressor of benign prostatic hyperplasia by inhibiting epithelial and stromal cell proliferation via suppression of the Hedgehog signaling pathway. Int J Mol Med 46: 311-319, 2020.
APA
Yuan, Y., Zhu, W., Liu, T., He, J., Zhou, Q., Zhou, X. ... Yang, J. (2020). Cyclopamine functions as a suppressor of benign prostatic hyperplasia by inhibiting epithelial and stromal cell proliferation via suppression of the Hedgehog signaling pathway. International Journal of Molecular Medicine, 46, 311-319. https://doi.org/10.3892/ijmm.2020.4569
MLA
Yuan, Y., Zhu, W., Liu, T., He, J., Zhou, Q., Zhou, X., Zhang, X., Yang, J."Cyclopamine functions as a suppressor of benign prostatic hyperplasia by inhibiting epithelial and stromal cell proliferation via suppression of the Hedgehog signaling pathway". International Journal of Molecular Medicine 46.1 (2020): 311-319.
Chicago
Yuan, Y., Zhu, W., Liu, T., He, J., Zhou, Q., Zhou, X., Zhang, X., Yang, J."Cyclopamine functions as a suppressor of benign prostatic hyperplasia by inhibiting epithelial and stromal cell proliferation via suppression of the Hedgehog signaling pathway". International Journal of Molecular Medicine 46, no. 1 (2020): 311-319. https://doi.org/10.3892/ijmm.2020.4569
Copy and paste a formatted citation
x
Spandidos Publications style
Yuan YF, Zhu WX, Liu T, He JQ, Zhou Q, Zhou X, Zhang X and Yang J: Cyclopamine functions as a suppressor of benign prostatic hyperplasia by inhibiting epithelial and stromal cell proliferation via suppression of the Hedgehog signaling pathway. Int J Mol Med 46: 311-319, 2020.
APA
Yuan, Y., Zhu, W., Liu, T., He, J., Zhou, Q., Zhou, X. ... Yang, J. (2020). Cyclopamine functions as a suppressor of benign prostatic hyperplasia by inhibiting epithelial and stromal cell proliferation via suppression of the Hedgehog signaling pathway. International Journal of Molecular Medicine, 46, 311-319. https://doi.org/10.3892/ijmm.2020.4569
MLA
Yuan, Y., Zhu, W., Liu, T., He, J., Zhou, Q., Zhou, X., Zhang, X., Yang, J."Cyclopamine functions as a suppressor of benign prostatic hyperplasia by inhibiting epithelial and stromal cell proliferation via suppression of the Hedgehog signaling pathway". International Journal of Molecular Medicine 46.1 (2020): 311-319.
Chicago
Yuan, Y., Zhu, W., Liu, T., He, J., Zhou, Q., Zhou, X., Zhang, X., Yang, J."Cyclopamine functions as a suppressor of benign prostatic hyperplasia by inhibiting epithelial and stromal cell proliferation via suppression of the Hedgehog signaling pathway". International Journal of Molecular Medicine 46, no. 1 (2020): 311-319. https://doi.org/10.3892/ijmm.2020.4569
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team