Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
November-2020 Volume 46 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2020 Volume 46 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Resveratrol protects retinal ganglion cells against ischemia induced damage by increasing Opa1 expression

  • Authors:
    • Yulian Pang
    • Mengqi Qin
    • Piaopiao Hu
    • Kaibao Ji
    • Ruihan Xiao
    • Nan Sun
    • Xinghui Pan
    • Xu Zhang
  • View Affiliations / Copyright

    Affiliations: Affiliated Eye Hospital of Nanchang University, Jiangxi Research Institute of Ophthalmology and Visual Science, Jiangxi Provincial Key Laboratory for Ophthalmology, Nanchang, Jiangxi 330006, P.R. China
    Copyright: © Pang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 1707-1720
    |
    Published online on: August 27, 2020
       https://doi.org/10.3892/ijmm.2020.4711
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Loss of idiopathic retinal ganglion cells (RGCs) leads to irreversible vision defects and is considered the primary characteristic of glaucoma. However, effective treatment strategies in terms of RGC neuroprotection remain elusive. In the present study, the protective effects of resveratrol on RGC apoptosis, and the mechanisms underlying its effects were investigated, with a particular emphasis on the function of optic atrophy 1 (Opa1). In an ischemia/reperfusion (I/R) injury model, the notable thinning of the retina, significant apoptosis of RGCs, reduction in Opa1 expression and long Opa1 isoform to short Opa1 isoform ratios (L‑Opa1/S‑Opa1 ratio) were observed, all of which were reversed by resveratrol administration. Serum deprivation resulted in reductions in R28 cell viability, superoxide dismutase (SOD) activity, Opa1 expression and induced apoptosis, which were also partially reversed by resveratrol treatment. To conclude, results from the present study suggest that resveratrol treatment significantly reduced retinal damage and RGC apoptosis in I/R injury and serum deprivation models. In addition, resveratrol reversed the downregulated expression of Opa1 and reduced SOD activity. Mechanistically, resveratrol influenced mitochondrial dynamics by regulating the L‑Opa1/S‑Opa1 ratio. Therefore, these observations suggest that resveratrol may exhibit potential as a therapeutic agent for RGC damage in the future.

Introduction

Glaucoma describes a group of eye diseases that are characterized by idiopathic optic nerve injury and is regarded as the primary cause of irreversible visual impairment (1). It is generally accepted that the abnormal elevation of intraocular pressure (IOP), which is one of the critical risk factors associated with retinal ganglion cell (RGC) damage, is primarily responsible for the occurrence and development of glaucoma (2). However, since RGC failure is also observed under normal IOP, and appropriate IOP control can only inhibit RGC degeneration induced by ocular hypertension (3), novel neuro-protective approaches for RGCs are required as an additional strategy in managing glaucoma.

There are several hypotheses into the possible mechanisms underlying RGC cell death in glaucoma, including oxidative stress, glutamate excitotoxicity and nitric oxide-induced injury (4). In addition, accumulating evidence is suggesting that mitochondrial dysfunction can also result in the death of RGCs (5-7). Mitochondria are subcellular organelles that are enclosed in two layers of separated membranes and are considered a cornerstone of metabolism in the cell by generating energy (8). Therefore, mitochondrial dysfunction induces detrimental effects on cells, particularly those with higher energy demands, including RGCs, cardiomyocytes and skeletal muscle cells (9-12). Mitochondria continuously undergo morphological changes. This dynamic process, which is caused by the constant cycle of fusion and fission, is under strict sophisticated regulation by a group of dynamin-related GTPases (13,14). Among these mitochondrial dynamins, optical atrophy 1 (Opa1) is of particular interest. Opa1 is a mitochondrial protein that is encoded in the nucleus, which can not only regulate mitochondrial fusion but can also inhibit programmed cell death by regulating cytochrome c release (15).

Trans 3,5,4'-trihydroxystilbene, commonly referred to as resveratrol, is an important activator of sirtuin1 (Sirt1) that is abundantly present in giant knotweed, wine and grapes (16,17). Over recent decades, resveratrol has been garnering significant research attention due to its numerous potentially beneficial properties being reported, including anti-apoptotic, anti-inflammatory and antioxidant (18,19). Additionally, no apparent adverse effects of resveratrol treatment have been observed in previous animal models and clinical human studies, suggesting that resveratrol has promising prospects for future therapeutic use (20). Previous studies in rat models of glaucoma have also shown that resveratrol can exert protective effects on RGCs (21). However, the precise mechanisms of the effects of resveratrol on RGCs have not been fully characterized (22).

The present study investigated the potential effects of resveratrol on ischemia/reperfusion (I/R)-induced retina injury and serum deprivation-induced R28 cell apoptosis. The results showed that resveratrol protected RGCs against apoptosis by regulating the expression of Opa1 and the activity of superoxide dismutase (SOD). Additionally, it was found that resveratrol influenced the long Opa1 isoform to short Opa1 isoform (L-Opa1/S-Opa1) ratio by regulating the expression of proteins that post-translationally process Opa1 in the retina, including overlapping activity with m-AAA protease (Oma1) and yeast mitochondrial DNA escape 1 (Yme1). Although further study may be warranted to confirm the relationship between resveratrol and post-transcriptional proteases of Opa1, the present study contributes evidence that resveratrol can exert protective effects on RGCs.

Materials and methods

Animals

All experiments concerning animal studies were performed in accordance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research (arvo. org/About/policies/statement-for-the-use-of-animals-in-ophtha lmic-and-vision-research/). All procedures concerning animal use were approved and monitored by the Institutional Animal Care and Use Committee of Nanchang University (approval no. 2016NC-020-02). Male Sprague-Dawley (SD) rats, 2-3 months of age were provided by the Center of Laboratory Animal Science of Nanchang University and were used for transient retinal I/R studies. The rats were provided free access to sterile water and food and housed in a controlled environment with a 12-h light/dark cycle at 23°C and 60% humidity.

R28 cell culture

All reagents required for cell culture were provided by Biological Industries. R28 retinal neuronal-like cells were kindly provided by Dr Guotong Xu (Tongji University School of Medicine). R28 cells were maintained in low-glucose DMEM containing 100 mg/ml streptomycin, 100 U/ml penicillin and 10% FBS, in a humidified incubator with 5% CO2 at 37°C as described previously (23). Cells were sub-cultured every 3-4 days, and they had a doubling time of 18-20 h.

Transient retinal I/R model

A total of 66 rats were randomly separated into four groups: i) Sham group (n=18, eyes/group); ii) I/R group (n=30, eyes/group); iii) I/R + vehicle group (n=18, eyes/group); iv) and I/R + resveratrol group (n=18 eyes/group). The right eye was used for the I/R procedure in the I/R, I/R + vehicle and I/R + resveratrol groups. The sham procedure which cannulated and maintained the eye at normal IOP was performed on the left eye of the rats in the I/R group and was used as the control (24). To minimize the suffering of rats during I/R injury, rats were anesthetized by an intraperitoneal injection of 10% chloral hydrate (400 mg/kg) prior to I/R injury and did not exhibit symptoms of discomfort, including pain or peritonitis following chloral hydrate administration. To induce ocular ischemia, the IOP was elevated (~110 mm Hg) in one eye of the rats by cannulating the anterior chambers through a canula equipped with a raised reservoir for 60 min. Completion of retinal ischemia was judged by observing the blanching of the iris and retina. Resveratrol (Sigma-Aldrich; Merck KGaA) was dissolved and diluted in 25% ethanol to a concentration of 10 mg/ml. The I/R + resveratrol group were injected intraperitoneally with 25 mg/kg resveratrol 1 day before, at the time of and 1 day after I/R retina injury, whilst the I/R + vehicle group were treated with 25% ethanol. After 1, 3 and 7 days of retinal ischemia, the rats were euthanized by an intraperitoneal injection of 2% sodium pentobarbital (100 mg/kg), and the heartbeat, breathing and corneal reflex were observed. After verification of animal death through a lack of heartbeat, breathing or respiration, the eyeballs were then harvested from each rat.

Serum deprivation and drug treatment

Retinal neuronal R28 cells were seeded at the desired density into tissue culture dishes. A total of 8 groups of cells, which were seeded into 6-well plates at a density of 1.5x106 cells/well, were washed three times with PBS. For serum deprivation treatment, three groups of cells were incubated in serum-free DMEM for 12, 24 or 48 h respectively. Cells in the control group were incubated with supplemented DMEM. For resveratrol treatment studies, resveratrol was dissolved in DMSO to a stock concentration of 10 mM, and three groups of cells were then treated with 4 µM resveratrol dissolved in serum-free DMEM for 12, 24 or 48 h (25). The cells were incubated with supplemented DMEM containing 4 µM DMSO, and was considered the vehicle group. Untreated cells and treated cells were incubated in serum-free DMEM in the same manner as the normal controls and serum deprivation controls, respectively.

Protein preparation

Retinal tissue was separated from the retinal pigment epithelium and choroid before lysing using RIPA buffer containing PMSF (Beijing Solarbio Science & Technology Co., Ltd.). The lysates were then centrifuged at 15,000 x g at 4°C for 15 min, following which, the supernatant was collected to obtain tissue proteins.

For R28 cells, whole cell lysates were obtained by adding PMSF-containing RIPA buffer, followed by centrifugation at 10,000 x g for 20 min at 4°C. The supernatant, which contained the cellular proteins, was collected. The concentration of proteins were determined using a Bradford assay (Beyotime Institute of Biotechnology) according to the manufacturer's protocols.

Western blot analysis

The sample protein (30 µg) was separated using 7.5-15% SDS-PAGE and transferred onto a nitrocellulose membrane. Blots were blocked in 5% non-fat dry milk in TBS/Tween-20 for 1 h at room temperature before incubation with the appropriate primary antibodies against Sirt1 (1:1,000; cat. no. 9475; Cell Signaling Technology, Inc.), Opa1 (1:1,000; cat. no. 612606; BD Biosciences) or β-tubulin (1:1,000; cat. no. HC101-01; TransGen Biotech) overnight at 4°C. The blots were then incubated with a horseradish peroxidase-conjugated anti-rabbit IgG secondary antibody (1:2,500; cat. no. 7074; Cell Signaling Technology, Inc.) or horseradish peroxidase-conjugated anti-mouse IgG secondary antibody (1:2,500; cat. no. 7076; Cell Signaling Technology, Inc.) for 1 h at room temperature. Finally, protein bands on the membrane were visualized using enhanced chemiluminescent western blot detection reagent (EMD Millipore). Densitometry analysis was performed using ImageJ version 1.46 (National Institutes of Health).

RNA extraction and reverse transcription-quantitative PCR (RT-qPCR)

According to the manufacturer's protocols, RNA was extracted from the rat retinas using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). RNA concentration and purity were determined using spectrophotometry (Tiangen Biotech Co., Ltd.; cat. no. OSE-260). The extracted RNA (200 ng/sample) was then reverse-transcribed into cDNA using the Quantscript RT kit (Tiangen Biotech Co., Ltd.). Specific oligonucleotide primers for each gene, including Sirt1, Opa1, Oma1, Yme1 and β-actin (Table I), were designed and synthesized by Tiangen Biotech Co., Ltd.. Subsequently, qPCR was performed using RealMasterMix (SYBR Green) kit (Tiangen Biotech Co., Ltd.) with the following thermocycling conditions: 95°C for 20 sec; followed by 39 cycles of 58°C for 20 sec and 68°C for 30 sec. All samples were tested in triplicate, and the mean of the reactions was used for calculating the expression levels. All the data were collected from the linear range of each amplification. The results obtained were analyzed using the 2-ΔΔCq method (26) and expression levels were normalized to the average of the β-tubulin mRNA levels from the same samples.

Table I

Sequences of the primers used in the present study.

Table I

Sequences of the primers used in the present study.

GenePrimer sequence, 5'-3'
Opa1
 Forward CAGCTGGCAGAAGATCTCAAG
 Reverse CATGAGCAGGATTTTGACACC
Yme1
 Forward AGGATGCAATGCCAATCAAT
 Reverse TGCCACTCTTCCTCCCATAC
Oma1
 Forward ACCAGTGCAAAAGCTCCTTG
 Reverse TGTTCCTCTTCACGCTGTCT
Sirt1
 Forward GGCACCGATCCTCGAACAAT
 Reverse CGCTTTGGTGGTTCTGAAAGG
β-actin
 Forward CCCGCGAGTACAACCTTCTT
 Reverse CGACGAGCGCAGCGATA
β-actin nuclear
encoded variant
 Forward CTGCTCTTTCCCAGATGAGG
 Reverse CCACAGCACTGTAGGGGTTT
COII
 Forward TGAGCCATCCCTTCACTAGG
 Reverse TGAGCCGCAAATTTCAGAG

[i] Opa1, optic atrophy 1; Oma1, overlapping activities with m-AAA protease 1; Yme1, yeast mitochondrial DNA escape 1; Sirt1, sirtuin1; COII, cytochrome c oxidase subunit II.

Immunocytochemistry

R28 cells cultured in dishes were fixed with PBS containing 4% sucrose and 4% paraformaldehyde (PFA) for 20 min at room temperature. Cells were then blocked with PBS containing 5% BSA and 0.2% Triton X-100 (PBSTX) for 30 min at room temperature. Cells were incubated at room temperature with primary antibodies against Opa1 (1:50) diluted in PBSTX with 1% BSA for 4-6 h. The fixed cells were then washed and incubated with the appropriate Alexa Fluor® 488-conjugated donkey anti-Mouse IgG (H+L) secondary antibody (1:200; cat. no. R37144; Thermo Fisher Scientific, Inc.) dissolved in PBSTX containing 1% BSA for 45 min at room temperature. Subsequently, the cells were incubated with DAPI (Vector Laboratories, Inc.) and sealed using anti-fading buffer (Bioworld Technology, Inc.).

Immunohistochemistry, and hematoxylin and eosin (H&E) staining

Under anesthesia, 0.1 M PBS (pH 7.4) containing ice-cold 4% PFA was injected into the left cardiac ventricle of the rats for fixation before the eyeballs of the rats were removed and embedded in 4% PFA at 4°C for 1 day. After fixation, the eyeballs were dehydrated, embedded in paraffin and cut into 5-µm sections. The central part of the eyeballs, through the optic nerve, were selected for immunohistochemical analysis. Each section was heated with 10 mM sodium citrate buffer (pH 6.0) at the secondary boiling point (100°C) for 10 min and then cooled for 30 min for antigen retrieval. Blocking, primary and secondary antibody labelling, and all washing steps were performed as mentioned above. Staining was observed using a confocal microscopy at a magnification of x20 (Axio-Imager_LSM-800, ZEISS, Germany). H&E staining was observed using an inverted fluorescence microscope at a magnification of x20 (Nikon Corporation). The thicknesses of the inner retina [RGC + inner plexiform layer (IPL) + inner nuclear layer (INL)] were measured in the H&E sections using the Image-pro Plus version 6.0 (Media Cybernetics) at every quarter point of each retinal cross-section, which were then averaged. Each group contained four eyeballs to be measured. A total of 10 images were obtained from each retinal section of every eyeball for measuring the average.

RGC labeling and quantification

Fluoro-Gold (Fluorochrome, LLC) was injected into the superior colliculi of the rats to retro-gradely label the RGCs. The rats were anaesthetized with an intraperitoneal injection of 10% chloral hydrate and placed in a small stereotaxic instrument (RWD Life Science Co., Ltd.). The skull was then opened to identify the bregma spot and mark the injection site of the superior colliculus. A hole was then drilled at the designated point using a 25-gauge needle. In total, 1.5 µl 5% Fluoro-Gold solution dissolved in 0.9% sodium chloride were injected into the superior colliculus of both hemispheres using a Hamilton syringe before the skin incision was sutured. The rats started to receive resveratrol treatment 7 days after Fluoro-Gold injection, specifically at 1 day before, at the time of and 1 day after I/R retina injury before being sacrificed 7 days after retinal I/R injury. The eyes were then enucleated and dissected at the corneal limbus, following which, the lenses were removed and the posterior segments were fixed in 4% PFA at 4°C for 1 h. The retina, with a distinctive 'four-leafed' shape, was then tiled onto glass slides. RGCs labeled with Fluoro-Gold in these four microscopic fields of the retina were viewed under a fluorescence microscope at x20 magnification (IX71, Olympus Corporation). The selected fields were located at ~2 mm radially from the optic disc to account for the variations in retinal ganglion cell density. The number of RGCs were counted by two individuals in a double-blinded manner, where the averages of the two were taken as the final count.

Apoptosis assay

Apoptosis analysis in retinal cells was performed as described previously (25,27). The preparation of sections (5 µm) and the treatment of R28 cells were described above, following which a TUNEL assay was performed using In Situ Cell Death Detection kit, Fluorescein (Roche Applied Science) to detect apoptotic cells in accordance with manufacturer's protocol. Tissue sections were assessed using a confocal microscope at a magnification of x20 (Axio-Imager_ LSM-800, ZEISS, Germany). Digital images were obtained (SPOT; Diagnostic Instruments, Inc.) and Photoshop versions 5.5 and 7.0 (Adobe Systems, Inc.) was used to compile images.

Cell counting Kit-8 (CCK-8) assay

The viability of the cells was assessed using a CCK-8 assay (BestBio Science). Cells in the logarithmic growth phase were seeded into 96-well culture plates at a density of ~2.5-3x104 cells in 100 µl culture medium. After the cells had adhered, they were serum starved or treated with resveratrol before being treated with 10 µl CCK-8 Solution. An automatic microplate reader (Multiskan MK3; Thermo Fisher Scientific, Inc.) was used to measure the optical density value (OD) in each well at a wavelength of 450 nm. Cell viability was calculated from the OD values in each well using the following formula: [(Treated cell OD-blank OD)/(control cell OD-blank OD)]x100%.

SOD activity analysis

R28 cells were seeded into 60-mm tissue culture dishes, serum starved and treated with or without resveratrol. Whole cell lysates were obtained by sonication at 20% amplitude, 20 kHz, 130 W for 1 min, five times each on ice, with saline and then centrifuged at 10,000 x g for 15 min at 4°C. The supernatant was then assayed using an SOD kit (Nanjing Jiancheng Bioengineering Institute) according to the manufacturer's protocol. The OD value of each sample was measured using a Multiskan MK3 reader at a wavelength of 450 nm. The SOD value was calculated according to the following formulas: SOD inhibition rate (%)=[(AControl group-AControl blank group)-(AMeasurement group-AMeasurement blank group)]/(AControl group-AControl blank group)x100%; and, SOD activity (U/mg)=SOD inhibition rate (%)/50%x[reaction system (0.24 ml)/dilution factor (0.02 ml)]/sample protein concentration (mgprot/ml).

Mitochondrial (mt)DNA copy number (mitCN)

Ezup column animal genomic DNA extraction kit (Sangon Biotech Co., Ltd.) was used to collect retinal DNA. Relative mitCNs in the retinal samples were then measured by RT-qPCR and corrected using nuclear DNA. The amplification of mitochondrial cytochrome c oxidase subunit II (COII) and β-actin (nuclear-encoded gene) were examined. The specific sequences of the primers used are shown in Table I.

Statistical analysis

Statistical analysis was performed using Microsoft Excel (Office 365; Microsoft Corporation) and statistical analysis was performed using GraphPad Prism version 6 (GraphPad Software, Inc.). Results are presented as the mean ± standard deviation. Comparisons were performed using an ANOVA followed by a post-hoc Tukey's test. P<0.05 was considered to indicate a statistically significant difference.

Results

Resveratrol protects the retina and RGCs from I/R injury in rats

In the present study, general histopathological changes in the retina 7 days after injury induction were first investigated using H&E staining to evaluate the effects of resveratrol on the retina following retinal I/R injury. Significant thinning of the retina was observed after I/R injury, particularly in the GCL, IPL and INL. Administration of resveratrol prevented this reduction in retinal thickness (Fig. 1A). The quantity of RGCs was assessed using retrograde Fluoro-Gold labeling. RGCs were labeled with Fluoro-Gold 1 week before I/R, and the number of RGCs were counted 7 days after I/R or I/R + resveratrol. A significant reduction in the number of RGCs was observed 7 days after I/R, which was significantly reversed by the administration of resveratrol (Fig. 1B). Statistical analysis of inner retinal thickness (Fig. 1C) and RGC counts (Fig. 1D) were performed.

Figure 1

H&E staining and Fluoro-Gold retrograde marker. (A-D) H&E staining was observed using an inverted fluorescence microscope. Magnification x20. (E) Quantitative analysis of inner retina (GCL+IPL+INL) thickness variation. (F-I) Tiled retinas were examined 7 days after I/R and I/R + RES and were observed using an inverted fluorescence microscope. Magnification x40. (J) Quantitative analysis of Fluoro-Gold staining of RGCs. n=3 per group. Scale bar, 100 µm. ***P<0.001, ****P<0.0001 vs. 0 day; #P<0.05, ###P<0.001 vs. 7 days + vehicle group. RES, resveratrol; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; H&E, hematoxylin and eosin; I/R, ischemia/reperfusion; RGC, retinal ganglion cell.

To investigate the effects of resveratrol on the retina further, TUNEL staining was performed 1, 3 and 7 days after I/R injury to explore the effects of resveratrol on apoptosis. Compared with the control group (day 0), there was an increase in the number of TUNEL-positive cells observed in the GCL and INL of the I/R group on day 1 (Fig. 2). A strong TUNEL-positive fluorescent signal was observed in the ONL of the I/R group on day 3, whilst almost no fluorescence was observed in the retina 7 days after I/R. Resveratrol treatment reduced the levels of cell apoptosis on days 1, 3 and 7 after I/R.

Figure 2

TUNEL staining to detect apoptosis. Retinal paraffin section TUNEL staining observed using a confocal microscope. In the normal retinal paraffin section, no fluorescence was observed following TUNEL staining. TUNEL staining of I/R 1 d retinal paraffin sections exhibited strong fluorescence in GCL and INL. In the TUNEL staining of I/R 3 d retinal paraffin sections, ONL exhibited a stronger fluorescence signal. TUNEL staining of I/R 7 days retinal paraffin sections showed no obvious fluorescence signal. I/R 0 and 7 days retinal paraffin sections showed no significant fluorescence changes following RES treatment. RES significantly attenuated the fluorescence signal induced by apoptosis in GCL at I/R 1 and 3 days. Scale bar, 100 µm. Blue, DAPI; green, TUNEL-positive cells. RES, resveratrol; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer; I/R, ischemia/reperfusion.

Resveratrol regulates Opa1 protein and mRNA expression following retinal I/R injury

Resveratrol has been previously demonstrated to be a critical activator of Sirt1 (28). To verify the effect of resveratrol on Sirt1 regulation, the expression profile of Sirt1 was examined. Four time points following I/R (0, 1, 3 and 7 days) assessed, and the expression of the Sirt1 protein was found to be significantly lower only 7 days after I/R (Fig. 3A). Subsequently, to assess the effect of resveratrol on Sirt1 expression in the I/R model, rats were sacrificed 7 days after I/R injury with or without resveratrol treatment. Intraperitoneal injections of resveratrol partially restored the expression of the Sirt1 protein and mRNA expression (Fig. 3B and C). Immunofluorescence staining showed that Sirt1 was primarily expressed in GCL, INL and ONL of the normal retina, and was found to be reduced 7 days after I/R injury. Resveratrol treatment partially restored Sirt1 expression following I/R (Fig. 3D).

Figure 3

RES affects Sirt1 protein and gene expression following I/R injury. (A) Sirt1 protein expression gradually decreased over time, and this decrease was statistically significant at I/R 7 days. n=3 rats per group. **P<0.01 vs. 0 day group. (B and C) Intraperitoneal injection of RES restored Sirt1 protein and gene expression to some extent. n=3 rats per group. *P<0.05 vs. sham group; #P<0.05, ###P<0.001 vs. 7 days + vehicle group. (D) Confocal microscopy was used to observe the localization of Sirt1 in the retina. Magnification, x20. Sirt1 is primarily expressed in GCL, INL and ONL of normal retina. The expression of Sirt1 in the retina was significantly reduced 7 days after I/R injury. Resveratrol partly restores Sirt1 expression. Red arrow indicates the expression of Sirt1 in GCL. Scale bar, 100 µm. RES, resveratrol; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; I/R, ischemia/reperfusion; Sirt1, sirtuin1.

The effect of resveratrol on Opa1 expression was a primary focus of the present study. It was found that at the selected time points after I/R injury, Opa1 protein expression also exhibited a decreasing trend, which was statistically significant only 7 days after I/R (Fig. 4A). Therefore, to investigate the effect of resveratrol on Opa1 expression in the I/R model, the rats were sacrificed 7 days after I/R injury with or without resveratrol treatment. Intraperitoneal injection of resveratrol was shown to partially restore Opa1 protein and gene expression (Fig. 4B and C). The localization of Opa1 expression were then elucidated by immunofluorescence staining in the adult rat retinal tissues. It was observed that positive Opa1 expression (green fluorescence) was primarily present in the GCL, IPL, INL and outer plexiform layer. On day 7 after I/R injury, the expression of Opa1 was found to be reduced in all layers of the retina, which was significantly reversed by resveratrol treatment in various layers of the retina (Fig. 4D).

Figure 4

RES influences the expression and localization of OPA1 following I/R injury. (A) Protein expression levels of OPA1 gradually decreased, and this decrease was statistically significant at I/R 7 days. n=3 rats per group. *P<0.05 vs. 0 day group. (B and C) Intraperitoneal injection of RES restored OPA1 protein and gene expression to some extent. n=3 rats per group. ****P<0.0001 vs. sham group; #P<0.05, ####P<0.0001 vs. 7 days + vehicle group. Confocal microscopy was used to observe the localization of OPA1 in the retina. Magnification, x20. (D) OPA1 is primarily expressed in GCL, IPL, INL and OPL of the normal retina. Expression of OPA1 was not observed in any layer of the retina 7 days after I/R injury. Resveratrol restored OPA1 expression. Red arrow indicates the expression of OPA1 in GCL. Scale bar, 100 µm. RES, resveratrol. GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer. I/R, ischemia/reperfusion; OPA1, optic atrophy 1.

In addition, to investigate the effects of resveratrol on mtDNA in the I/R model, mitCN was measured at the selected time points (0, 1, 3 and 7 days). A significant reduction (~50%) was observed in the mitCN in the retina 7 days after I/R compared with that in the sham group (Fig. 5A). However, resveratrol treatment did not reverse this change (Fig. 5B).

Figure 5

Change in mitCN in the retina following I/R injury. (A) mitCN in the retina gradually decreased, and this decrease was statistically significant in I/R 7 days + vehicle. (B) Intraperitoneal injection of RES did not reverse the reduction in mitCN. n=4 rats per group. **P<0.01 vs. 0 day group. RES, resveratrol; mtDNA, mitochondrial DNA; mitCN, mtDNA copy number; I/R, ischemia/reperfusion.

Resveratrol regulates the ratio of L-Opa1/S-Opa1

In mammalian cells, strict regulation of the L-Opa1/S-Opa1 ratio is required for a physiologically functioning mitochondrial network. In the present study, it was found that resveratrol increased the L-Opa1/S-Opa1 ratio (Fig. 6A). To investigate the detailed underlying mechanism, RT-qPCR was performed to study the influence of resveratrol on Oma1 and Yme1, two post-transcriptases that have previously been reported to regulate Opa1 (29,30). The expression of Oma1 was found to be increased 7 days after I/R, which was reversed by resveratrol (Fig. 6B). The expression profile of Yme1 expression was opposite to that of Oma1, with significant reductions 7 days after I/R, and upregulation after resveratrol treatment (Fig. 6C).

Figure 6

RES affects the gene expression levels of Oma1 and Yme1 genes and in-turn affects the L-Opa1/S-Opa1 ratio. (A) Opa1-L/Opa1-S ratio at the protein level. ##P<0.01 vs. 7 days + vehicle group. (B and C) Oma1 and Yme1 mRNA expression levels in the retina of the sham group, 7 days I/R group, 7 days I/R + vehicle group and 7 days I/R + RES group. Graphs represent Oma1 and Yme1 gene expression levels. n=3 rats per group. **P<0.01 vs. sham group; #P<0.05, ##P<0.01 vs. 7 days + vehicle group. I/R, ischemia/reperfusion; OPA1, optic atrophy 1, Oma1, overlapping activities with m-AAA protease 1; Yme1, yeast mitochondrial DNA escape 1.

Effects of resveratrol on apoptosis, activity and the vitality of SOD in R28 cells

The effects of resveratrol on apoptosis was next explored using TUNEL staining 12, 24 and 48 h after serum deprivation. Compared with those in the control and solvent control group, a higher number of TUNEL-positive cells were observed in the serum deprivation group (12, 24 and 48 h), suggesting that serum deprivation can cause R28 cell apoptosis. Consistent with observations in vivo, resveratrol treatment also reversed this change (Fig. 7). The viability of R28 cells was then determined using a CCK-8 assay (Fig. 8A-C). Compared with that in the control group, the viability of R28 cells was found to be significantly reduced in the solvent control group (DMSO for 12, 24 and 48 h). Cell viability in cells 12 h after serum deprivation was similar to that in the solvent control group. However, cells exhibited lower cell viability compared with that in the solvent control group 24 and 48 h after serum deprivation, suggesting that the effect of serum deprivation on cell viability is time-dependent. Resveratrol treatment was demonstrated to partially reverse this reduction in cell viability. To investigate the relationship between SOD activity and apoptosis, the activity of SOD in R28 cells was also examined. After 24 h of serum deprivation, the activity of SOD was found to be significantly reduced, and this was attenuated by resveratrol treatment (Fig. 8D).

Figure 7

Resveratrol affects apoptosis of R28 cells. R28 cells treated with or without RES, were stained with TUNEL, 12, 24 and 48 h after serum deprivation and visualized using confocal microscopy. No TUNEL-positive cells were observed in the control group or the control + RES group. The presence of TUNEL-positive cells gradually increased in the serum deprived cells over time. The increase in apoptotic cells in the serum deprived cells was attenuated by RES treatment. Blue, DAPI; green, TUNEL-positive cell. Scale bar, 50 µm. Magnification, x20. RES, resveratrol.

Figure 8

Resveratrol affects the activity of SOD in R28 cells. The viability of R28 cells was detected using a Cell Counting Kit-8 assay. (A) Compared with the control group, the viability of R28 cells was significantly reduced in the solvent control group (treated with DMSO for 12 h), a similar reduction was also observed in the cells that had been serum deprived cells for 12 h. Compared with the cells that had been serum deprived cells for 12 h, there was no significant increase in R28 cell viability when treated with RES and serum deprived for 12 h. **P<0.01, ***P<0.001 vs. control group. (B) Cell viability of R28 cells was reduced in the solvent control group (treated with DMSO for 24 h), a more significant reduction was observed in the cells that had been serum deprived cells for 24 h. Compared to the cells that had been serum deprived for 24 h, RES treatment partially restored the viability of R28 cells. ***P<0.001, ****P<0.0001 vs. control group; #P<0.05 vs. 24 h of serum deprivation. (C) Serum deprivation for 48 h resulted in similar results to that of 24 h serum deprivation. ***P<0.001, ****P<0.0001 vs. control group. ##P<0.01 vs. 48 h. (D) SOD activity in R28 cells was detected using a SOD kit. SOD activity was significantly reduced after 24 h of serum deprivation, and the decrease in activity was attenuated by RES treatment. **P<0.01, vs. control group; #P<0.05 vs. 24 h of serum deprivation. RES, resveratrol; SOD, superoxide dismutase.

Effects of resveratrol on Opa1 expression and localization in R28 cells

Compared with the control cells, Opa1 expression was shown to be significantly reduced 24 and 48 h after serum deprivation (Fig. 9A), which was partially attenuated by resveratrol treatment (Fig. 9B). Immunostaining of R28 cells was subsequently performed to determine the localization of Opa1. Opa1 was found to be expressed in the cytoplasm, but neither serum deprivation nor resveratrol treatment resulted in a significant alteration in Opa1 localization (Fig. 9C).

Figure 9

Effect of serum deprivation and RES on the localization and expression of OPA1 in R28 cells. Confocal microscopy was used to observe the localization and expression of OPA1 in R28 cells. Magnification, x20. (A) OPA1 expression was significantly reduced after 48 h of serum deprivation. **P<0.01 vs. 0 h. (B) Simultaneous RES treatment increased OPA1 expression compared with serum deprivation alone. ***P<0.001 vs. control group. #P<0.05 vs. 48 h of serum deprivation. (C) Expression and localization of OPA1 in R28 cells under normal conditions, serum deprivation for 48 h with and without RES. n=6 per group. Scale bar, 50 µm. RES, resveratrol; OPA1, optic atrophy 1.

Discussion

Irreversible damage to neurons in the retina results in deterioration of vision and serves a central role in a number of optical diseases, including glaucoma, age-associated macular degeneration and diabetic retinopathy (31). However, minimal success has been achieved to halt or reverse the onset and development of these types of vision loss by clinical interventions (32). Therefore, to explore potential therapeutic targets for such diseases in the eye, particular research attention should be paid to the underlying molecular mechanism of retinal neuronal injury induction. In the present study, the potential effects of resveratrol on RGC following I/R injury and in vitro serum deprivation models were investigated, with a particular focus on the effects of resveratrol on the expression of Opa1 in vitro and in vivo. Resveratrol treatment was found to inhibit retinal damage, RGC loss and apoptosis following I/R injury and in in vitroserum deprivation models. In addition, resveratrol also altered the expression profiles of Oma1 and Yme1 at the mRNA level, two primary proteins responsible for the post-transcriptional cleavage of Opa1, thereby increasing the L-Opa1/S-Opa1 ratio. The present study also showed that resveratrol partially reversed the reduction in Opa1 expression and the SOD activity caused by I/R. Thus, the results suggest that resveratrol treatment can protect RGCs by increasing Opa1 expression and regulating the expression of the post-transcriptional proteases of Opa1 in the ischemic retina.

The present study contributes information on the influence of resveratrol treatment on the ischemic retina. Resveratrol has attracted significant attention due to its previously reported neuroprotective, antitumorigenic and antioxidant properties (33). Zhang et al (34) previously reported that resveratrol can alleviate retinal damage and RGC-5 cell apoptosis by activating the 5'-AMP-activated protein kinase/peroxisome proliferator-activated receptor γ-coactivator 1 signaling pathway in addition to restoring RGC malfunction. Lindsey et al (35) also suggested that long term dietary resveratrol supplements can alter the expressional patterns of endoplasmic reticulum chaperones to protect against RGC dendrite loss. In the present study, a retinal I/R animal model was used, where increased IOP resulted in retinal circulatory disturbances and increased levels of reactive oxygen species and free radicals that attack cell structures and proteins during reperfusion, resulting in significant tissue damage (36,37). Results from the present study suggested that resveratrol treatment significantly reduced retinal damage, RGC loss and apoptosis in I/R injury models, consistent with previous studies. Additionally, the same conclusions were drawn from the in vivo experiments. R28 cells have been previously used for in vitro and in vivo retinal cell behavior experiments (38). Serum deprivation was induced to measure the degree of apoptosis and explore potential protective interventions (39). Serum deprivation-induced damage has been reported to result from the lack of nutrients in the cell culture (39-42). In the present study, it was found that serum deprivation resulted in reduced R28 cell viability along with reduced apoptosis. Resveratrol treatment significantly improved the viability of R28 cells and partially prevented apoptosis. In particular, two notable observations were made based on the TUNEL staining in the retina. Although the levels of cell apoptosis in the GCL and INL layers were reduced, apoptotic cells could be observed in the ONL in I/R+RES group. Such multifaceted effects of resveratrol in the different retinal layers may be associated with the cellular distribution of the adenosine receptor subtypes. Adenosine A2 receptors are expressed predominantly in the GCL and INL (43), whilst adenosine A3 receptors are primarily found in the ONL (44). Activated A2 receptors can mediate the protective effects on ischemic neurons, whereas A3 receptors have been previously documented to serve a noxious role in triggering neuron apoptosis. Therefore, it is hypothesized that resveratrol is a non-selective adenosine receptor agonist that can induce apoptosis in the ONL whilst inhibiting this process in the INL and GCL, although the detailed mechanism requires further study (45-47). In addition, it is worth noting that TUNEL staining in the retina was negative 7 days after I/R. The possible cause of this may be that TUNEL stained the 3' end of the cleaved DNA during apoptosis (48). Apoptosis is a gradual and phased process, such that following progression to a certain stage, apoptotic bodies are gradually engulfed by neighboring cells or phagocytic cells in vivo(49).

Mitochondrial dysfunction is considered to be the pivotal pathological change in the process of RGC loss during glaucoma development, which has consistently been the primary focus of research on its etiology (50). A number of proteins have been reported to participate in maintaining mitochondrial function. Opa1 is well known for its role in the regulation of mitochondrial dynamics, where it inhibits mitochondrial cristae remodeling and cytochrome c release (13,51). Cytochrome c released into the cytosol can recruit pro-apoptotic signals and trigger downstream apoptotic events by binding between the two tryptophan (W) and aspartate (D)-rich WD domains of the apoptotic protease activating factor (Apaf-1), thereby irreversibly activating the apoptotic cascade (52). Cristae morphogenesis, which is induced by the reduction of Opa1 expression, may increase the probability of cytochrome c release (53,54). In previous studies, Opa1 has been reported to serve a neuroprotective role in the retina by modulating mitochondrial function (55). Additionally, Opa1 has also been found to be significantly downregulated in the retina of Wistar rats following I/R injury (13). Opa1 mutations have been proposed to result in RGC dendropathy, increasing the susceptibility of RGCs to apoptosis and vulnerability to oxidative stress (56). A substantial number of studies focusing on the molecular mechanism by which Opa1 protects against RGC loss have been performed. Hu et al (57) hypothesized that during experimental glaucoma, Opa1 exerted a protective effect on RGCs by promoting mitochondrial fusion and enhancing Parkin-mediated mitophagy (57). This previous study also suggested that the Opa-1-mediated downregulation of Bax, a pro-apoptotic member of the Bcl-2 family, coupled with the activation of Bcl-2, can alleviate ischemia-induced RGC loss (57). In the present study, at the selected I/R time points, the expression of the Opa1 protein also exhibited a decreasing trend in the retina of SD rats. Consistent with these findings, serum deprivation also resulted in the reduction of Opa1 expression in R28 cells. These observations support the notion that Opa1 may protect against RGC apoptosis. Resveratrol has been previously reported to induce mitochondrial biogenesis and improve mitochondrial function (58,59). In addition, it has also been shown to significantly reverse rotenone-induced reductions in Opa1 protein and mRNA expression in PC12 cells (60). Similar results were obtained following resveratrol treatment in the I/R retinal injury and serum deprivation models used in the present study. These observations suggest that resveratrol may confer therapeutic potential for the treatment of RGC apoptosis by increasing Opa1 expression.

Results from the present study also provided evidence that resveratrol can upregulate the L-Opa1/S-Opa1 ratio by modulating the proteolytic processing of Opa1. In mammals, L-Opa1 is anchored onto the inner membrane, whereas S-Opa1 is soluble (61). S-Opa1 is generated by the cleavage of L-Opa1 in the transmembrane domain (61). Mitochondrial fusion is determined by the tightly regulated L-Opa1/S-Opa1 ratio, where L-Opa1 facilitated mitochondrial inner membrane fusion and S-Opa1 promoted mitochondrial fission. Excessive mitochondrial fission can induce mitochondrion fragmentation, resulting in mitochondrial dysfunction and cell death (62-66). Under physiological conditions, Oma1 is degraded by sufficient ATP and Yme-1 serves a pivotal role in promoting mitochondrial fusion whilst inhibiting apoptosis by generating L-Opa1. By contrast, during conditions of high oxidative stress, Oma1 can promote mitochondrial fragmentation by rapidly converting L-Opa1 into S-Opa1, which triggers the ubiquitination of proteins in the outer membrane to be removed by mitophagy (67-69). In the retina, 7 days after I/R injury, the mRNA expression levels of Yme1 were found to be significantly reduced, whilst that of Oma1 was found to be increased, and this was reversed by resveratrol treatment. This observation suggested that resveratrol administration may increase the L-Opa1/S-Opa1 ratio by regulating the post-transcriptional cleavage of Opa1 in the ischemic retina. To the best of our knowledge, this was the first time that resveratrol was demonstrated to influence the L-Opa1/S-Opa1 ratio in ischemic retina. However, whether these changes in Opa1 post-transcriptional cleavage are direct effects of resveratrol administration warrant further investigation.

To assess whether resveratrol can effectively improve mitochondrial quality, the mitCN in the retina was measured using RT-qPCR. Accumulating evidence provided by previous genotyping studies demonstrated that depletion of mtDNA, which is one of the biomarkers of mitochondrial quality, can be detected in patients with glaucoma (70,71). In addition, it has been previously reported that Opa1 is pivotal in maintaining mitCNs and mitochondrial morphology (72). Supporting this, an increased number of mtDNA-deficient cells with mitochondrial fragmentation is observed in organisms encoding the mutated version of the Opa1 gene (73). The present study reported a ~50% decrease in the mitCN within the retina 7 days after I/R, consistent with the results from previous studies. However, no notable changes were detected after resveratrol treatment, contrary to that of Chen et al(74), who demonstrated that resveratrol could maintain mitCNs in a serum deprivation model of RGCs. A possible explanation for this striking difference in mitCNs following resveratrol treatment in vivo and in vitro may be that, compared with the cell culture model, the animal model is considerably more complex as a number of uncontrollable factors which can influence cell behavior and gene expression, such as endogenous growth factors, should be taken into consideration. When investigating the protective mechanisms of resveratrol on the ischemic retina, monolayer culture models alone cannot be considered as a reliable tool compared with animal studies (75-77). Therefore, it is crucial that further research into this specific mechanism is performed in vivo.

In vitro data in the present study demonstrated that resve-ratrol supplementation can effectively reduce ROS production. Excessive production of reactive oxygen species can also be regarded as the main cause of turbulence in bioenergetic homeostasis and mitochondrial dysfunction. Oxidative stress can lead to the suppression of pro-survival signaling and pro-apoptotic signaling activation, in turn activating apoptosis downstream of caspase activation (78). SOD is one of the ROS scavengers that rapidly converts superoxide radicals into H2O2 to efficiently prevent deteriorations in mitochondrial function and apoptosis (79). It has been previously reported that resveratrol can induce superoxide dismutase in the liver to inhibit ethanol-induced oxidative stress (80). To initially investigate the relationship among SOD activity, apoptosis and the regulatory role of resveratrol in RGCs, SOD activity of R28 cells was first assessed. After 24 h of serum deprivation, the activity of SOD was found to be reduced, and this was attenuated by resveratrol treatment.

These present findings may confer important implications for the development of potential therapeutic strategies against glaucomatous RGC loss. However, the present study has several limitations. The underlying molecular pathway between resveratrol treatment and Opa1 post-transcriptional cleavage requires further elucidation. Additionally, in the present study, resveratrol was injected intraperitoneally into the rats. Since intraperitoneal injection of resveratrol is not a suitable method for delivery into humans, an optimized method of resveratrol administration should also be developed for its prospective clinical application (81).

In summary, the present study found that treatment with resveratrol exhibited protective effects on I/R-induced retinal injury and serum deprivation-induced R28 cell apoptosis. In addition, resveratrol has also been found to exert protective effects on RGCs. Mechanistically, resvera-trol was shown to regulate the expression of Opa1 and the activity of SOD. However, it remains necessary to further investigate the relationship between apoptosis, Opa1 and SOD activity to provide clearer evidence of the protective effects of resveratrol on RGCs, in particular in association with glaucoma.

Funding

This study was supported by the National Natural Science Foundation of China (grant nos. 81271425, 81860170 and 81260148) and the Natural Science Foundation of Jiangxi (grant no. 20181ACG70010).

Availability of data and materials

The data sets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

YP, MQ, PH and XZ conceived the study. YP, MQ, PH, KJ, RX, NS and XP performed the experiments. YP, MQ, PH and XZ analyzed the data. YP, MQ and XZ drafted the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

All experiments were performed in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and were approved and monitored by the Institutional Animal Care and Use Committee of Nanchang University (approval no. 2016NC-020-02).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Acknowledgments

We are grateful to Dr Lingfeng Li, Dr Hongdou Luo and Dr Weiwei Sheng (Affiliated Eye Hospital of Nanchang University, Jiangxi Research Institute of Ophthalmology and Visual Science) for their guidance.

References

1 

Bonomi L: Epidemiology of angle-closure glaucoma. Acta Ophthalmol Scand Suppl. 236:11–13. 2002. View Article : Google Scholar : PubMed/NCBI

2 

Garcia-Valenzuela E, Shareef S, Walsh J and Sharma SC: Programmed cell death of retinal ganglion cells during experimental glaucoma. Exp Eye Res. 61:33–44. 1995. View Article : Google Scholar : PubMed/NCBI

3 

Quigley HA, Nickells RW, Kerrigan LA, Pease ME, Thibault DJ and Zack DJ: Retinal ganglion cell death in experimental glaucoma and after axotomy occurs by apoptosis. Invest Ophthalmol Vis Sci. 36:774–786. 1995.PubMed/NCBI

4 

Almasieh M, Wilson AM, Morquette B, Cueva Vargas JL and Di Polo A: The molecular basis of retinal ganglion cell death in glaucoma. Prog Retin Eye Res. 31:152–181. 2012. View Article : Google Scholar

5 

Williams PA, Harder JM, Foxworth NE, Cochran KE, Philip VM, Porciatti V, Smithies O and John SW: Vitamin B3 modulates mitochondrial vulnerability and prevents glaucoma in aged mice. Science. 355:756–760. 2017. View Article : Google Scholar : PubMed/NCBI

6 

Huang C, Zhang P, Wang W, Xu Y, Wang M, Chen X and Dong X: Long-term blue light exposure induces RGC-5 cell death in vitro: Involvement of mitochondria-dependent apoptosis, oxidative stress, and MAPK signaling pathways. Apoptosis. 19:922–932. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Das A, Bell CM, Berlinicke CA, Marsh-Armstrong N and Zack DJ: Programmed switch in the mitochondrial degradation pathways during human retinal ganglion cell differentiation from stem cells is critical for RGC survival. Redox Biol. 34:1014652020. View Article : Google Scholar : PubMed/NCBI

8 

Giacomello M, Pyakurel A, Glytsou C and Scorrano L: The cell biology of mitochondrial membrane dynamics. Nat Rev Mol Cell Biol. 21:204–224. 2020. View Article : Google Scholar : PubMed/NCBI

9 

Lee S, Van Bergen NJ, Kong GY, Chrysostomou V, Waugh HS, O'Neill EC, Crowston JG and Trounce IA: Mitochondrial dysfunction in glaucoma and emerging bioenergetic therapies. Exp Eye Res. 93:204–212. 2011. View Article : Google Scholar

10 

Schober MS, Chidlow G, Wood JP and Casson RJ: Bioenergetic-based neuroprotection and glaucoma. Clin Exp Ophthalmol. 36:377–385. 2008. View Article : Google Scholar : PubMed/NCBI

11 

Dhingra A, Jayas R, Afshar P, Guberman M, Maddaford G, Gerstein J, Lieberman B, Nepon H, Margulets V, Dhingra R and Kirshenbaum LA: Ellagic acid antagonizes Bnip3-mediated mitochondrial injury and necrotic cell death of cardiac myocytes. Free Radic Biol Med. 112:411–422. 2017. View Article : Google Scholar : PubMed/NCBI

12 

Geng J, Wei M, Yuan X, Liu Z, Wang X, Zhang D, Luo L, Wu J, Guo W and Qin ZH: TIGAR regulates mitochondrial functions through SIRT1-PGC1 α pathway and translocation of TIGAR into mitochondria in skeletal muscle. FASEB J. 33:6082–6098. 2019. View Article : Google Scholar : PubMed/NCBI

13 

Sun Y, Xue W, Song Z, Huang K and Zheng L: Restoration of Opa1-long isoform inhibits retinal injury-induced neurodegeneration. J Mol Med (Berl). 94:335–346. 2016. View Article : Google Scholar

14 

Youle RJ and van der Bliek AM: Mitochondrial fission, fusion, and stress. Science. 337:1062–1065. 2012. View Article : Google Scholar : PubMed/NCBI

15 

Frezza C, Cipolat S, Martins de Brito O, Micaroni M, Beznoussenko GV, Rudka T, Bartoli D, Polishuck RS, Danial NN, De Strooper B and Scorrano L: OPA1 controls apoptotic cristae remodeling independently from mitochondrial fusion. Cell. 126:177–189. 2006. View Article : Google Scholar : PubMed/NCBI

16 

Baur JA and Sinclair DA: Therapeutic potential of resveratrol: The in vivo evidence. Nat Rev Drug Discov. 5:493–506. 2006. View Article : Google Scholar : PubMed/NCBI

17 

Chong ZZ, Shang YC, Wang S and Maiese K: SIRT1: new avenues of discovery for disorders of oxidative stress. Expert Opin Ther Targets. 16:167–178. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Ahmed T, Javed S, Javed S, Tariq A, Šamec D, Tejada S, Nabavi SF, Braidy N and Nabavi SM: Resveratrol and Alzheimer's disease: Mechanistic insights. Mol Neurobiol. 54:2622–2635. 2017. View Article : Google Scholar

19 

Pandey AK, Bhattacharya P, Shukla SC, Paul S and Patnaik R: Resveratrol inhibits matrix metalloproteinases to attenuate neuronal damage in cerebral ischemia: A molecular docking study exploring possible neuroprotection. Neural Regen Res. 10:568–575. 2015. View Article : Google Scholar : PubMed/NCBI

20 

Richard T, Pawlus AD, Iglésias ML, Pedrot E, Waffo-Teguo P, Mérillon JM and Monti JP: Neuroprotective properties of resveratrol and derivatives. Ann N Y Acad Sci. 1215:103–108. 2011. View Article : Google Scholar : PubMed/NCBI

21 

Abu-Amero KK, Kondkar AA and Chalam KV: Resveratrol and ophthalmic diseases. Nutrients. 8:2002016. View Article : Google Scholar : PubMed/NCBI

22 

Zuo L, Khan RS, Lee V, Dine K, Wu W and Shindler KS: SIRT1 promotes RGC survival and delays loss of function following optic nerve crush. Invest Ophthalmol Vis Sci. 54:5097–5102. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Krishnamoorthy RR, Agarwal P, Prasanna G, Vopat K, Lambert W, Sheedlo HJ, Pang IH, Shade D, Wordinger RJ, Yorio T, et al: Characterization of a transformed rat retinal ganglion cell line. Brain Res Mol Brain Res. 86:1–12. 2001. View Article : Google Scholar : PubMed/NCBI

24 

Liu B, Chen H, Johns TG and Neufeld AH: Epidermal growth factor receptor activation: An upstream signal for transition of quiescent astrocytes into reactive astrocytes after neural injury. J Neurosci. 26:7532–7540. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Bennet D and Kim S: Effects of agmatine and resveratrol on RGC-5 cell behavior under light stimulation. Environ Toxicol Pharmacol. 38:84–97. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

27 

Chintala SK, Zhang X, Austin JS and Fini ME: Deficiency in matrix metalloproteinase gelatinase B (MMP-9) protects against retinal ganglion cell death after optic nerve ligation. J Biol Chem. 277:47461–47468. 2002. View Article : Google Scholar : PubMed/NCBI

28 

Lagouge M, Argmann C, Gerhart-Hines Z, Meziane H, Lerin C, Daussin F, Messadeq N, Milne J, Lambert P, Elliott P, et al: Resveratrol improves mitochondrial function and protects against metabolic disease by activating SIRT1 and PGC-1alpha. Cell. 127:1109–1122. 2006. View Article : Google Scholar : PubMed/NCBI

29 

Anderson CJ, Kahl A, Fruitman H, Qian L, Zhou P, Manfredi G and Iadecola C: Prohibitin levels regulate OMA1 activity and turnover in neurons. Cell Death Differ. 27:1896–1906. 2020. View Article : Google Scholar

30 

Griparic L, Kanazawa T and van der Bliek AM: Regulation of the mitochondrial dynamin-like protein Opa1 by proteolytic cleavage. J Cell Biol. 178:757–764. 2007. View Article : Google Scholar : PubMed/NCBI

31 

Osborne NN, Casson RJ, Wood JP, Chidlow G, Graham M and Melena J: Retinal ischemia: Mechanisms of damage and potential therapeutic strategies. Prog Retin Eye Res. 23:91–147. 2004. View Article : Google Scholar : PubMed/NCBI

32 

Gao H, Zhang HL, Shou J, Chen L, Shen Y, Tang Q, Huang J and Zhu J: Towards retinal ganglion cell regeneration. Regen Med. 7:865–875. 2012. View Article : Google Scholar : PubMed/NCBI

33 

Semba RD, Ferrucci L, Bartali B, Urpí-Sarda M, Zamora-Ros R, Sun K, Cherubini A, Bandinelli S and Andres-Lacueva C: Resveratrol levels and all-cause mortality in older community-dwelling adults. JAMA Intern Med. 174:1077–1084. 2014. View Article : Google Scholar : PubMed/NCBI

34 

Zhang X, Feng Y, Wang Y, Wang J, Xiang D, Niu W and Yuan F: Resveratrol ameliorates disorders of mitochondrial biogenesis and dynamics in a rat chronic ocular hypertension model. Life Sci. 207:234–245. 2018. View Article : Google Scholar : PubMed/NCBI

35 

Lindsey JD, Duong-Polk KX, Hammond D, Leung CK and Weinreb RN: Protection of injured retinal ganglion cell dendrites and unfolded protein response resolution after long-term dietary resveratrol. Neurobiol Aging. 36:1969–1981. 2015. View Article : Google Scholar : PubMed/NCBI

36 

Szabo ME, Droy-Lefaix MT, Doly M and Braquet P: Free radical-mediated effects in reperfusion injury: A histologic study with superoxide dismutase and EGB 761 in rat retina. Ophthalmic Res. 23:225–234. 1991. View Article : Google Scholar : PubMed/NCBI

37 

Belforte N, Sande PH, de Zavalia N, Fernandez DC, Silberman DM, Chianelli MS and Rosenstein RE: Ischemic tolerance protects the rat retina from glaucomatous damage. PLoS One. 6:e237632011. View Article : Google Scholar : PubMed/NCBI

38 

Seigel GM: Review: R28 retinal precursor cells: The first 20 years. Mol Vis. 20:301–306. 2014.PubMed/NCBI

39 

Charles I, Khalyfa A, Kumar DM, Krishnamoorthy RR, Roque RS, Cooper N and Agarwal N: Serum deprivation induces apoptotic cell death of transformed rat retinal ganglion cells via mitochondrial signaling pathways. Invest Ophthalmol Vis Sci. 46:1330–1338. 2005. View Article : Google Scholar : PubMed/NCBI

40 

Lee SB, Kim JJ, Kim TW, Kim BS, Lee MS and Yoo YD: Serum deprivation-induced reactive oxygen species production is mediated by Romo1. Apoptosis. 15:204–218. 2010. View Article : Google Scholar

41 

Liu Q, Ju WK, Crowston JG, Xie F, Perry G, Smith MA, Lindsey JD and Weinreb RN: Oxidative stress is an early event in hydrostatic pressure induced retinal ganglion cell damage. Invest Ophthalmol Vis Sci. 48:4580–4589. 2007. View Article : Google Scholar : PubMed/NCBI

42 

Kang KD, Andrade da Costa BL and Osborne NN: Stimulation of prostaglandin EP2 receptors on RGC-5 cells in culture blunts the negative effect of serum withdrawal. Neurochem Res. 35:820–829. 2010. View Article : Google Scholar : PubMed/NCBI

43 

Kvanta A, Seregard S, Sejersen S, Kull B and Fredholm BB: Localization of adenosine receptor messenger. RNAs in the rat eye Exp Eye Res. 65:595–602. 1997. View Article : Google Scholar

44 

Grillo SL, McDevitt DS, Voas MG, Khan AS, Grillo MA and Stella SJ Jr: Adenosine receptor expression in the adult zebrafish retina. Purinergic Signal. 15:327–342. 2019. View Article : Google Scholar : PubMed/NCBI

45 

Castillo A, Tolón MR, Fernández-Ruiz J, Romero J and Martinez-Orgado J: The neuroprotective effect of cannabidiol in an in vitro model of newborn hypoxic-ischemic brain damage in mice is mediated by CB(2) and adenosine receptors. Neurobiol Dis. 37:434–440. 2010. View Article : Google Scholar

46 

Dai SS, Zhou YG, Li W, An JH, Li P, Yang N, Chen XY, Xiong RP, Liu P, Zhao Y, et al: Local glutamate level dictates adenosine A2A receptor regulation of neuroinflammation and traumatic brain injury. J Neurosci. 30:5802–5810. 2010. View Article : Google Scholar : PubMed/NCBI

47 

Von Lubitz DK, Lin RC, Popik P, Carter MF and Jacobson KA: Adenosine A3 receptor stimulation and cerebral ischemia. Eur J Pharmacol. 263:59–67. 1994. View Article : Google Scholar : PubMed/NCBI

48 

Kressel M and Groscurth P: Distinction of apoptotic and necrotic cell death by in situ labelling of fragmented DNA. Cell Tissue Res. 278:549–556. 1994. View Article : Google Scholar : PubMed/NCBI

49 

Elmore S: Apoptosis: A review of programmed cell death. Toxicol Pathol. 35:495–516. 2007. View Article : Google Scholar : PubMed/NCBI

50 

Hass DT and Barnstable CJ: Mitochondrial uncoupling protein 2 knock-out promotes mitophagy to decrease retinal ganglion cell death in a mouse model of glaucoma. J Neurosci. 39:3582–3596. 2019.PubMed/NCBI

51 

Olichon A, Guillou E, Delettre C, Landes T, Arnauné-Pelloquin L, Emorine LJ, Mils V, Daloyau M, Hamel C, Amati-Bonneau P, et al: Mitochondrial dynamics and disease OPA1. Biochim Biophys Acta. 1763:500–509. 2006. View Article : Google Scholar : PubMed/NCBI

52 

Shalaeva DN, Dibrova DV, Galperin MY and Mulkidjanian AY: Modeling of interaction between cytochrome c and the WD domains of Apaf-1: Bifurcated salt bridges underlying apopto-some assembly. Biol Direct. 10:292015. View Article : Google Scholar

53 

Olichon A, Baricault L, Gas N, Guillou E, Valette A, Belenguer P and Lenaers G: Loss of OPA1 perturbates the mitochondrial inner membrane structure and integrity, leading to cytochrome c release and apoptosis. J Biol Chem. 278:7743–7746. 2003. View Article : Google Scholar : PubMed/NCBI

54 

Varanita T, Soriano ME, Romanello V, Zaglia T, Quintana-Cabrera R, Semenzato M, Menabò R, Costa V, Civiletto G, Pesce P, et al: The OPA1-dependent mitochondrial cristae remodeling pathway controls atrophic, apoptotic, and ischemic tissue damage. Cell Metab. 21:834–844. 2015. View Article : Google Scholar : PubMed/NCBI

55 

Zhang L, He Z, Zhang Q, Wu Y, Yang X, Niu W, Hu Y and Jia J: Exercise pretreatment promotes mitochondrial dynamic protein OPA1 expression after cerebral ischemia in rats. Int J Mol Sci. 15:4453–4463. 2014. View Article : Google Scholar : PubMed/NCBI

56 

Williams PA, Morgan JE and Votruba M: Opa1 deficiency in a mouse model of dominant optic atrophy leads to retinal ganglion cell. dendropathy Brain. 133:2942–2951. 2010. View Article : Google Scholar

57 

Hu X, Dai Y, Zhang R, Shang K and Sun X: Overexpression of optic atrophy type 1 protects retinal ganglion cells and upregu-lates Parkin expression in experimental glaucoma. Front Mol Neurosci. 11:3502018. View Article : Google Scholar

58 

Jardim FR, de Rossi FT, Nascimento MX, da Silva Barros RG, Borges PA, Prescilio IC and de Oliveira MR: Resveratrol and brain mitochondria:. A review Mol Neurobiol. 55:2085–2101. 2018. View Article : Google Scholar

59 

de Oliveira MR, Nabavi SF, Manayi A, Daglia M, Hajheydari Z and Nabavi SM: Resveratrol and the mitochondria: From triggering the intrinsic apoptotic pathway to inducing mitochondrial biogenesis, a mechanistic view. Biochim Biophys Acta. 1860:727–745. 2016. View Article : Google Scholar : PubMed/NCBI

60 

Peng K, Tao Y, Zhang J, Wang J, Ye F, Dan G, Zhao Y, Cai Y, Zhao J, Wu Q, et al: Resveratrol regulates mitochondrial biogenesis and fission/fusion to attenuate rotenone-induced neurotoxicity. Oxid Med Cell Longev. 2016:67056212016. View Article : Google Scholar : PubMed/NCBI

61 

Lee H, Smith SB, Sheu SS and Yoon Y: The short variant of optic atrophy 1 (OPA1) improves cell survival under oxidative stress. J Biol Chem. 295:6543–6560. 2020. View Article : Google Scholar : PubMed/NCBI

62 

MacVicar T and Langer T: OPA1 processing in cell death and disease-the long and short of it. J Cell Sci. 129:2297–2306. 2016. View Article : Google Scholar : PubMed/NCBI

63 

Lang A, Anand R, Altinoluk-Hambüchen S, Ezzahoini H, Stefanski A, Iram A, Bergmann L, Urbach J, Böhler P, Hänsel J, et al: SIRT4 interacts with OPA1 and regulates mitochondrial quality control and mitophagy. Aging (Albany NY). 9:2163–2189. 2017. View Article : Google Scholar

64 

Alavi MV: Targeted OMA1 therapies for cancer. Int J Cancer. 145:2330–2341. 2019. View Article : Google Scholar : PubMed/NCBI

65 

Ishihara N, Fujita Y, Oka T and Mihara K: Regulation of mitochondrial morphology through proteolytic cleavage of OPA1. EMBO J. 25:2966–2977. 2006. View Article : Google Scholar : PubMed/NCBI

66 

Song Z, Chen H, Fiket M, Alexander C and Chan DC: OPA1 processing controls mitochondrial fusion and is regulated by mRNA splicing, membrane potential, and Yme1L. J Cell Biol. 178:749–755. 2007. View Article : Google Scholar : PubMed/NCBI

67 

Rainbolt TK, Lebeau J, Puchades C and Wiseman RL: Reciprocal degradation of YME1L and OMA1 adapts mitochondrial proteo-lytic activity during stress. Cell Rep. 14:2041–2049. 2016. View Article : Google Scholar : PubMed/NCBI

68 

Stiburek L, Cesnekova J, Kostkova O, Fornuskova D, Vinsova K, Wenchich L, Houstek J and Zeman J: YME1L controls the accumulation of respiratory chain subunits and is required for apoptotic resistance, cristae morphogenesis, and cell proliferation. Mol Biol Cell. 23:1010–1023. 2012. View Article : Google Scholar : PubMed/NCBI

69 

Rainbolt TK, Saunders JM and Wiseman RL: YME1L degradation reduces mitochondrial proteolytic capacity during oxidative stress. EMBO Rep. 16:97–106. 2015. View Article : Google Scholar :

70 

Singh LN, Crowston JG, Lopez Sanchez MIG, Van Bergen NJ, Kearns LS, Hewitt AW, Yazar S, Mackey DA, Wallace DC and Trounce IA: Mitochondrial DNA variation and disease susceptibility in primary open-angle glaucoma. Invest Ophthalmol Vis Sci. 59:4598–4602. 2018. View Article : Google Scholar : PubMed/NCBI

71 

Kumar M, Tanwar M, Faiq MA, Pani J, Shamsi MB, Dada T and Dada R: Mitochondrial DNA nucleotide changes in primary congenital glaucoma patients. Mol Vis. 19:220–230. 2013.PubMed/NCBI

72 

Garcia I, Innis-Whitehouse W, Lopez A, Keniry M and Gilkerson R: Oxidative insults disrupt OPA1-mediated mitochondrial dynamics in cultured mammalian cells. Redox Rep. 23:160–167. 2018. View Article : Google Scholar : PubMed/NCBI

73 

Kondadi AK, Anand R and Reichert AS: Functional interplay between cristae biogenesis, mitochondrial dynamics and mitochondrial DNA integrity. Int J Mol Sci. 20:43112019. View Article : Google Scholar :

74 

Chen S, Fan Q, Li A, Liao D, Ge J, Laties AM and Zhang X: Dynamic mobilization of PGC-1α mediates mitochondrial biogenesis for the protection of RGC-5 cells by resveratrol during serum deprivation. Apoptosis. 18:786–799. 2013. View Article : Google Scholar : PubMed/NCBI

75 

Kim MJ, Chi BH, Yoo JJ, Ju YM, Whang YM and Chang IH: Structure establishment of three-dimensional (3D) cell culture printing model for bladder cancer. PLoS One. 14:e2236892019.

76 

Liang T, Tao Q, Guan R, Cao G, Shen H, Liu Z and Xia Q: Antioxidant and antiproliferative activities of cyanidin-3-O-glu-coside (C3G) liposome in Caco-2 cells cultivated in 2D and 3D cell culture models. J Food Sci. 84:1638–1645. 2019. View Article : Google Scholar : PubMed/NCBI

77 

Burd A, Kwok CH, Hung SC, Chan HS, Gu H, Lam WK and Huang L: A comparative study of the cytotoxicity of silver-based dressings in monolayer cell, tissue explant, and animal models. Wound Repair Regen. 15:94–104. 2007. View Article : Google Scholar : PubMed/NCBI

78 

Li D, Ni S, Miao KS and Zhuang C: PI3K/Akt and caspase pathways mediate oxidative stress-induced chondrocyte apoptosis. Cell Stress Chaperones. 24:195–202. 2019. View Article : Google Scholar :

79 

Fukai T and Ushio-Fukai M: Superoxide dismutases: Role in redox signaling, vascular function, and diseases. Antioxid Redox Signal. 15:1583–1606. 2011. View Article : Google Scholar : PubMed/NCBI

80 

Chen WM, Shaw LH, Chang PJ, Tung SY, Chang TS, Shen CH, Hsieh YY and Wei KL: Hepatoprotective effect of resveratrol against ethanol-induced oxidative stress through induction of superoxide dismutase in vivo and in vitro. Exp Ther Med. 11:1231–1238. 2016. View Article : Google Scholar : PubMed/NCBI

81 

Tomé-Carneiro J, Larrosa M, González-Sarrías A, Tomás-Barberán FA, García-Conesa MT and Espín JC: Resveratrol and clinical trials: The crossroad from in vitro studies to human evidence. Curr Pharm Des. 19:6064–6093. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Pang Y, Qin M, Hu P, Ji K, Xiao R, Sun N, Pan X and Zhang X: Resveratrol protects retinal ganglion cells against ischemia induced damage by increasing Opa1 expression. Int J Mol Med 46: 1707-1720, 2020.
APA
Pang, Y., Qin, M., Hu, P., Ji, K., Xiao, R., Sun, N. ... Zhang, X. (2020). Resveratrol protects retinal ganglion cells against ischemia induced damage by increasing Opa1 expression. International Journal of Molecular Medicine, 46, 1707-1720. https://doi.org/10.3892/ijmm.2020.4711
MLA
Pang, Y., Qin, M., Hu, P., Ji, K., Xiao, R., Sun, N., Pan, X., Zhang, X."Resveratrol protects retinal ganglion cells against ischemia induced damage by increasing Opa1 expression". International Journal of Molecular Medicine 46.5 (2020): 1707-1720.
Chicago
Pang, Y., Qin, M., Hu, P., Ji, K., Xiao, R., Sun, N., Pan, X., Zhang, X."Resveratrol protects retinal ganglion cells against ischemia induced damage by increasing Opa1 expression". International Journal of Molecular Medicine 46, no. 5 (2020): 1707-1720. https://doi.org/10.3892/ijmm.2020.4711
Copy and paste a formatted citation
x
Spandidos Publications style
Pang Y, Qin M, Hu P, Ji K, Xiao R, Sun N, Pan X and Zhang X: Resveratrol protects retinal ganglion cells against ischemia induced damage by increasing Opa1 expression. Int J Mol Med 46: 1707-1720, 2020.
APA
Pang, Y., Qin, M., Hu, P., Ji, K., Xiao, R., Sun, N. ... Zhang, X. (2020). Resveratrol protects retinal ganglion cells against ischemia induced damage by increasing Opa1 expression. International Journal of Molecular Medicine, 46, 1707-1720. https://doi.org/10.3892/ijmm.2020.4711
MLA
Pang, Y., Qin, M., Hu, P., Ji, K., Xiao, R., Sun, N., Pan, X., Zhang, X."Resveratrol protects retinal ganglion cells against ischemia induced damage by increasing Opa1 expression". International Journal of Molecular Medicine 46.5 (2020): 1707-1720.
Chicago
Pang, Y., Qin, M., Hu, P., Ji, K., Xiao, R., Sun, N., Pan, X., Zhang, X."Resveratrol protects retinal ganglion cells against ischemia induced damage by increasing Opa1 expression". International Journal of Molecular Medicine 46, no. 5 (2020): 1707-1720. https://doi.org/10.3892/ijmm.2020.4711
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team