Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
October-2015 Volume 47 Issue 4

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2015 Volume 47 Issue 4

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Vasoactive intestinal peptide represses activation of tumor-associated macrophages in gastric cancer via regulation of TNFα, IL-6, IL-12 and iNOS

  • Authors:
    • Lu Chen
    • Weijie Yuan
    • Zhikang Chen
    • Shaobin Wu
    • Jie Ge
    • Jinxiang Chen
    • Zihua Chen
  • View Affiliations / Copyright

    Affiliations: Department of General Surgery, Xiangya Hospital, Central South University, Changsha 410008, P.R. China
  • Pages: 1361-1370
    |
    Published online on: August 19, 2015
       https://doi.org/10.3892/ijo.2015.3126
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Vasoactive intestinal peptide (VIP) has been regarded as deactivator for macrophages. However, the depressive effect of VIP on tumor-associated macrophages (TAM) has not been recognized. In the present study, we investigated the effect of VIP on gastric cancer via TAM by suppressing expression levels of TNFα, IL-6, IL-12 and iNOS. Real-time PCR was carried out to examine the expression of CD68 to determine the levels of TAM. The effect of VIP on cell activities was assayed by proliferation assay, colony formation and flow cytometry analysis. The co-culture of TAM and human gastric cancer cell line MKN-45 were performed to understand whether the VIP affects the gastric cancer cells via TAM. Further, the tumor formation in a nude mouse model and VIP injection were performed to illustrate the effect on tumor progression in vivo. CD68 was high expressed in gastric cancer indicating high level of TAM in gastric cancer. Treatment with VIP significantly depressed TAM activation. Moreover, the expression of TNFα, IL-6, IL-12 and iNOS in TAM were depressed by VIP treatment, and the VIP treated TAM depressed gastric cancer cells. The experiment in the nude mouse model also suggested that by injection with TAM+VIP, the tumor volume and tumor weight were both decreased significantly. These data suggest that treatment with VIP inhibits gastric cancer.

Introduction

Gastric cancer is one of the most common cancers in the world (1). Up to date, the castration-resistant gastric cancer has only limited curative effect and has shown poor prognosis in clinical practice (2). New treatment strategy of targeting driver pathways provides optional treatment for cancers. For example, induced robust CD8+ T cell response against tumor-associated macrophages (TAM) suggested a novel strategy against breast cancer (3). In tumor progression, TAM is increased and thereby remodels the tumor microenvironment which promoted carcinogenesis (4). By secreting growth and proangiogenic factors, TAM participates in tumor cell proliferation and metastasis via regulating the function of fibroblasts in the tumor stroma (5). Recent studies suggested that anti-TAM effects by small molecule inhibitors could depress tumor suppression, such as cytotoxic (6), biphosphonate compound (7) and zoledronic acid (7). However, these inhibitors showed low infiltrate and limited effects on tumor growth. Thus, the therapeutic targeting of TAM needs to be elucidated and more inhibitors should be developed.

Vasoactive intestinal peptide (VIP) belongs to a superfamily of peptides which also includes pituitary adenylate cyclase-activating polypeptide (PACAP), secretin, and glucagon (8). In recent studies, VIP was shown to regulate the production of TNFα, IL-6, IL-12 and iNOS (8–10). Moreover, VIP also inhibits expression levels of cyclooxygenase-2 (COX2) and high mobility group box-1 (HMGB1) in activated macrophages (11,12). In peritonitis, VIP reduced recruitment of neutrophils, macrophages and lymphocytes via controlling the expression of transcription factors including AP-1, CREB and IRF-1 (12–14). Although inhibiting the expression levels of signaling pathways, VIP also induces the expression of toll-like receptors (TLRs) (15,16), indicating the multiple-effects on the immune system. In macrophages, similar to PACAP, VIP was able to bind to specific membrane receptors, including PAC1 and VPAC (17). The receptors of VIP interact with G proteins, and mediate cAMP-dependent pathway as well as calcium mobilization, protein kinase C, phosphoinositide 3-kinase (PI3-K) and mitogen-activated protein kinase MEK1/2 pathways (18,19). Thus, the expression of VIP in organisms plays a crucial role in multiple biological actions including immunomodulation, muscle relaxation, cell proliferation and differentiation. Several studies have shown that VIP has potential effects on increasing vessel formation in a xenograft model providing insight into VIP treatment in clinical practice (10,20). Similarly, Vacas and colleagues indicated that VIP suppresses clear cell renal cell carcinoma by inducing oxidative stress (9). Therefore, VIP as deactivator of macrophages may also contribute to the suppression of TAM. However, the molecular mechanism underlying this suppression effect of VIP remains poorly understood.

The effects of VIP on expression of TNFα, IL-6, IL-12 and iNOS in macrophages were reported previously (12). TNFα, IL-6, IL-12 and iNOS are important regulators and indicators in the process of physiological and pathological immune system (21–23). Herein, we hypothesized that VIP may directly interact with TAM in gastric cancer and modulate the activation of TAM by regulating TNFα, IL-6, IL-12 and iNOS. The aim of the present study was to understand the effects of VIP on TAM in gastric cancer and illustrate the mechanism by which VIP represses the activation of TAM. For this purpose, the increasing TAM profile in patients and the depressive effects of VIP on TAM in gastric cancer were studied. Furthermore, by in vivo and in vitro experiments, the TNFα, IL-6, IL-12 and iNOS expression levels after VIP treatment was also assayed.

Materials and methods

Patients

All the samples from gastric cancer were obtained from Xiangya School of Medicine, Central South University (Changsha, China). The experiments in the present study were according to the ethical guidelines of Xiangya School of Medicine Research Ethics Committee. All the patients signed informed consent forms and the study was approved by the Hospital Ethics Committee. In total, 38 patients with gastric cancer were involved in this study. Tissues were collected during the operation. Tissue adjacent to the tumors were determined under a microscope as normal control tissues. The characteristics of the patients were shown in Table I.

Table I

The patient characteristics.

Table I

The patient characteristics.

VariablesData
Sample size38
Age (years)
Median53.69
Range37–63
Histology
 Distal30
 Proximal8
Size (mm)
 <1113
 11–2011
 21–307
 30–406
 >401
Histological grade
 I21
 II11
 III6
Stage
 I14
 II12
 III7
 IV5
Cell culture and treatment

Human gastric cancer cell line MKN-45 was purchased from Shanghai Cell Bank, Chinese Academy of Sciences. TAM was induced from human monocytes THP1 as previously reported (24). Briefly, with 48-h treatment by 320 nmol/l phorbol myristate acetate (Merck Chemical Division, Rahway, NJ, USA), the suspended cells were transferred into adherent cells. Then the cells were treated with 20 ng/ml IL-4 and IL-13 for 72 h. The induced TAM was demonstrated using flow cytometry by the biomarkers CD14, CD68, CD206 and CD204.

The MKN-45 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) (Gibco, Gaithersburg, MD, USA) [supplemented with 10% fetal bovine serum (Gibco)] at 37°C in an incubator with atmosphere of 5% CO2. For TAM, the medium was supplemented with 500 U/ml IFN-γ and 100 ng/ml LPS (Sigma-Aldrich, St. Louis, MO, USA).

To determine the effect of VIP on TAM, cells were planted at 3×104 cells/ml in 6-well plates (Gibco). The 20 wells were randomly divided into five groups (n=4), including 0, 0.5, 1, 2 and 10 μM VIP supplemented groups. After 48-h culture, the TAM responses to the VIP were detected by flow cytometry, proliferation assay and colony formation. The maximal responses of the VIP concentration was confirmed as 1.0 μM, and used to treat the TAM in following analysis. Subsequently, to understand the effects of TAM and VIP in the treated TAM on the gastric cancer cells, the MKN-45 cells at 3×104 cells/ml were plated in 6-well plates (Gibco). The plated cells were divided into five groups (n=4), including control, TAM+MKN-45, TAM+VIP (1 μM), MKN-45+VIP (1 μM) and TAM+MKN-45+VIP (1 μM). The groups which contained TAM and MKN-45 were co-cultured at concentration of 3×104 cells/ml for each cell type. For the groups with VIP supplementation, the VIP was added within 48 h after plating. Subsequently, the cells were analyzed within 96 h. Three independent experiments were performed.

Real-time PCR

Total RNAs from tissues and cells were isolated using RNA TRIzol (Invitrogen, Carlsbad, CA, USA). By agarose gel electrophoresis and BioPhotometer Plus (Eppendorf AG, Hamburg, Germany), the integrity and amount were assayed. Then 2 μg of total RNA was reverse transcribed into first cDNA using reverse transcriptase (Invitrogen) according to the manufacturer's protocols. The primers of the present study were designed as shown in Table II. The PCR was performed on ABI 7500 Real-Time PCR system (Applied Biosystems, Austin, TX, USA). The conditions were: 95°C for 3 min, 40 cycles at 95°C for 12 sec and 55°C for 40 sec. In this experiment, GAPDH mRNA is the internal control gene for normalization. Tests without DNA template were performed as negative control and melt curves were performed to remove the DNA contamination. The relative expressions of mRNAs were calculated using 2−ΔΔCt method.

Table II

Primers used for real-time PCR.

Table II

Primers used for real-time PCR.

Gene namesForward primers (5′→3′)Reverse primers (5′→3′)
CD68 CGGAATTCTGCTGGGGCTACTGGCAG TGATCTAGAGTCCCCTGGGCTTTTGGCAG
TNF-α GGAGAAGGGTGACCGACTCA CTGCCCAGACTCGGCAA
IL-6 AGCACATTAAGTACATCCTCGGC CCAGATTGGAAGCATCCGTC
IL-12 TGGAGTGCCAGGAGGACAGT TCTTGGGTGGGTCAGGTTTG
iNOS GGATGACTTTCGAGGACATGC GGGCCCTCTGGTCATACTTTT
GAPDH TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG
Western blotting

The protein expression levels were assayed using western blotting. After homogenized in RIPA buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1% NP-40, 0.5% DOC, 0.1% SDS, 1 mM DTT, protease and phosphatase inhibitors), the protein were isolated and then the quantity was determined by BCA protein assay kit (Beyotime, Wuhan, China). For each sample, 20 μg total protein was separated by 10% dodecyl sulfate polyacrylamide gel. The protein on gel was then transferred into polyvinylidene fluoride membranes (Millipore, Billerica, MA, USA). After blocking with 4% skim milk for 1 h at room temperature, primary polyclonal antibodies of CD68 (IS613, Dako, Denmark, produced in rabbit, 1:1,000), TNFα (T8300, Sigma-Aldrich, produced in rabbit, 1:2,000), IL-6 (MFCD00162579, Sigma-Aldrich, produced in rabbit, 1:1,000), IL-12 (I4153, Sigma-Aldrich, produced in goat, 1:1,000), iNOS (SAB4502011, Sigma-Aldrich, produced in rabbit, 1:1,000) and GAPDH (SAB2100894, Sigma-Aldrich, produced in rabbit, 1:500) were incubated with membranes at 4°C overnight. All the antibodies were purchased from Sigma-Aldrich. After 3 times washing in TBST buffer (pH 7.6, 20 mM Tris-HCl, 137 mM NaCl, 0.01% Tween-20), the second antibodies (HRP-conjugated anti-rabbit IgG and HRP-conjugated anti-goat IgG, Sigma-Aldrich, 1:2,000) and enhanced chemiluminescence (ECL, Millipore) were used to visualized the protein signals.

Immunohistochemical staining (IHC)

Tissues were cut into 6-μm thick sections in paraffin wax. After de-waxing, the sections were blocked with 4% skim milk and incubated with primary antibodies (CD68, 1:200; TNFα, 1:200; IL-6, 1:500; IL-12, 1:200; iNOS, 1:200) at 4°C overnight. Subsequently, the proteins were visualized after the second antibody incubation at room temperature for 1 h and visualized using streptavidin-biotinylated horseradish peroxidase complex kit (Beyotime). The TAM and MKN-45 cells were labeled by antibodies of FITC-CD68 (1:200) and cy5-MSI1 (1:200) (Bioss Co., China). Each staining was repeated 3 times.

Colony formation assay

After treatment, 2,000 cells from each group were plated into 6-well plates and incubated for 7 days at 37°C in an incubator with atmosphere of 5% CO2. After washing with phosphate buffer solution (PBS) three times, the cells were fixed with methanol for 15 min and stained using 0.2% crystal violet for 15 min. The colonies were counted and mean values were calculated from three independent experiments.

Flow cytometry

To analyze the apoptosis of the cells, we used flow cytometry (Coulter, Luton, UK) and Annexin V-FITC and propidium iodide (PI) (BioVision, Milpitas, CA, USA) staining according to the manufacturer's instructions. At least 30,000 cells for each sample were treated. The detection of biomarkers of TAM was performed using antibodies of CD14, CD68, CD206 and CD204. The cells were fixed using Cytofix/Cytoperm™ Fixation/Permeabilization solution (BD Biosciences, Franklin Lakes, NJ, USA). The FITC-CD68, FITC-CD14, PE-CD206, and PE-CD204 antibodies (Sigma-Aldrich) were incubated with the cells and labeled with PE-conjugated goat anti-mouse secondary antibody. Triplicate biological repeats were measured for this experiment.

Tumor formation in a nude mouse model

We used 5-week-old nude mice to generate the tumor model. The animal experiments were approved of the ethics committees of Xiangya School of Medicine, Central South University (Changsha, China). The tested mice were randomly divided into three groups (n=10 for each group), including control, VIP and VIP+TAM group. The mice were first injected with 3×104 MKN-45 cells in 1 ml DMEM. The injections were performed every 2 days for 20 days until the tumor size was 100 mm3. The tumor size was calculated as V=LxWxDx3.14/6. Subsequently, TAM and TAM+VIP (1 μM) were injected into the tumor tissues. Also, a blank group was performed by injection with saline. The tumor volumes were measured every 2 days until 20 days. After 20 days, the tumor tissues were excised and assayed using real-time PCR, western blotting and IHC.

Statistical analysis

The data are indicated as mean ± standard deviation (SD). The difference among the groups were confirmed using one-way-ANOVA analysis. The significant difference was determined at P<0.05. All the statistical analysis were performed using SPSS 17.0 (SPSS Inc., Chicago, IL, USA).

Results

Increasing of TAM in gastric cancer

To assess the TAM level in gastric cancer, the indicator of TAM, CD68 was detected using real-time PCR. Compared to the adjacent normal tissues, the expression of CD68 was much higher in cancer samples (P<0.001, Fig. 1A). High level of CD68 was observed in the high histological grade (Fig. 1B) and advanced tumor stage (Fig. 1C). The results indicated high levels of TAM in gastric cancer.

Figure 1

Expression of CD68 is upregulated in gastric cancer. (A) Compared to the normal tissues, the expression of CD68 was much higher in the gastric cancer tissues. (B) Higher expression of CD68 was observed based on the histological grade. (C) The expression of CD68 was much higher in III–IV advanced tumor stages compared to I–II advanced tumor stages. *p<0.05; **p<0.001.

VIP depresses TAM activation

The TAM were induced by THP1 human monocytes. The flow cytometry analysis of biomarkers including CD14 (marker for monocyte differentiation), CD68 (marker for macrophages differentiation), CD206, and CD204 (both markers for M2 macrophages) proved that the TAM were successfully induced (Fig. 2).

Figure 2

Confirmation of induced TAM by CD14 (marker for monocyte differentiation), CD68 (marker for macrophage differentiation), CD206, and CD204 (both markers for M2 macrophages).

After VIP treatment, the CD68 mRNA levels in TAM were significantly depressed (P<0.05). The 0.5 and 1.0 μM VIP treatment showed the most significant effects on expression of CD68 mRNA indicating the inhibition of TAM by VIP (Fig. 3A). The protein expression levels decreased significantly and was similar to the expression of mRNA. The 1.0 μM VIP treatment showed the most efficient depressive effects (Fig. 3B). The colony formation assay suggested that treatment with 1.0 μM VIP inhibited growth of TAM (Fig. 3C). By flow cytometry, we also showed that VIP treatment stimulated the apoptosis of TAM and 1.0 μM VIP induced apoptosis with the optimal dosage (Fig. 3D).

Figure 3

VIP depresses activation of TAM. (A) Real-time PCR shows inhibition of CD68 mRNA levels of TAM by VIP (n=4 for each group, data are expressed as the means ± SD; different lower case characters represent significant differences, P<0.05). (B) Western blotting indicates the depressive effects of VIP on protein levels of CD68. (C) Colony formation test of TAM after VIP treatment. (D) Flow cytometry assay indicates that VIP treatment induces apoptosis of TAM. The same letter indicates no significant difference while different letter superscripts represent significant difference.

VIP inhibits TNFα, IL-6, IL-12 and iNOS in TAM

VIP has been shown to depress expression of TNFα, IL-6, IL-12 and iNOS in macrophages. In the present study, the effect of VIP on expression of TNFα, IL-6, IL-12 and iNOS in TAM was determined. The result showed that VIP depressed the expression of TNFα, IL-6 and IL-12 in all the treatment groups, including 0.5, 1.0, 2.0 and 10.0 μM VIP treatment (Fig. 4A–C). For iNOS, except the 0.5 μM VIP treatment, the other concentrations of VIP treatment, including 1.0, 2.0 and 10.0 μM VIP, inhibited the expression in TAM significantly (Fig. 4D). Western blotting showed similar changes (Fig. 4E). The protein expression of TNFα, IL-6, IL-12 and iNOS was dcreased after VIP treatment. The 1.0 μM VIP treatment group showed inhibition of these genes among all the groups, thus, the following experiment was performed using 1.0 μM VIP in treatment of TAM.

Figure 4

VIP inhibits expression of TNFα, IL-6, IL-12 and iNOS in TAM. Real-time PCR indicates that mRNA expression of TNFα (A), IL-6 (B), IL-12 (C) and iNOS (D) of TAM (n=4 for each group, data are expressed as the means ± SD; different lower case characters represent significant differences, P<0.05). (E) Western blotting also shows depressive effects of VIP on protein expression of TNFα, IL-6, IL-12 and iNOS in TAM.

The VIP-treated TAM depressed gastric cancer cells

To examine the possible effects of VIP on gastric cancer cells via TAM, TAM were co-cultured with human gastric cancer cell line MKN-45 and treated with VIP. The co-culture of TAM and MKN-45 is shown in Fig. 5A. The CD68 and MSI1 as specific biomarkers for TAM and MKN-45 were used to identify the cells. The result showed co-existence of TAM and MKN-45 (Fig. 5A). Colony formation assay showed that the VIP-treated TAM remarkably reduced colony formation of gastric cancer cells (Fig. 5B). Moreover, without TAM, the MKN-45+VIP group had no significant decrease compared to control, which indicated the depressive effects of VIP on gastric cancer cells is indirect and meditated by TAM (Fig. 5B). The proliferation assay showed that the lowest cell viability of MKN-45 cells was observed in TAM+VIP and TAM+MKN-45+VIP group (Fig. 5C). The TAM+MKN-45 group had the highest cell viability, while, other groups showed medial cell viability. Apoptosis demonstrated by flow cytometry showed similar results. TAM+MKN-45+VIP group showed the highest apoptosis rate while TAM+MKN-45 group had the lowest apoptosis rate (Fig. 5D).

Figure 5

VIP inhibits activation of gastric cancer cells via depressing TAM. (A) Co-culture of TAM and MKN-45. CD68 and MSI1 are labeled TAM and MKN-45, respectively. (B) Colony formation test of gastric cancer cells (MKN-45) and TAM after VIP treatment. (C) Cell proliferation of gastric cancer cells (MKN-45) and TAM after VIP treatment (n=4 for each group, data are expressed as the means ± SD; different lower case characters represent significant differences, P<0.05). (D) Flow cytometry assay indicates apoptosis of gastric cancer cells (MKN-45) and TAM after VIP treatment. The same letter indicates no significant difference while different letter superscripts represent significant difference.

As the VIP depressed activation of gastric cancer cells via TAM, we next determine if VIP affects gene expression levels in cultured gastric cancer cells directly or indirectly. VIP downregulated TNFα, IL-6, IL-12 and iNOS were found in TAM+VIP and TAM+MKN-45+VIP groups while MKN-45+VIP group showed no significant difference of expression compared to control, which suggested that the depressive effects of TNFα, IL-6, IL-12 and iNOS was mediated by TAM (Fig. 6).

Figure 6

VIP depression of TNFα, IL-6, IL-12 and iNOS after VIP treatment in TAM co-cultured with gastric cancer cells. Real-time PCR indicates that mRNA expression of TNFα (A), IL-6 (B), IL-12 (C) and iNOS (D) of TAM co-cultured with gastric cancer cells (n=4 for each group, data are expressed as the means ± SD; different lower case characters represent significant differences, P<0.05). (E) Western blotting also shows depressive effects of VIP on protein expression of TNFα, IL-6, IL-12 and iNOS in TAM co-cultured with gastric cancer cells.

VIP depresses TAM and tumor formation in the nude mouse model

To illustrate the effect of VIP on gastric cancer in vivo, the tumor formation in the nude mouse model was constructed by 3×104 MKN-45 cell injections. After tumor formation, the TAM and TAM+VIP were injected into the tumors. The tumor volume and tumor weight of TAM+VIP group were significantly lower compared with the TAM group (P<0.05 after 20 days) (Fig. 7A and B). The CD68 was increased accordingly in TAM groups while depressed CD68 was found in TAM+VIP group indicating the depressive effect of TAM in vivo (Fig. 7C–E).

Figure 7

VIP treatment of TAM depresses tumor formation. (A) Tumor volume changes after injection with TAM and VIP treated TAM (n=10 mice in each group). (B) Tumor weight after injection with TAM and VIP treated TAM (n=10 mice in each group, data are expressed as the means ± SD; asterisks showed significant difference between the groups, P<0.05). (C) Expression of CD68 mRNA in xenograft tumors after injection with TAM and VIP treated TAM (n=5 mice in each group, data are expressed as the means ± SD; asterisks showed significant difference between the groups, P<0.05). (D) Expression of CD68 protein in xenograft tumors after injection with TAM and VIP treated TAM assayed by western blotting (data are expressed as the means ± SD; asterisks show significant difference between the groups, P<0.05). (E) Distribution and expression of CD68 detected by IHC. Bar, 50 μm.

Consistent with the result in vitro, the expression levels of TNFα, IL-6, IL-12 and iNOS in xenograft tumor tissues were downregulated by VIP in TAM+VIP group compared with the TAM group (Fig. 8). Thus, the results of the xenograft model suggested that VIP inhibits the tumor progression of gastric cancer mediated by TAM in vivo via downregulating expression of TNFα, IL-6, IL-12 and iNOS.

Figure 8

Expression of TNFα, IL-6, IL-12 and iNOS in xenograft tumors after injection with TAM and VIP treated TAM. (A) Real-time PCR result indicates depressive effect of VIP treatment on mRNA expression of TNFα, IL-6, IL-12 and iNOS in xenograft tumors after TAM injection (n=5 mice in each group, data are expressed as the means ± SD; asterisks show significant difference between the groups, P<0.05). (B) Western blotting shows depressive effect of VIP treatment on protein expression of TNFα, IL-6, IL-12 and iNOS in xenograft tumors after TAM injection.

Discussion

The present study showed the primary findings on the VIP depressive effect on TAM. Moreover, the treatment with VIP inhibits the expression of TNFα, IL-6, IL-12 and iNOS in TAM, which results in deactivation of TAM. For cancer cells, TAM acts as mediators for interacting growth factors, cytokines and chemokines and change the tumor microenvironment to stimulate tumor progression (25–27). We demonstrated that the VIP inhibited gastric cancer via TAM both in cultured cells and in the nude mouse model.

Macrophages originating from blood monocytes are divided into M1 (classically activated) and M2 types (alternatively activated) (28). TAM has been regarded as M2 phenotype and play mostly pro-tumoral functions such as promoting tumor cell survival, proliferation and invasion (29). High levels of TAM are correlated with poor prognosis (30). Simultaneously, CD68 as indicator of TAM has been used as molecular signature to determine the prognosis of cancer (31,32). With no surprise, as we found in the present study, CD68 was highly expressed in gastric cancer tissues compared to normal tissues showing similar results with previous reports with higher level of TAM in tumor than normal tissues. Accordingly, depression of TAM may be a potential therapy for gastric cancer treatment. Further, we used VIP, a pleiotropic peptides to intervene in TAM to demonstrate the possibility of VIP as new therapeutic strategy.

Tumorigenesis as a complex process, results from molecular and cellular variation with a variety of compounds including oncoproteins and tumor proteins. During this process, TAM are the promotional factor for tumorigenesis (33). VIP is a neuropeptide that exerts multiple actions in different types of cells (8). Several studies showed that the de-activated function of VIP in macrophages (11,12,34). As we found in the present study, VIP depressed TAM as well. It is known that VIP affects the expression of both pro- and anti-inflammatory factors after LPS and IFNγ induced macrophages (35,36). In the present study, the treatment of VIP depressed activities of TAM by suppressing expression of CD68 and colony formation as well as inducing apoptosis. Based on these findings, it seems likely that the depressing effect of VIP on the proliferation of macrophages also exists in TAM. However, there is still a lack of straight forward answer as to how VIP suppressed the TAM and whether VIP could inhibit tumorigenesis by depressing TAM in vivo.

The molecular mechanism by which VIP exerts its deactivated effects in macrophage is well studied. VIP has been shown to regulate the expression and/or transactivating of transcription factors such as AP-1, NFκB, CREB and IRF-1 (13,14,34,36) and mediate the expression of chemokines, tumor necrosis factors, COX2, interleukin and toll-like receptors (8,15). TNFα showed tumor-promoting roles in previous studies and is regarded as a target in malignant cancer (21,37). Inhibition of TNFα reduces metastatic activity in tumors (37). The present study showed that VIP inhibited production of TNFα and the incubation of VIP suppressed the effects of TAM. These data are consistent with previous studies showing that VIP reduced the growth of macrophage via regulating the growth factor, and in macrophages, IL-6, IL-12 and iNOS could be inhibited by VIP which showed deactivation effects of VIP on macrophages (8,11,12). IL-6 and IL-12 are synthesized by macrophages and participate in inducing antibody secretion, acute phase reaction, hematopoiesis and regulating production of IFN-γ and TNFα (8). iNOS, also participates in the immune response by binding to calmodulin and produces NO as an immune defense mechanism which also indicates the activities of macrophages (23). The inhibited expression levels of IL-6, IL-12 and iNOS by VIP showed decreased activity of TAM. These results indicate that treatment with VIP inhibits TNFα and IL-6, IL-12 and iNOS of TAM which then results in depressed cell proliferation.

Our data showed that VIP inhibits progression of TAM, and the role of TAM as cancer promoter has been demonstrated previously. This evidence suggests TAM as potential therapeutic target in human cancer and VIP could be an efficient inhibitor for TAM. In the present study, VIP is found to inhibit gastric cancer cells as well as tumor formation in the nude mouse model. We found the depressive effects of VIP are indirect via first suppressing TAM. The decreased expression of TNFα and IL-6, IL-12 and iNOS after VIP treated required co-culture of TAM and MKN-45. In a previous study, VIP suppressed metastatic human clear cell renal cell carcinoma by inducing oxidative stress (9). Vacas et al demonstrated that VIP inhibited invasion and metastasis of human clear cell renal cell carcinoma via decreasing β-catenin (9). On the contrary, high expression of VIP in pancreas could induce VIPoma which is a very rare type of cancer that usually derived from pancreatic cells (38). Thus, the roles of VIP in cancer progression seem contradictory in different types of cancer which needs to be elucidated in further study. The results of our present study showed that the VIP treatment with a proper dosage could inhibit progression of gastric cancer by deactivating TAM which is similar to the macrophages by decreasing expression levels of TNFα and IL-6, IL-12 and iNOS.

In conclusion, we demonstrated that VIP inhibits progression of gastric cancer mediated by TAM in the present study. The antitumor action of VIP appears to be initiated by interaction with TAM via depression of the expression levels of TNFα and IL-6, IL-12 and iNOS. The presented data provide new insight into the therapeutic application of VIP to inhibit gastric cancer both in vivo and in vitro via TAM.

References

1 

Roder DM: The epidemiology of gastric cancer. Gastric Cancer. 5(Suppl 1): S5–S11. 2002. View Article : Google Scholar

2 

Cervantes A, Roda D, Tarazona N, Roselló S and Pérez-Fidalgo JA: Current questions for the treatment of advanced gastric cancer. Cancer Treat Rev. 39:60–67. 2013. View Article : Google Scholar

3 

Mukhtar RA, Nseyo O, Campbell MJ and Esserman LJ: Tumor-associated macrophages in breast cancer as potential biomarkers for new treatments and diagnostics. Expert Rev Mol Diagn. 11:91–100. 2011. View Article : Google Scholar

4 

Noy R and Pollard JW: Tumor-associated macrophages: From mechanisms to therapy. Immunity. 41:49–61. 2014. View Article : Google Scholar : PubMed/NCBI

5 

De Palma M and Lewis CE: Macrophage regulation of tumor responses to anticancer therapies. Cancer Cell. 23:277–286. 2013. View Article : Google Scholar : PubMed/NCBI

6 

Bingle L, Brown NJ and Lewis CE: The role of tumour-associated macrophages in tumour progression: Implications for new anticancer therapies. J Pathol. 196:254–265. 2002. View Article : Google Scholar : PubMed/NCBI

7 

Giraudo E, Inoue M and Hanahan D: An amino-bisphosphonate targets MMP-9-expressing macrophages and angiogenesis to impair cervical carcinogenesis. J Clin Invest. 114:623–633. 2004. View Article : Google Scholar : PubMed/NCBI

8 

Delgado M and Ganea D: Vasoactive intestinal peptide: A neuropeptide with pleiotropic immune functions. Amino Acids. 45:25–39. 2013. View Article : Google Scholar

9 

Vacas E, Bajo AM, Schally AV, Sánchez-Chapado M, Prieto JC and Carmena MJ: Vasoactive intestinal peptide induces oxidative stress and suppresses metastatic potential in human clear cell renal cell carcinoma. Mol Cell Endocrinol. 365:212–222. 2013. View Article : Google Scholar

10 

Yang J, Shi QD, Song TB, Feng GF, Zang WJ, Zong CH and Chang L: Vasoactive intestinal peptide increases VEGF expression to promote proliferation of brain vascular endothelial cells via the cAMP/PKA pathway after ischemic insult in vitro. Peptides. 42:105–111. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Delgado M and Ganea D: Vasoactive intestinal peptide prevents activated microglia-induced neurodegeneration under inflammatory conditions: Potential therapeutic role in brain trauma. FASEB J. 17:1922–1924. 2003.PubMed/NCBI

12 

Delgado M, Robledo G, Rueda B, Varela N, O'Valle F, Hernandez-Cortes P, Caro M, Orozco G, Gonzalez-Rey E and Martin J: Genetic association of vasoactive intestinal peptide receptor with rheumatoid arthritis: Altered expression and signal in immune cells. Arthritis Rheum. 58:1010–1019. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Delgado M and Ganea D: Cutting edge: Is vasoactive intestinal peptide a type 2 cytokine? J Immunol. 166:2907–2912. 2001. View Article : Google Scholar : PubMed/NCBI

14 

Delgado M and Ganea D: Inhibition of endotoxin-induced macrophage chemokine production by VIP and PACAP in vitro and in vivo. Arch Physiol Biochem. 109:377–382. 2001. View Article : Google Scholar

15 

Gomariz RP, Arranz A, Abad C, Torroba M, Martinez C, Rosignoli F, Garcia-Gómez M, Leceta J and Juarranz Y: Time-course expression of Toll-like receptors 2 and 4 in inflammatory bowel disease and homeostatic effect of VIP. J Leukoc Biol. 78:491–502. 2005. View Article : Google Scholar : PubMed/NCBI

16 

Arranz A, Juarranz Y, Leceta J, Gomariz RP and Martínez C: VIP balances innate and adaptive immune responses induced by specific stimulation of TLR2 and TLR4. Peptides. 29:948–956. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Laburthe M and Couvineau A: Molecular pharmacology and structure of VPAC Receptors for VIP and PACAP. Regul Pept. 108:165–173. 2002. View Article : Google Scholar : PubMed/NCBI

18 

Brenneman DE: Neuroprotection: A comparative view of vasoactive intestinal peptide and pituitary adenylate cyclase-activating polypeptide. Peptides. 28:1720–1726. 2007. View Article : Google Scholar : PubMed/NCBI

19 

Voice JK, Dorsam G, Chan RC, Grinninger C, Kong Y and Goetzl EJ: Immunoeffector and immunoregulatory activities of vasoactive intestinal peptide. Regul Pept. 109:199–208. 2002. View Article : Google Scholar : PubMed/NCBI

20 

Collado B, Carmena MJ, Clemente C, Prieto JC and Bajo AM: Vasoactive intestinal peptide enhances growth and angiogenesis of human experimental prostate cancer in a xenograft model. Peptides. 28:1896–1901. 2007. View Article : Google Scholar : PubMed/NCBI

21 

Balkwill F: TNF-α in promotion and progression of cancer. Cancer Metastasis Rev. 25:409–416. 2006. View Article : Google Scholar : PubMed/NCBI

22 

Wong CK, Ho CY, Ko FW, Chan CH, Ho AS, Hui DS and Lam CW: Proinflammatory cytokines (IL-17, IL-6, IL-18 and IL-12) and Th cytokines (IFN-γ, IL-4, IL-10 and IL-13) in patients with allergic asthma. Clin Exp Immunol. 125:177–183. 2001. View Article : Google Scholar : PubMed/NCBI

23 

Aktan F: iNOS-mediated nitric oxide production and its regulation. Life Sci. 75:639–653. 2004. View Article : Google Scholar : PubMed/NCBI

24 

Tjiu JW, Chen JS, Shun CT, Lin SJ, Liao YH, Chu CY, Tsai TF, Chiu HC, Dai YS, Inoue H, et al: Tumor-associated macrophage-induced invasion and angiogenesis of human basal cell carcinoma cells by cyclooxygenase-2 induction. J Invest Dermatol. 129:1016–1025. 2009. View Article : Google Scholar

25 

Liu J, Zhang N, Li Q, Zhang W, Ke F, Leng Q and Wang H, Chen J and Wang H: Tumor-associated macrophages recruit CCR6+ regulatory T cells and promote the development of colorectal cancer via enhancing CCL20 production in mice. PLoS One. 6:e194952011. View Article : Google Scholar

26 

Caillou B, Talbot M, Weyemi U, Pioche-Durieu C, Al Ghuzlan A, Bidart JM, Chouaib S, Schlumberger M and Dupuy C: Tumor-associated macrophages (TAMs) form an interconnected cellular supportive network in anaplastic thyroid carcinoma. PLoS One. 6:e225672011. View Article : Google Scholar : PubMed/NCBI

27 

Chen JJ, Lin YC, Yao PL, Yuan A, Chen HY, Shun CT, Tsai MF, Chen CH and Yang PC: Tumor-associated macrophages: The double-edged sword in cancer progression. J Clin Oncol. 23:953–964. 2005. View Article : Google Scholar

28 

Martinez FO, Sica A, Mantovani A and Locati M: Macrophage activation and polarization. Front Biosci. 13:453–461. 2008. View Article : Google Scholar

29 

Mantovani A, Sozzani S, Locati M, Allavena P and Sica A: Macrophage polarization: Tumor-associated macrophages as a paradigm for polarized M2 mononuclear phagocytes. Trends Immunol. 23:549–555. 2002. View Article : Google Scholar : PubMed/NCBI

30 

Pollard JW: Tumour-educated macrophages promote tumour progression and metastasis. Nat Rev Cancer. 4:71–78. 2004. View Article : Google Scholar : PubMed/NCBI

31 

Khorana AA, Ryan CK, Cox C, Eberly S and Sahasrabudhe DM: Vascular endothelial growth factor, CD68, and epidermal growth factor receptor expression and survival in patients with Stage II and Stage III colon carcinoma: A role for the host response in prognosis. Cancer. 97:960–968. 2003. View Article : Google Scholar : PubMed/NCBI

32 

Strojnik T, Kavalar R, Zajc I, Diamandis EP, Oikonomopoulou K and Lah TT: Prognostic impact of CD68 and kallikrein 6 in human glioma. Anticancer Res. 29:3269–3279. 2009.PubMed/NCBI

33 

Solinas G, Germano G, Mantovani A and Allavena P: Tumor-associated macrophages (TAM) as major players of the cancer-related inflammation. J Leukoc Biol. 86:1065–1073. 2009. View Article : Google Scholar : PubMed/NCBI

34 

Delgado M, Abad C, Martinez C, Leceta J and Gomariz RP: Vasoactive intestinal peptide prevents experimental arthritis by downregulating both autoimmune and inflammatory components of the disease. Nat Med. 7:563–568. 2001. View Article : Google Scholar : PubMed/NCBI

35 

Delgado M and Ganea D: Inhibition of IFN-γ-induced janus kinase-1-STAT1 activation in macrophages by vasoactive intestinal peptide and pituitary adenylate cyclase-activating polypeptide. J Immunol. 165:3051–3057. 2000. View Article : Google Scholar : PubMed/NCBI

36 

Ganea D and Delgado M: Vasoactive intestinal peptide (VIP) and pituitary adenylate cyclase-activating polypeptide (PACAP) as modulators of both innate and adaptive immunity. Crit Rev Oral Biol Med. 13:229–237. 2002. View Article : Google Scholar : PubMed/NCBI

37 

van Horssen R, Ten Hagen TL and Eggermont AM: TNF-α in cancer treatment: Molecular insights, antitumor effects, and clinical utility. Oncologist. 11:397–408. 2006. View Article : Google Scholar : PubMed/NCBI

38 

Krejs GJ: VIPoma syndrome. Am J Med. 82B:37–48. 1987. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chen L, Yuan W, Chen Z, Wu S, Ge J, Chen J and Chen Z: Vasoactive intestinal peptide represses activation of tumor-associated macrophages in gastric cancer via regulation of TNFα, IL-6, IL-12 and iNOS. Int J Oncol 47: 1361-1370, 2015.
APA
Chen, L., Yuan, W., Chen, Z., Wu, S., Ge, J., Chen, J., & Chen, Z. (2015). Vasoactive intestinal peptide represses activation of tumor-associated macrophages in gastric cancer via regulation of TNFα, IL-6, IL-12 and iNOS. International Journal of Oncology, 47, 1361-1370. https://doi.org/10.3892/ijo.2015.3126
MLA
Chen, L., Yuan, W., Chen, Z., Wu, S., Ge, J., Chen, J., Chen, Z."Vasoactive intestinal peptide represses activation of tumor-associated macrophages in gastric cancer via regulation of TNFα, IL-6, IL-12 and iNOS". International Journal of Oncology 47.4 (2015): 1361-1370.
Chicago
Chen, L., Yuan, W., Chen, Z., Wu, S., Ge, J., Chen, J., Chen, Z."Vasoactive intestinal peptide represses activation of tumor-associated macrophages in gastric cancer via regulation of TNFα, IL-6, IL-12 and iNOS". International Journal of Oncology 47, no. 4 (2015): 1361-1370. https://doi.org/10.3892/ijo.2015.3126
Copy and paste a formatted citation
x
Spandidos Publications style
Chen L, Yuan W, Chen Z, Wu S, Ge J, Chen J and Chen Z: Vasoactive intestinal peptide represses activation of tumor-associated macrophages in gastric cancer via regulation of TNFα, IL-6, IL-12 and iNOS. Int J Oncol 47: 1361-1370, 2015.
APA
Chen, L., Yuan, W., Chen, Z., Wu, S., Ge, J., Chen, J., & Chen, Z. (2015). Vasoactive intestinal peptide represses activation of tumor-associated macrophages in gastric cancer via regulation of TNFα, IL-6, IL-12 and iNOS. International Journal of Oncology, 47, 1361-1370. https://doi.org/10.3892/ijo.2015.3126
MLA
Chen, L., Yuan, W., Chen, Z., Wu, S., Ge, J., Chen, J., Chen, Z."Vasoactive intestinal peptide represses activation of tumor-associated macrophages in gastric cancer via regulation of TNFα, IL-6, IL-12 and iNOS". International Journal of Oncology 47.4 (2015): 1361-1370.
Chicago
Chen, L., Yuan, W., Chen, Z., Wu, S., Ge, J., Chen, J., Chen, Z."Vasoactive intestinal peptide represses activation of tumor-associated macrophages in gastric cancer via regulation of TNFα, IL-6, IL-12 and iNOS". International Journal of Oncology 47, no. 4 (2015): 1361-1370. https://doi.org/10.3892/ijo.2015.3126
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team