Characterization of the human zinc finger nfx‑1‑type containing 1 encoding ZNFX1 gene and its response to 12‑O‑tetradecanoyl‑13‑acetate in HL‑60 cells
- Authors:
- Published online on: August 20, 2019 https://doi.org/10.3892/ijo.2019.4860
- Pages: 896-904
Abstract
Introduction
Zinc finger proteins (ZNFs) regulate transcription (1), replication (2), and other biologically significant events, including cellular differentiation (3), and some have been suggested to be responsible for human diseases (4,5). However, the molecular mechanisms that regulate their gene expression remain unclear. Surveillance of the human genomic DNA database revealed that duplicated GGAA (TTCC) motifs, which are frequently contained in the 5′ flanking regions of the DNA repair, apoptosis, anti-viral response and mitochondrial function associated factor encoding genes (6,7), are present in the 5′ flanking regions of several ZNF family genes (8). Interestingly, the duplicated GGAA motif responds to interferon (IFN) β (9) and trans resveratrol (10, 12). In the ataxia telangiectasia and Rad3 related, xeroderma pigmentosum type B, and retinoblastoma (RB1) promoters, the motif notably responds to 12-O-tetra decanoylphorbol 13 acetate (TPA) in HL 60 cells (13). These observations suggest that ZNF family genes could be induced by the cis-function of the GGAA motifs during the macrophage like-differentiation of HL-60 cells.
The GGAA is a core sequence motif that E26 transformation-specific (ETS) family proteins recognize (14). Numerous transcription factors (TFs), including GA-binding protein TF (GABP), nuclear factor erythroid 2-related factor 2, nuclear factor κB/c Rel, STATs and interferon regulatory factor proteins bind to the GGAA motif-containing sequences and regulate gene transcription (7). Notably, ETS family proteins play essential roles in the regulation of cellular differentiation (15,16). Duplicated GGAA motifs are contained in the promoter region of the human CD41 (ITGA2B) (17) and programmed death-1 genes (18), suggesting that GGAA motif binding proteins regulate megacaryocytic cell differentiation. ETS family TF spleen focus forming virus proviral integration oncogene (SPI1; PU.1) regulates the timing of the activation of the T lineage developmental program (19). Other ETS family proteins, ETS variant (ETV)4 and ETV5, regulate the differentiation of embryonic stem cells (20). ETS1 regulates neural crest development via the epigenetic control of bone morphogenetic protein signaling (21). Moreover, ETS family proteins have been suggested to affect tumorigenesis (22). The aberrant fusion protein EWS friend leukemia integration 1 TF is known to induce osteosarcoma development (23). In addition, amplification of ETS1 is suggested to cause tumor invasion (24). These lines of evidence suggest that GGAA binding proteins are involved in the generation and development of cancer.
In the present study, we isolated 5′upstream regions of six human ZNF-encoding genes and found that the zinc finger nfx-1-type containing 1 (ZNFX1) promoter is the most prominently activated in response to TPA. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) and western blotting revealed that amount of ZNFX1 transcripts and degree of translation increase during the TPA-induced differentiation of HL-60 cells. Deletion and point mutation-introducing experiments demonstrated that the duplicated GGAA motif, which is present 100-bp downstream of the transcription start site (TSS), serves an essential role in the TPA response. JASPAR analysis of the TPA responding duplicated GGAA motif suggested that SPI1 (PU.1), ETS1, myeloid zinc finger 1 (MZF1) and STAT1/2 are involved in the regulation of ZNFX1 gene expression during the differentiation of HL-60 into macrophage like cells. Taken together, it was suggested that investigations in the transcription mechanism of the ZNFX1 gene may contribute to the development of novel anti-cancer therapies.
Materials and methods
Materials
TPA was purchased from Sigma-Aldrich (Merck KGaA) (13).
Cells and cell culture
The human promyelotic leukemia cell line HL-60 (Institute of Medical Science, Tokyo University) (25) was cultured in RPMI 1640 medium (WAKO Pure Chemical), supplemented with 10% fetal calf serum (FCS) (Biosera), containing 120 IU/ml penicillin G (Meiji Seika Pharma) and 120 µg/ml streptomycin (Meiji Seika Pharma), at 37°C in a humidified atmosphere with 5% CO2.
Construction of luciferase (Luc) reporter plasmids
A 543-bp region of the human ZNFX1 gene and other promoter regions of ZNF252, ZNF343, ZNF555, ZNF782, zinc finger CCCH-type containing, antiviral 1 (ZC3HAV1) genes were obtained by PCR-amplification, which was carried out with Prime STAR (Takar Bio, Inc.), appropriate primer pairs (Table I) and HeLa S3 genomic DNA as a template. The reaction was as follows: 98°C for 15 sec, 55°C for 5 sec, and 72°C for 30 sec for 30 cycles. The PCR-amplified DNA fragments were digested with restriction enzymes, then they were ligated into the KpnI/HindIII or the KpnI/XhoI site of pGL4.10[luc2] (Promega Corporation), to make pGL4-ZNFX1, -ZNF252, -ZNF343, -ZNF555, -ZNF782, -zinc finger CCCH-type containing, anti viral 1 (ZC3HAV1). Similarly, the deletion of the 543-bp was carried out by PCR with appropriate primer sets (Table I), and pGL4-ZNFX1 as a template. The DNA fragments were ligated into the MCS of pGL4.10[luc2] to make pGL4-X1-Δ1 to Δ7 plasmids. Other plasmids,-Δ6mt1,-Δ6mt2,-Δ6mt12,-Δ7mt1,-Δ7mt2, and-Δ7mt12, were constructed by a similar proce dure (13) with appropriate primer pairs (Table I) and template plasmids, pGL4-X1-Δ6 or pGL4-X1-Δ7, for the amplification of the DNA fragments (Table I). Nucleotide sequences were confirmed by a DNA sequencing service (FASMAC-Greiner Japan, Inc.) with primers Rv (5′-TAGCAAAATAGGCTGTCCCC-3′) and GL (5′-CTTTATGTTTTTGGCGTCTTCC-3′).
 | Table IPrimer pairs used to amplify 5′ upstream regions of the human zinc finger motif containing protein-encoding genes. |
Transient transfection and luc assay
Plasmids (100 ng/1-2×105 cells) were transfected into HL-60 cells via the DEAE dextran method (26) in 96 well plates. After 24 h of transfection, the culture medium was changed to RPMI/1640 containing 10% FCS with or without TPA (8.1 nM). Control cells were treated without TPA and cultured in the medium containing 0.0005% DMSO. After a further 24 h of incubation at 37°C, cells were collected and lysed with 100 µl of 1X cell culture lysis reagent containing 25 mM Tris phosphate (pH 7.8), 2 mM dithiothreitol, 2 mM 1,2-diaminocyclohexane-N,N,N′,N′,-tetraacetic acid, 10% glycerol and 1% Triton X-100, and then were mixed and centrifuged at 12,000 x g for 5 sec at 4°C. The supernatant was stored at -80°C. The Luc assay was performed with a Luciferase Assay system (Promega Corporation), and relative Luc activities were normalized by the protein concentration and calculated as described previously (10,11).
Western blot analysis
Whole proteins were extracted by RIPA buffer (20 mM Tris-HCl (pH 7.4), containing 0.1% SDS, 1% Triton X100, and 1% sodium deoxycholate). Proteins were separated via 8/15% SDS-PAGE. Western blot analysis was carried out as previously described (10,11) with antibodies against ZNFX1 (Abcam, cat no. ab179452) and β actin (Sigma Aldrich; Merck KGaA, cat no. A5441), diluted 1:2,600 and 1:10,000, respectively, followed by the addition of horse radish peroxidase-conjugated secondary antibody for ZNFX1 (Sigma Aldrich, cat no. A0545) and β-actin (Sigma-Aldrich, cat no. A9917) diluted 1:20,000. Signal intensities of samples at 0, 1, 2, 4, 8, 16, 24, 40 and 48 h following treatment were quantified with a ChemiDoc and ImageLab System (BioRad Laboratories, Inc.).
RT-qPCR
RT-qPCR was carried out as described previously (9-11). Total RNAs were extracted by GeneElute Mammalian Total RNA Miniprep Kit (Sigma Aldrich), according to the manufacturer's protocols. First strand cDNAs were synthesized with ReverTra Ace (Toyobo Life Science), random primers (Takara Bio, Inc.), and total RNAs extracted from HL-60 cells, which were treated with TPA (8.1 nM) for 0, 8, 24, 48 and 72 h. The reaction was carried out by incu bating at 30°C for 10 min, 42°C for 40 min, and then heating at 94°C for 5 min. The sequences (from 5′-3′) of the primer pairs used to amplify human ZNFX1, integrin subunit α M (ITGAM; CD11b), and GAPDH cDNAs were hZX1RT: GGCCCTCAAAAGAAGCCCTG and AhZX1RT: GATGGGGAACTTCTGGAGGC; hCD11b 459: GGGCTCTGCTTCCTGTTT G and AhCD11b 758: CTGCGTTATTGGCTTCACC; and hGAPDH556: TGC ACC ACC AAC TGC TTA GC and hGAPDH642: GGCATG GACTGTGGTCATGAG, respectively.
Conditions for PCR, which was performed with BIOTAQ DNA polymerase (Bioline), were as follows: 96°C for 10 sec, 55°C for 5 sec, and 72°C for 10 sec, for 30 (ZNFX1), 32 (ITGAM), and 22 (GAPDH) cycles. The PCR products were electrophoresed on 5% acrylamide gels and stained with ethidium bromide. The signal intensities were quantified using a ChemiDoc and ImageLab System.
qPCR analysis of transcripts
cDNAs were amplified using Thunderbird Real time PCR Master Mix (Toyobo Life Science) and 0.3 µM of each primer pair. The primer pairs for amplifying human ZNFX1 and GAPDH transcripts were the same as described above. qPCR was carried out using an Applied Biosystems 7300 Real Time PCR System (Thermo Fisher Scientific, Inc.) (9-11). Amplification was performed initially for 1 min at 95°C, followed by 40 cycles (95°C for 15 sec and 60°C for 30 sec). Relative gene expression values were obtained by normalizing CT (threshold cycle) values of target genes in comparison with CT values of the GAPDH gene using the ΔΔCq method (27).
Surveillance of putative TSS and TF-binding sequences
The putative TSS was identified in 543-bp ZNFX1 promoter region from the NCBI Gene database (https://www.ncbi.nlm.nih.gov/gene/57169). The 543 bp and the 21 bp TPA responsive element were analyzed by JASPAR database (http://jaspar.genereg.net/) with threshold 97.5 and 92%, respectively.
Statistical analysis
All statistical analyses were carried out with Excel software (Microsoft Excel; version 2013; Microsoft Corporation). The experiments were repeated at least three times. All data are presented as the mean ± standard deviation. A Student's t-test was performed to evaluate the significant differences between TPA treated and non-treated experiments. P<0.05 was considered to indicate a statistically significant difference. To compare multiple data sets, one way ANOVA was performed followed by a Tukey's post hoc test (SPSS; version 19; IBM Corp.).
Results
Isolation and characterization of the 5' flanking region of the human ZNFX1 gene
The duplicated GGAA motif containing 14 nucleotide consensus sequences, which are present in the upstream region of several TPA responding genes (13), are also contained within 500 bp from the putative TSSs of several ZNF protein encoding genes (7,8). To examine the response to TPA, we isolated ~500-bp of the 5′upstream regions of the ZC3HAV1, ZNF252, ZNF343, ZNF555, ZNF782 and ZNFX1 genes to construct Luc reporter plasmids. They were transfected into HL-60 cells (Fig. 1A). As the Luc activity from the control vector transfected cells was very low, we used the value just for a subtraction. Notable Luc activity of the pGL4-ZNF343-transfected cells was detected; however, it was not affected by TPA treatment. Therefore, we used it for the reference for the easy, reproducible, cost-effective DEAE dex based multiple transfection assay (28). As the ZNFX1 promoter was significantly activated by TPA treatment compared without treatment, we focused on the regulation of the ZNFX1 gene expression mechanism during the differentiation of the HL 60 cells. Sequence analysis revealed that the pGL4-ZNFX1 contains a nucleotide identical to NCBI Sequence ID, NC_018931.2 (nucleotide from 47799505 47798963) and that it covers the most upstream 5′ end of the cDNA (Sequence ID: NM_021035.2 of the ZNFX1 mRNA; GENE ID: 57169 ZNFX1). Interestingly, this 543-bp region also contains a 5′ upstream end of the ZFAS1 mRNA (NM_021035.2; GENE ID: 441951ZFAS1) in a reverse orientation to that of the ZNFX1 gene (Fig. 1B). The TSS was tentatively set as +1 at the most upstream 5′ end of the ZNFX1 cDNA that is shown in the NCBI Gene database (https://www.ncbi.nlm.nih.gov/gene/57169). Sequence analysis of the 543-bp region with 97.5% relative scores suggested characteristic recognition sequences of several known TFs (Fig. 1B). Although no particular sequences similar to the TATA or CCAAT boxes were present, putative binding sites for E2F1 (-347 to -336 and -111 to -100), E2F4/6 (-347 to -336), EHF (-158 to -150), ETS1 (-208 to -202, -158 to -150, and +101 to +106), KLF5/16 and Sp1/2/4 (257 to 241), SPI1 (-245 to -239, -208 to -202, and -157 to -151), SPIB (-158 to 150), TFAP2A (-292 to -282 and -52 to -41), and ZNF354C (+25 to +30) are contained in the 543-bp region (Fig. 1B).
Effects of TPA on ZNFX1 gene expression and its protein amount in HL-60 cells
To examine whether human ZNFX1 gene expression is upregulated during the macrophage like differentiation of HL-60 cells, total RNAs were extracted after TPA (8.1 nM) treatment. The ZNFX1 gene transcripts were accumulated from 24-48 h of TPA addition (Fig. 2). This was accompanied with the induction of ITGAM expression (Fig. 2A), which encodes the adherent molecule integrin subunit α M/CD11b/Mac1 (29). The relative gene expression of ZNFX1 compared with that of GAPDH was induced after 24 h of TPA addition (Fig. 2B). However, the amount of transcripts decreased in response to longer durations following TPA treatment (Fig. S1). Prior to the upregulation of transcription, the amount of ZNFX1 protein began to increase from 1-24 h after TPA treatment (Fig. 3), suggesting that the post-transcriptional regulation, including translation rate or stability of the ZNFX1 protein, may have been altered following TPA treatment. The accumulation of the ZNFX1 protein occurred prior to that of CD11b, which was significantly induced at 48 h after TPA treatment compared with the other time points following treatment (Fig. S2).
Effects of TPA on ZNFX1 promoter activity
To investigate the molecular mechanism as to how the human ZNFX1 promoter is upregulated by TPA, pGL4-ZNFX1 and its derivative deletion constructs (Fig. 4A) were transiently transfected into HL 60 cells. The relative Luc activity of the pGL4-ZNFX1-transfected cells significantly increased after the addition of TPA (8.1 nM) to the cell culture compared with the corresponding control (Fig. 4A). This induction by TPA was also observed in pGL4-X1-Δ3, Δ4, and Δ5 transfected cells, but not in the pGL4-X1-Δ1 and Δ2 transfected cells. The Luc activities of the pGL4-X1-Δ1 and Δ2 transfected cells were reduced to almost background level, implying that they had lost the essential elements for transcription. In addition, a notable response to TPA was not observed from the pGL4-X1-Δ1 and Δ2 transfected cells, suggesting that the 97 nucleotides from +87 to +183 are primarily required for the positive response to TPA in HL 60 cells.
To examine the TPA responding elements in detail, point mutations were introduced in the pGL4-X1-Δ6 and pGL4-X1-Δ7 plasmids (Fig. 4B). The response to TPA was completely abolished when both GGAA motifs were disrupted (pGL4-X1-Δ6mt12 and pGL4-X1-Δ7mt12), suggesting that the duplicated GGAA motif serves a role in the positive response to TPA. JASPAR analysis with 92% relative scores suggested that putative binding elements for ETS1, MZF1, SPI1, STAT1, and STAT2 proteins are involved in the positive response to TPA (Table II). As expected, the disruption of the duplicated GGAA motif in the pGL4-X1-Δ6mt12 and pGL4-X1-Δ7mt12 constructs excluded the possibilities of the binding of these TFs to the 21 bp element. Taken together, these results suggested that the ZNFX1 promoter is regulated by the duplicated GGAA motif, which is present +50 to +70-bp downstream of the putative TSS, pertaining to the positive response to TPA in differentiating HL-60 cells.
| Table IIPutative transcription factor binding sites in the TPA-responsive 21-bp element in the ZNFX1 promoter. |
Discussion
Although, it might be worth to analyze expression of the selected ZNF family genes, their responses to TPA were not greater than that of ZNFX1. In addition, as epigenetic or post transcriptional regulation could serve a role in the transcription of these genes, expression may not always be associated with promoter activities. Therefore, in this study, the 543 bp region upstream of the human ZNFX1, which is head-head oriented with the ZFAS1 gene, was characterized. IFN treatment is known to affect HL 60 cell differentiation (30). Additionally, duplicated GGAA motifs are frequently found in 5′-flanking regions of the human interferon stimulated genes (ISGs) (9). It should be noted that TPA responding duplicated GGAA motif is present 0.1 kb downstream of the putative TSS of the ZNFX1 that belongs to the ISGs (31). We observed upregulation of the human ZNFX1 gene and protein expression during HL-60 differentiation into macrophage like cells. JASPAR analysis indicated that ETS1, MZF1, SPI1, and STAT1/STAT2 are candidate proteins to bind to the TPA responding as its overexpression was reported to exhibit no effect on TPA-induced monocyte/macrophage differentiation of HL-60 cells (32). Given that STAT1 and ETS family proteins, which co operatively regulate transcription of the CD40 gene in microglia/macrophages (33,34), they may regulate ZNFX1 gene expression. The JAK/STAT signaling pathway serves a role in the TPA inducible expression of 2′-5′-oligoadenylate synthetase 1 (OAS1), which belongs to the ISGs, in HL-60 cells (35). Of note, the OAS1 promoter possesses a duplicated GGAA motif responsive to the ETS family TF E74 like ETS transcription factor 1 in HeLa S3 cells (9). The TPA-responsive 21 bp region harbors similar sequences to the consensus binding motifs for ETS family type III proteins, including SPI1, SPIB, and SPIC, and type I proteins, including ETS1/2 and GABPα (14). GABP α/β protein targets the GGAA motif in the promoter region of mouse RB1, which is regulated during myogenesis (36). Spi1 (PU.1) and SPIB proteins occupy similar regions in the genome, suggesting they co operatively regulate the expression of genes that regulate B cell development (37). An electrophoretic mobility shift assay (EMSA) with antibodies indicated that SPI1 (PU.1) binds to the TPA responding regions of the human poly(ADP ribose) glycohydrolase (38) and eukaryotic translation termination factor 4 (39) gene promoters. Although JASPAR analysis in our study suggested candidate, it has not been shown which TFs bind to the TPA-responding sequence. ZNFX1 expression could be induced by combinations or the expression profiles of the duplicated GGAA-recognizing TFs, which include ETS family proteins and several DNA binding proteins (8). This should be elucidated in future experiments, such as EMSA, Footprint analysis, and chromatin immunoprecipitation assay, along with overexpression/knockdown experiments.
Binding of transcription suppressor ETS2 repressor factor to the GGAA motif is hindered by upregulation of the ETS transcription factor ERG in prostate cancer (40). Occupation or combinations of the GGAA motif binding proteins near TSSs play a role in both positive and negative regulation of cellular differentiation regulator encoding gene expression (8). In other words, if the binding of strong trans-activating TFs were replaced by weak ones after TPA treatment, the GGAA motif could be a suppressive element (8). This may partly explain the reason why the ZC3HAV1, ZNF343, ZNF252, ZNF555 and ZNF782 promoters exhibited marked activation in response to TPA treatment. Alternatively, specific elements near the TSSs could hinder the positive response of the duplicated GGAA motifs. Furthermore, TPA inducible microRNAs (41) should be taken into account for regulation of gene expression.
TPA inducible genes in HL-60 cells have been studied previously (42). The induction profile of the expression of the RB1 gene, with a 5′ flanking region has duplicated GGAA motifs (13), resembles that of the ZNFX1 gene. Although, in this study, RB1 gene expression was not analyzed, it has been reported to be induced at 10 h after TPA treatment (13). The expression of these two genes continued to increase after the TPA treatment for at least for 48 h when almost all cells attach to the culture dish (13). RB1, in association with E2F proteins, regulates the expression of various genes to control cell cycle progression (43,44). Interestingly, the human ZNFX1 and RB1 genes are under the control of bi directional promoters, having ZFAS1 and LINC00441as partner genes, respectively. The expression of the ZFAS1 (ZNFX1-AS1) gene is downregulated in breast tumors (45), and its overexpression inhibits proliferation to induce the apoptosis of cancer cells (46), implying that ZFAS1 serves as a tumor suppressor. ZNFX1 protein expression increased until 40 h after treatment with TPA I our study, suggesting that it plays a role in sustaining the macrophage like state of the HL-60 cells. Certain ZNFs, including zinc finger E-box binding homeobox 1, ZFP36, broad-complex, tramtrack and bric-à-brac-zinc finger, and ectopic virus integration site 1 are known to regulate cell differentiation (5,47-49). Additionally, epigenetic regulation should be considered in this process. In Caenorhabditis elegans, ZNFX1 functions as an RNA helicase that directs transgenerational epigenetic inheritance (50).
A potential cancer therapy with low toxic effect, or differen tiation/apoptosis inducing therapy, has been proposed (51,52). Providing that upregulation of both ZNFX1 and ZFAS1 genes affect the differentiation process, further investigations into the regulation of their expression may contribute to the estab lishment of differentiation inducing gene therapy.
Supplementary Data
Abbreviations:
|
FCS |
fetal calf serum |
|
IFN |
interferon |
|
Luc |
luciferase |
|
RT-qPCR |
reverse transcription-quantitative polymerase chain reaction |
|
TPA |
12-O-tetradecanoylphorbol-13-acetate |
|
TSS |
transcription start site |
Acknowledgments
The authors are grateful to Ms. Sayaka Ishibashi and Ms. Chihiro Katsuda (Department of Gene Regulation, Faculty of Pharmaceutical Sciences, Tokyo University of Science), for their outstanding technical assistance.
Funding
The present study was supported in part by JSPS KAKENHI (grant no. 24510270) and a Research Fellowship from the Research Center for RNA Science, RIST, Tokyo University of Science.
Availability of data and materials
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
Authors' contributions
HH, MY, HO, YK, and KN constructed the Luc reporter plasmids. HH and HO performed experiments and analyzed the data (transfection assay, RT qPCR, western blotting, and statistical analysis). YM performed ANOVA. FU interpreted the data and wrote the manuscript. ST collected and analyzed/interpreted the data. TO and MA interpreted the data and edited the manuscript. All authors have read and approved the final manuscript.
Ethics approval and consent to participate
Not applicable.
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
References
|
Hasegawa A, Kaneko H, Ishihara D, Nakamura M, Watanabe A, Yamamoto M, Trainor CD and Shimizu R: GATA1 binding kinetics on conformation-specific binding sites elicit differential transcriptional regulation. Mol Cell Biol. 36:2151–2167. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Liu Q, Niu N, Wada Y and Liu J: The role of Cdkn1A interacting zinc finger protein 1 (CIZ1) in DNA replication and pathophysi ology. Int J Mol Sci. 17:2122016. View Article : Google Scholar | |
|
Tetreault MP, Weinblatt D, Shaverdashvili K, Yang Y and Katz JP: KLF4 transcriptionally activates non canonical WNT5A to control epithelial stratification. Sci Rep. 6:261302016. View Article : Google Scholar | |
|
Liu Y, Ma D and Ji C: Zinc fingers and homeoboxes family in human diseases. Cancer Gene Ther. 22:223–226. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Prenzler F, Fragasso A, Schmitt A and Munz B: Functional analysis of ZFP36 proteins in keratinocytes. Eur J Cell Biol. 95:277–284. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Uchiumi F, Larsen S and Tanuma S: Transcriptional regulation of the human genes that encode DNA repair and mitochondrial function associated proteins. DNA Repair. Chen C: InTechOpen; London, UK: pp. 129–167. 2015 | |
|
Uchiumi F, Larsen S and Tanuma S: Possible roles of a duplicated GGAA motif as a driver cis element for cancer associated genes. Understand Cancer-research and treatment. iConcept: iConcept Press Ltd.; Hong Kong: pp. 1–25. 2016 | |
|
Uchiumi F, Miyazaki S and Tanuma S: The possible functions of duplicated ets (GGAA) motifs located near transcription start sites of various human genes. Cell Mol Life Sci. 68:2039–2051. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Larsen S, Kawamoto S, Tanuma S and Uchiumi F: The hematopoietic regulator, ELF 1, enhances the transcriptional response to Interferon β of the OAS1 anti viral gene. Sci Rep. 5:174972015. View Article : Google Scholar | |
|
Uchiumi F, Shoji K, Sasaki Y, Sasaki M, Sasaki Y, Oyama T, Sugisawa K and Tanuma S: Characterization of the 5′-flanking region of the human TP53 gene and its response to the natural compound, resveratrol. J Biochem. 159:437–447. 2016. View Article : Google Scholar | |
|
Uchiumi F, Arakawa J, Iwakoshi K, Ishibashi S and Tanuma S: Characterization of the 5′-flanking region of the human DNA helicase B (HELB) gene and its response to trans-Resveratrol. Sci Rep. 6:245102016. View Article : Google Scholar | |
|
Uchiumi F, Arakawa J, Takihara M, Akui M, Ishibashi S and Tanuma S: The effect of trans resveratrol on the expression of the human DNA-repair associated genes. Int Mol Med. 3:783–792. 2016. | |
|
Uchiumi F, Watanabe T and Tanuma S: Characterization of various promoter regions of the human DNA helicase encoding genes and identification of duplicated ets (GGAA) motifs as an essential transcription regulatory element. Exp Cell Res. 316:1523–1534. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Perdomo Sabogal A, Nowick K, Piccini I, Sudbrak R, Lehrach H, Yaspo ML, Warnatz HJ and Querfurth R: Human lineage-specific transcriptional regulation through GA binding protein transcription factor alpha (GABPa). Mol Biol Evol. 33:1231–1244. 2016. View Article : Google Scholar | |
|
Oikawa T and Yamada T: Molecular biology of the Ets family of transcription factors. Gene. 303:11–34. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Hsu T, Trojanowska M and Watson DK: Ets proteins in biological control and cancer. J Cell Biochem. 91:896–903. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Sevinsky JR, Whalen AM and Ahn NG: Extracellular signal-regulated kinase induces the megakaryocyte GPIIb/CD41 gene through MafB/Kreisler. Mol Cell Biol. 24:4534–4545. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Cho HY and Lee SW, Seo SK, Choi IW, Choi I and Lee SW: Interferon sensitive response element (ISRE) is mainly respon sible for IFN-α-induced upregulation of programmed death 1 (PD 1) in macrophages. Biochim Biophys Acta. 1779:811–819. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Champhekar A, Damle SS, Freedman G, Carotta S, Nutt SL and Rothenberg EV: Regulation of early T lineage gene expression and developmental progression by the progenitor cell transcription factor PU.1. Genes Dev. 29:832–848. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Akagi T, Kuure S, Uranishi K, Koide H, Costantini F and Yokota T: ETS related transcription factors ETV4 and ETV5 are involved in proliferation and induction of differentiation-associated genes in embryonic stem (ES) cells. J Biol Chem. 290:22460–22473. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Wang C, Kam RK, Shi W, Xia Y, Chen X, Cao Y, Sun J, Du Y, Lu G, Chen Z, et al: The proto-oncogene transcription factor Ets 1 regulates neural crest development through histone deacetylase 1 to mediate output of bone morphogenetic protein signaling. J Biol Chem. 290:21925–21938. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Kar A and Gutierrez-Hartmann A: Molecular mechanisms of ETS transcription factor mediated tumorigenesis. Crit Rev Biochem Mol Biol. 48:522–543. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Komura S, Semi K, Itakura F, Shibata H, Ohno T, Hotta A, Woltjen K, Yamamoto T, Akiyama H and Yamada Y: An EWS FLI1 induced osteosarcoma model unveiled crucial role of impaired osteogenic differentiation on osteosarcoma development. Stem Cell Reports. 6:592–606. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Dean KC, Huang L, Chen Y, Lu X and Liu Y: An Rb1-dependent amplification loop between Ets1 and Zeb1 is evident in thymo cyte differentiation and invasive lung adenocarcinoma. BMC Mol Biol. 16:82015. View Article : Google Scholar | |
|
Gulick T: Transfection using DEAE-dextran. Curr Protoc Mol Biol. Chapter 20: Unit 20.4. 2003. View Article : Google Scholar | |
|
Katagiri K, Katagiri T, Koyama Y, Morikawa M, Yamamoto T and Yoshida T: Expression of src family genes during monocytic differentiation of HL-60 cells. J Immunol. 146:701–707. 1991.PubMed/NCBI | |
|
Schmittgen TD and Livak KJ: Analyzing real time PCR data by the comparative C(T) method. Nat Protoc. 3:1101–1108. 2008. View Article : Google Scholar | |
|
Uchiumi F, Ohi H and Tanuma S: Application of DEAE-dextran to an efficient gene transfer system. Seikagaku. 86:532–537. 2014.In Japanese. PubMed/NCBI | |
|
White SL, Belov L, Barber N, Hodgkin PD and Christopherson RI: Immunophenotypic changes induced on human HL60 leukemia cells by 1 alpha, 25-dihydroxyvitamin D3 and 12-O-terradecanoyl phorbol 13 acetate. Leuk Res. 29:1141–1151. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Grant S, Bhalla K, Weinstein B, Pestka S, Mileno MD and Fisher PB: Recombinant human interferon sensitizes resistant myeloid leukemic cells to induction of terminal differentiation. Biochem Biophys Res Commun. 130:379–388. 1985. View Article : Google Scholar : PubMed/NCBI | |
|
Forde N, Duffy GB, McGettigan PA, Browne JA, Mehta JP, Kelly AK, Mansouri Attia N, Sandra O, Loftus BJ, Crowe MA, et al: Evidence for an early endometrial response to pregnancy in cattle: Both dependent upon and independent of interferon tau. Physiol Genomics. 44:799–810. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Robertson KA, Hill DP, Kelley MR, Tritt R, Crum B, Van Epps S, Srour E, Rice S and Hromas R: The myeloid zinc finger gene (MZF-1) delays retinoic acid-induced apoptosis and differentiation in myeloid leukemia cells. Leukemia. 12:690–698. 1998. View Article : Google Scholar : PubMed/NCBI | |
|
Fu H, Yang G, Lu F, Wang R, Yao L and Lu Z: Transcription up regulation of restin by all-trans retinoic acid through STAT1 in cancer cell differentiation process. Biochem Biophys Res Commun. 343:1009–1016. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Nguyen VT and Benveniste EN: Involvement of STAT-1 and Ets family members in interferon gamma induction of CD40 transcription in microglia/macrophages. J Biol Chem. 275:23674–23684. 2000. View Article : Google Scholar : PubMed/NCBI | |
|
Cohen S, Dovrat S, Sarid R, Huberman E and Salzberg S: JAK-STAT signaling involved in phorbol 12 myristate 13 acetate and dimethyl sulfoxide induced 2′-5′ oligoadenylate synthetase expression in human HL 60 leukemia cells. Leuk Res. 29:923–931. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Deléhouzée S, Yoshioka T, Sawa C, Sawada J, Ito T, Omori M, Wada T, Yamaguchi Y, Kabe Y and Handa H: GABP, HCF-1 and YY1 are involved in Rb gene expression during myogenesis. Genes Cells. 10:717–731. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Solomon LA, Li SK, Piskorz J, Xu LS and DeKoter RP: Genome wide comparison of PU.1 and Spi-B binding sites in a mouse B lymphoma cell line. BMC Genomics. 16:762015. View Article : Google Scholar | |
|
Uchiumi F, Sakakibara G, Sato J and Tanuma S: Characterization of the promoter region of the human parg gene and its response to PU.1 during differentiation of HL-60 cells. Genes Cells. 13:1229–1247. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Hamada H, Goto Y, Arakawa J, Murayama E, Ogawa Y, Konno M, Oyama T, Asai M, Sato A, Tanuma SI and Uchiumi F: Characterization of the human E2F4 promoter region and its response to 12-O-tetradecanoylphorbol 13 acetate. J Biochem. pii: mvz047. 2019. View Article : Google Scholar : Epub ahead of print. | |
|
Bose R, Karthaus WR, Armenia J, Abida W, Iaquinta PJ, Zhang Z, Wongvipat J, Wasmuth EV, Shah N, Sullivan PS, et al: ERF mutations reveal a balance of ETS factors controlling pros tate oncogenesis. Nature. 546:671–675. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Kasashima K, Nakamura Y and Kozu T: Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells. Biochem Biophys Res Commun. 322:403–410. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Zheng X, Ravatn R, Lin Y, Shih WC, Rabson A, Strair R, Huberman E, Conney A and Chin KV: Gene expression of TPA induced differentiation in HL 60 cells by DNA microarray analysis. Nucleic Acids Res. 30:4489–4499. 2002. View Article : Google Scholar : PubMed/NCBI | |
|
Dick FA and Rubin SM: Molecular mechanisms underlying RB protein function. Nat Rev Mol Cell Biol. 14:297–306. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Bagchi S, Weinmann R and Raychaudhuri P: The retinoblastoma protein copurifies with E2F-1 an E1A-regulated inhibitor of the transcription factor E2F. Cell. 65:106310721991. View Article : Google Scholar : PubMed/NCBI | |
|
Askarian Amiri MN, Crawford J, French JD, Smart CE, Smith MA, Clark MB, Ru K, Mercer TR, Thompson ER, Lakhani SR, et al: SNORD-host RNA Zfas1 is a regulator of mammary development and a potential marker for breast cancer. RNA. 17:878–891. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Wang T, Ma S, Qi X, Tang X, Cui D, Wang Z, Chi J, Li P and Zhai B: Long noncoding RNA ANFX1-AS1 suppresses growth of hepatocellular carcinoma cells by regulating the methylation of miR-9. Onco Targets Ther. 9:5005–5014. 2016. View Article : Google Scholar : | |
|
Chevier A and Corcoran LM: BTB-ZF transcription factors, a growing family of regulators of early and late B-cell develop ment. Immunol Cell Biol. 92:481–488. 2014. View Article : Google Scholar | |
|
Singh S, Howell D, Trivedi N, Kessler K, Ong T, Rosmaninho P, Raposo AA, Robinson G, Roussel MF, Castro DS and Solecki DJ: Zeb1 controls neuron differentiation and germinal zone exit by a mesenchymal epithelial like transition. Elife. 5:pii: e12717. 2016. View Article : Google Scholar | |
|
Glass C, Wilson M, Gonzalez R, Zhang Y and Perkins AS: The role of EVI1 in myeloid malignancies. Blood Cells Mol Dis. 53:67–76. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Wan G, Fields BD, Spracklin G, Shukla A, Phillips CM and Kennedy S: Spatiotemporal regulation of liquid like condensates in epigenetic inheritance. Nature. 557:679–683. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Leszczyniecka M, Roberts T, Dent P, Grant S and Fisher PB: Differentiation therapy of human cancer: Basic science and clinical applications. Pharmacol Ther. 90:105–156. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Luo H, Liu WH, Liang HY, Yan HT, Lin N, Li DY, Wang T and Tang LJ: Differentiation inducing therapeutic effect of Notch inhibition in reversing malignant transformation of liver normal stem cells via MET. Oncotarget. 9:18885–18895. 2018. View Article : Google Scholar : PubMed/NCBI |
