Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular and Clinical Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9450 Online ISSN: 2049-9469
Journal Cover
June-2016 Volume 4 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2016 Volume 4 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Clinical significance of enlarged lateral pelvic lymph nodes before and after preoperative chemoradiotherapy for rectal cancer

  • Authors:
    • Yasuhiro Inoue
    • Susumu Saigusa
    • Junichiro Hiro
    • Yuji Toiyama
    • Toshimitsu Araki
    • Koji Tanaka
    • Yaushiko Mohri
    • Masato Kusunoki
  • View Affiliations / Copyright

    Affiliations: Division of Reparative Medicine, Department of Gastrointestinal and Pediatric Surgery, Institute of Life Sciences, Mie University Graduate School of Medicine, Tsu, Mie 514‑8507, Japan
  • Pages: 994-1002
    |
    Published online on: April 8, 2016
       https://doi.org/10.3892/mco.2016.855
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Preoperative chemoradiotherapy (CRT) with total mesorectal excision (TME) is the widely accepted treatment for rectal cancer (rc) in Western countries. However, there remains controversy as to whether preoperative CRT is useful in tumors that extend beyond the mesorectum, including metastasis to the lateral pelvic lymph nodes (LPLN). The aim of this study was to assess the prognostic significance of LPLN enlargement in patients with RC who receive preoperative CRT followed by TME without LPLN dissection. We evaluated the prognostic effect of radiographic LPLN enlargement before and after CRT, as well as the patients' clinicopathological and genetic profiles. Of the 104 patients investigated, pretreatment imaging identified 19 (18%) as LPLN‑positive (>7 mm in diameter). Of these 19 patients, 7 (37%) exhibited LPLN downsizing to <7 mm following CRT. The median follow‑up period was 52 months. The 5‑year cancer‑specific survival (CSs) or relapse‑free survival (RFS) did not differ significantly between patients who did and those who did not have positive LPLN on pretreatment imaging. However, LPLN that remained positive after CRT were significantly associated with poorer 5‑year CSS (73 vs. 84%, respectively; P=0.0052) and RFS (32 vs. 78%, respectively; P=0.0264). None of the patients whose LPLN were downsized to <7 mm following CRT developed recurrence; however, those with positive LPLN after CRT had a 55% higher recurrence rate, characterized by delayed local recurrence, a pattern that may be affected by certain chemokines. In conclusion, changes in initially positive LPLN (>7 mm) may predict the prognosis of patients with RC who receive preoperative CRT‑TME. LPLN positivity after CRT was associated with shorter CSs and RFS. Strategies to improve patient survival may include selective LPLN dissection or more aggressive multimodality therapy.

Introduction

Recent advances in the treatment of rectal cancer (RC) have reduced local recurrence rates and improved overall survival. Preoperative chemoradiotherapy (CRT) with total mesorectal excision (TME) is the widely accepted treatment for RC in Western countries. However, different treatment strategies have been developed in Japan and Western countries to achieve postoperative local control for advanced RC, particularly for tumors that extend beyond the mesorectum, including metastasis to the lateral pelvic lymph nodes (LPLN). LPLN dissection is often performed with TME in advanced low RC in Japan, as TME does not remove LPLN, which may contain metastasis and lead to local recurrence. The incidence of LPLN metastasis is reportedly 10–20% in patients with advanced low RC who undergo LPLN dissection (1–5). Although a retrospective analysis has suggested that LPLN dissection is equivalent to preoperative CRT in terms of local control for patients with lower RC (6), the effect of preoperative CRT on patients with involved LPLN has not been fully investigated. Recent reports have demonstrated that pretreatment imaging of RC patients using computed tomography (CT) and/or magnetic resonance imaging (MRI) may detect LPLN involvement with a high degree of accuracy (7). Pretreatment imaging of LPLN in RC patients who undergo preoperative CRT reportedly has some clinical significance. Dharmarajan et al evaluated the outcomes of patients whose LPLN enlargement was identified with pretreatment imaging and who were treated with preoperative CRT-TME without LPLN dissection (8), and concluded that clinically enlarged LPLN do not affect prognosis following preoperative CRT-TME in stage III RC patients. However, Akiyoshi et al reported that the incidence of LPLN metastasis is high even after preoperative CRT, and selective LPLN dissection in patients with suspected LPLN metastasis based on pretreatment imaging may improve local disease control and patient survival (9).

Although enlarged LPLN response to preoperative CRT may help guide the selection of lymphadenectomy or active adjuvant chemotherapy for persistently enlarged LPLN, the clinical significance of this response is unclear. The aim of this study was to determine the outcomes of patients whose LPLN were enlarged on pretreatment imaging and who received preoperative CRT-TME without LPLN dissection. We also sought to determine the characteristics of enlarged LPLN following preoperative CRT, and the prognostic significance of enlarged LPLN response to preoperative CRT.

Patients and methods

Patients

Prospectively maintained data of all the patients (n=104) who underwent preoperative CRT for advanced, biopsy-proven RC at the Department of Gastrointestinal Surgery, Mie University Hospital (Tsu, Japan), from January, 2001 to July, 2013 were retrospectively evaluated. The criteria for preoperative CRT were as follows: Patients aged 20–80 years who had cT2-4 or cN+ disease, with an Eastern Cooperative Oncology Group performance status of 0 or 1. Our Institutional Ethics Committee approved the study protocol, and written informed consent was obtained from all the patients who entered the study.

Clinical staging and LPLN evaluation

Pretreatment clinical stage was assessed based on multidetector CT (MDCT) and/or MRI. Tumor location was determined by endoscopy, barium enema and transrectal ultrasound, and LN enlargement was determined by MDCT and/or MRI. All the images were retrospectively reviewed by one colorectal surgeon and two experienced radiologists, who were blinded to the precise clinical information. The maximum long and short axis diameter of the LPLNs were measured before and after the preoperative CRT (i.e., just before rectal surgery), and LPLN positivity was defined as any lymph node sized >7 mm in the long-axis diameter in the lateral pelvic area, according to previous reports (9,10). Reduction of LPLN size following preoperative CRT was defined as initially positive LPLN downsized to <7 mm.

CRT schedules and surgery

Patients with RC were treated with short-course (20 Gy in four fractions, n=58) or long-course (45–50 Gy in 25 fractions, n=46) external irradiation using the 4-field approach. A CT-based treatment planning system was mandatory for defining the planning target volume, including the primary tumor, the surrounding mesorectum and bilateral LPLN, including the internal iliac, obturator, external iliac and common iliac areas, according to the Japanese Society for Cancer of the Colon and Rectum (JSCCR) classification (11). All the patients underwent concurrent 5-fluorouracil (5-FU)-based chemotherapy, including 5-FU/leucovorin, tegafur/uracil and S-1 (12,13). Long-course CRT was mainly used for patients with low-lying tumors and intended sphincter preservation, or tumors close to the circumferential margin. The mean interval between the completion of CRT and TME was 10 days in short-course and 6–8 weeks in long-course CRT. LPLN dissection was not introduced in this study, with the exception of staging biopsy in 1 patient.

Clinical response and tumor regression after CRT

The degree of histopathological tumor regression was defined based on the Guidelines for the Clinical and Pathological Studies on Carcinoma of the Colorectum, and was classified into 4 grades: Grade 0, no necrosis or regressive change; grade 1a, 66% vital residual tumor cells (VRTCs); grade 1b, ~33–66% VRTCs; grade 2, <33% VRTCs; and grade 3, no VRTCs (11). Non-responders were defined as patients with histopathological tumor regression grades 0–1b, and responders as those with grades 2–3.

Molecular analysis of resected specimens

Formalin-fixed paraffin-embedded specimens following CRT were available according to our previous study (14). Quantitative reverse transcription-polymerase chain reaction (RT-PCR) analysis was performed with the SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) using the Applied Biosystems 7500 Real-Time PCR system. Previously reported genes associated with the CRT effects were evaluated in this study (14). The primers for cyclin-dependent kinase inhibitor 1A [CDKN1A (p21Cipl)], vascular endothelial growth factor (VEGF), hypoxia-inducible factor 1 (HIF1), hepatocyte growth factor (HGF), CD133, sex determining region Y-box 2 (SOX2), octamer-binding transcription factor 4 (OCT4), BCL2-associated X protein (BAX), B-cell lymphoma 2 (BCL2), C-X-C motif chemokine 12 (CXCL12), C-X-C chemokine receptor type 4 (CXCR4), and β-actin genes were designed with Primer3 software (Biology Workbench version 3.2, San Diego Supercomputer Center, University of California, San Diego, CA, USA). The primer sequences are listed in Table I. Immunohistochemistry for CXCL12 was also performed in 1 patient who underwent LPL sampling following local recurrence, according to our previous study (15). Monoclonal anti-human CXCL12 antibody (clone 79018; dilution 1:100; cat. no. MAB350; R&D systems, Minneapolis, MN, USA) was used to implement the labeled streptavidin-biotin method (LASB2 kit/HRP, DakoCytomation, Denmark). The tumors were classified as CXCL12-negative if all or most of the cancer cells were unstained (<10% positive cells) and as CXCL12-positive if >10% of the cells were immunostained.

Table I.

Primer sequences of target genes.

Table I.

Primer sequences of target genes.

Gene symbolForwardReverse
CDKN1A (p21Cipl) GACTCTCAGGGTCGAAAAACG GGATTAGGGCTTCCTCTTGG
VEGF CAGAAGGAGGAGGGCAGAA CTCGATTGGAGGCAGTAGC
HIF1 CCGCTGGAGACACAATCATA CTTCCTCAAGTTGCTTTTCA
HGF ATTTGGCCATGTTTTGACC AGCTGCGTCCTTTACCAATG
CD133 GCTTTGCAATCTCCCTGTTG AGCTGCGTCCTTTACCAATG
SOX2 CAAGATGCACAACTCGGAGA GCTTAGCCTCGTCGATGAAC
OcT4 CTGGAGAAGGAGAAGCTGGA CAAATTGCTCGAGTTCTTTCTG
BAX CTTTGCCAGCAAACTGGTG CAGCCCATGATGGTTCTGA
BCL2 TCGCCCTGTGGATGACTGA CAGACAGAGCCAGGTTCTGA
CXCL12 ATGAACGCCAAGGTCGTG ACATGGCTTTCGAAGAATCG
CXCR4 CAGCAGGTAGCAAAGTGACG ATAGTCCCCTGACCCTTT
ACTB ACAGAGCCTCGCCTTTGC GCGGCGATATCATCATC

[i] CDKN1A (p21Cipl), cyclin-dependent kinase inhibitor 1A; VEGF, vascular endothelial growth factor; HIF1, hypoxia-inducible factor 1; HGF, hepatocyte growth factor; SOX2, sex-determining region Y-box 2; OCT4, octamer-binding transcription factor; BAX, BCL2-associated X protein; BCL2, B-cell lymphoma 2; CXCL12, C-X-C motif chemokine 12; CXCR4, C-X-C chemokine receptor type 4; ACTB, β-actin.

Statistical analysis

JMP version 7 software (SAS Institute, Cary, NC, USA) was used for statistical analyses. The data are presented as mean ± standard error. Contingency tables were analyzed using Fisher's exact test or the χ2 test with Yates's correction. Correlations between continuous and categorical variables were evaluated by the Mann-Whitney U test. Survival curves were constructed according to the Kaplan-Meier method and differences were analyzed using the log-rank test. Each significant predictor identified was assessed by multivariate analysis using the Cox's proportional hazards model. P<0.05 was considered to indicate statistically significant differences.

Results

Patient characteristics

Of the 104 patients, 19 (18.3%) had positive LPLN (>7 mm) identified on pretreatment imaging and 85 (81.7%) were LPLN-negative. A comparison of demographic characteristics and treatment details between the LPLN-positive and -negative cases is shown in Table II. The mean distance of the tumors from the anal verge was not significantly different between the two groups. However, cT4 was more common among LPLN-positive (52.6%) than LPLN-negative cases (12.9%); thus, abdominoperineal rectal resection was more frequently applied in the LPLN-positive group. The pretreatment serum carcinoembryonic antigen (CEA) level was significantly higher in the LPLN-positive compared with the LPLN-negative group (63.1 vs. 13.3, respectively; P=0.005), although the two groups did not significantly differ in terms of age, gender, or histological type. The proportion of short- course and long-course CRT also did not differ significantly between the two groups.

Table II.

Patient and tumor characteristics according to enlarged LPLN identified on pretreatment imaging.

Table II.

Patient and tumor characteristics according to enlarged LPLN identified on pretreatment imaging.

CharacteristicsAll patientsLPLN-positiveLPLN-negativeP-value
Patients, n1041985
Age (mean, years)62.461.862.50.78
Gender (male/female)77/2716/361/240.26
Tumor distance (mean, cm)3.93.64.00.52
Clinical UICC stage
  I/II/III/IV11/13/79/10/0/19/011/13/60/10.06
  cT4 (%)21 (20.2)10 (52.6)11 (12.9) <0.0001
  cN metastasis (%)80 (76.9)19 (100)61 (71.8)0.008
Histological differentiation 0.10
  High/moderate931578
  Mucinous/poor1147
Pretreatment CEA (ng/µl)22.463.113.30.005
CRT schedule
  Short-course/long-course58/4610/948/370.47
Adjuvant chemotherapy
  Yes (%)97 (93.3)18 (94.7)78 (91.8)0.35
Surgery
  Yes (%)103 (99.0)18 (94.7)85 (100)0.18
Surgical procedure 0.0001
  LAR28226
  CAA63954
  APR752
  Hartmann's procedure220
  Local excision303
  Intersphincter resection (%)43 (41.7)7 (36.8)36 (42.4)0.66
  APR (%)7 (6.7)5 (26.3)2 (2.4)0.0002
Pathological UICC stage
  0/I/II/III/IV7/24/36/35/20/2/9/8/07/22/27/27/20.27
  pN metastasis (%)35 (33.7)8 (42.1)27 (31.8)0.39
CRM positivity (%)3 (2.9)1 (5.6)2 (2.4)0.46
Pathological effects
  Grade 0/1a/1b/2/31/36/29/31/71/5/5/7/10/31/24/24/60.25
  Grade ≥2 (%)38 (36.5)8 (42.1)30 (35.3)0.58
  pCR (%)7 (6.7)1 (5.2)6 (7.0)0.78
Mesorectal LN harvest8.59.98.20.25
  Positive LNs (mean)1.12.40.80.008
  Negative LNs (mean)7.47.47.40.97
  LN ratio (postitive/harvested)0.120.190.10.19
Interval between CRT and surgery (days), mean35.645.633.80.20

[i] Bold print indicates statistical significance. LPLN, lateral pelvic lymph nodes; UICC, Union for International Cancer Control; CRM, circumferential resection margin; CEA, carcinoembryonic antigen; CRT, chemoradiotherapy; LAR, low anterior resection; CAA, colo-anal anastomosis; APR, abdominoperineal rectal resection; pCR, pathological complete response.

Radiation effects on LPLN-positive status

After preoperative CRT, 7 of the 19 (36.8%) patients with positive LPLN had downsized to <7 mm. The maximum diameter of initially positive LPLN (mean, 15.1 mm; range, 8–45 mm) was significantly reduced after preoperative CRT (mean, 10.9 mm; range, 0–45 mm; P=0.009). Rectal resection was performed in 103 patients, and grade ≥2 response was confirmed in 38 (36.5%) patients. These primary tumor responders were not correlated with LPLN-positive status before and after CRT, but were correlated with a lower rate of pathological mesorectal lymph node (MLN) metastasis (10.5 vs. 47.0%; P=0.0002). Although the CRT effect were not significantly correlated with LPLN-positive status and primary tumor, the LPLN-positive group had significantly more cases of pathological MLN metastasis compared with the LPLN-negative group (2.4 vs. 0.8, respectively; P=0.008). The patient and tumor characteristics according to LPLN-positive status after preoperative CRT are shown in Table III. More MLN metastases were found in the LPLN-positive group after preoperative CRT (3.7 vs. 0.7; P<0.0001) and the LN ratio (positive/harvested LNs) in LPLN-positive patients after CRT (n=12) was significantly higher compared with that in LPLN-negative patients after CRT, although 5 of the 12 (41.2%) patients had no pathological MLN metastasis.

Table III.

Patient and tumor characteristics according to enlarged LPLN after preoperative CRT.

Table III.

Patient and tumor characteristics according to enlarged LPLN after preoperative CRT.

CharacteristicsLPLN-positiveLPLN-negativeP-value
Patients, n1292
Age (mean, years)60.862.60.58
Gender (male/female)10/267/250.43
Tumor distance (mean, cm)3.74.00.71
Clinical UICC stage
  I/II/III/IV0/0/12/011/13/67/10.23
  cT4 (%)8 (66.7)13 (14.1) <0.0001
  cN metastasis (%)12 (100)68 (73.9)0.04
Histological differentiation 0.47
  High/moderate1083
  Mucinous/poor29
Pretreatment CEA (ng/µl)96.313.1 <0.0001
CRT schedule
  Short-course/long-course5/752/400.33
Adjuvant chemotherapy
  Yes (%)11 (91.2)85 (92.4)1.00
Surgery
  Yes (%)11 (91.2)92 (100)0.105
Surgical procedure 0.0001
  LAR028
  CAA458
  APR53
  Hartmann's procedure20
  Local excision03
  Intersphincter resection (%)4 (33.3)39 (42.4)0.55
  APR (%)4 (33.3)3 (3.3) <0.0001
Pathological UICC stage
  0/I/II/III/IV0/0/5/7/07/24/31/28/20.14
  pN metastasis (%)7 (58.3)28 (30.4)0.054
CRM positivity (%)1 (9.0)2 (2.2)0.20
Pathological effects
  Grade 0/1a/1b/2/30/0/5/7/07/24/31/28/20.08
  Grade ≥2 (%)4 (36.4)34 (37.0)0.81
  pCR (%)1 (5.2)6 (7.0)0.78
Mesorectal LN harvest11.88.10.051
  Positive LNs (mean)3.70.7 <0.0001
  Negative LNs (mean)7.77.40.85
  LN ratio (postitive/harvested)0.270.10.03
Interval between CRT and surgery (days), mean45.034.50.34

[i] Bold print indicates statistical significance. LPLN, lateral pelvic lymph nodes; UICC, Union for International Cancer Control; CRM, circumferential resection margin; CEA, carcinoembryonic antigen; CRT, chemoradiotherapy; LAR, low anterior resection; CAA, colo-anal anastomosis; APR, abdominoperineal rectal resection; pCR, pathological complete response.

Oncological outcomes

The median follow-up period was 52.2 months (range, 5.7–154.3 months). Of the 103 patients who underwent primary resection, recurrence developed in 27 patients, including local recurrence in 7 (6.8%) and distant recurrence in 20 (19.4%) patients. The 5-year cancer-specific survival (CSS) and relapse-free survival (RFS) did not differ significantly between patients with and without positive LPLN on pretreatment imaging (82.6 vs. 83.4% and 75.2 vs. 56.6%, respectively). However, LPLN-positive status after CRT was significantly associated with poor 5-year CSS (72.9 vs. 84.8%; P=0.005) and RFS (32.4 vs. 77.1%; P=0.04) (Fig. 1). For the entire cohort, the 3-year cumulative local recurrence rates were 12.5% in the LPLN-positive and 2.8% in the LPLN-negative groups after CRT. The univariate analysis identified cT4, LPLN-positive status after CRT, pMLN metastasis and high serum CEA level as significant predictors of poor CSS. The multivariate analysis demonstrated that pMLN metastasis and cT4, but not enlarged LPLN, were independent prognostic factors for CSS [odds ratio (OR) = 3.72, 95% confidence interval (CI): 1.34–10.31, P=0.01; and OR=3.65, 95% CI: 1.28–10.42, P=0.02, respectively] in patients with RC who received preoperative CRT (Table IV). Also, CRM positivity, cT4 and pMLN metastasis were significant predictors of RFS in the univariate analysis, and pMLN metastasis was an independent prognostic factor for RFS in the multivariate analysis (OR=4.61, 95% CI: 2.00–10.53, P=0.0003) (Table IV). However, the Kaplan-Meier survival analysis revealed significant differences in CSS among the three groups (pN0, pMLN metastasis and LPLN-positive groups) after CRT (P=0.003) (Fig. 2). Interestingly, survival differences between pMLN metastasis and LPLN-positive cases after CRT were confirmed >5 years after surgery, due to delayed recurrence. All 7 patients who exhibited LPLN downsizing to <7 mm after CRT had no recurrence. However, of the 11 patients whose LPLN remained positive after CRT and underwent surgery, 6 (54.5%) developed recurrence. Local recurrence developed in 4 patients at a median of 47 months (range, 23–59 months), whereas distant recurrence developed in 2 patients at a median of 39 months (range, 11–60 months). The sites of local recurrence were 1 to the anterior pelvis at 48 months, 2 to the posterior pelvis at 38.8 and 45.3 months, and 1 LPLN at 58.7 months after surgery.

Figure 1.

Kaplan-Meier survival estimates for (A) cancer-specific survival (CSS) and (B) relapse-free survival (RFS) in the LPLN-positive and LPLN-negative groups after preoperative CRT. LPLN, lateral pelvic lymph nodes; CRT, chemoradiotherapy.

Figure 2.

Kaplan-Meier survival analysis showed significant differences in (A) cancer-specific survival (CSS) and (B) relapse-free survival (RFS) among three groups, namely the pN0, pMLN metastasis and LPLN-positive groups, after CRT. MLN, mesorectal lymph nodes; LPLN, lateral pelvic lymph nodes; CRT, chemoradiotherapy.

Table IV.

Univariate and multivariate analyses of factors considered to affect cancer-specific and relapse-free survival among patients with rectal cancer who received preoperative CRT.

Table IV.

Univariate and multivariate analyses of factors considered to affect cancer-specific and relapse-free survival among patients with rectal cancer who received preoperative CRT.

Univariate analysisMultivariate analysis


VariablesOR95% CIP-valueOR95% CIP-value
CSS
  Age (64> vs. <64 years)1.200.47–3.010.71–––
  CRM positivity (yes vs. no)2.630.34–20.440.36–––
  AV (<5 vs. 5≥ cm)3.5710.82–15.630.09–––
  cT44.391.72–11.240.0023.651.28–10.420.02
  LPLN-positive before CRT2.030.76–5.410.16–––
  LPLN-positive after CRT3.751.40–10.000.0081.730.60–4.980.31
  pMLN metastasis3.451.35–8.850.0013.721.34–10.310.01
  Pathological effect (grade 0–1 vs. 2–3)1.410.53–3.770.49–––
  CEA level (6> vs. <6 ng/µl)5.351.53–18.890.0093.200.86–11.900.08
RFS
  Age (64> vs. <64 years)1.390.64–3.130.40–––
  CRM positivity (yes vs. no)4.861.12–21.120.034.550.87–23.760.07
  AV (<5 vs. 5≥ cm)1.590.60–3.760.38–––
  cT42.531.11–5.750.032.170.87–5.320.10
  LPLN-positive before CRT1.330.53–3.320.54–––
  LPLN-positive after CRT2.460.98–6.170.051.480.57–3.850.42
  pMLN metastasis4.201.89–9.350.00044.612.00–10.530.0003
  Pathological effect (grade 0–1 vs. 2–3)1.910.80–4.50.14–––
  CEA level (6> vs. <6 ng/µl)2.200.97–5.000.06–––

[i] Bold print indicates statistical significance. OR, odds ratio; CI, confidence interval; CSS, cancer-specific survival; CRM, circumferential resection margin; AV, tumor distance from anal verge; LPLN, lateral pelvic lymph node; pMLN, pathological mesorectal lymph node metastasis; CEA, carcinoembryonic antigen; RFS, relapse-free survival.

Molecular characteristics of RC according to the CRT effect on LPLN-positive status

To evaluate the molecular characteristics of RC with LPLN-positive status even after CRT, the expression of genes reportedly associated with CRT were measured using RT-PCR. We observed no significant association between the expression levels of several genes, such as CDKN1A (p21Cipl), VEGF, HIF1, HGF, CD133, SOX2, OCT4, BAX and BCL2 in primary cancer cells and CRT effect on LPLN-positive status (data not shown); however, the mRNA levels of CXCL12 and CXCR4 in RC following CRT were 0.253±0.174 (range, 0–9.03) and 0.292±0.262 (range, 0–13.86), respectively. Patients with consistently positive LPLN status after CRT exhibited a significantly higher expression of the CXCL12 protein in cancer cells (P=0.02) compared with patients with a LPLN-negative status after CRT (Fig. 3).

Figure 3.

Differences in gene expression patterns of CXCL12 (A) and CXCR4 (B) in primary cancer cells according to the response of LPLN-positive status to CRT. CXCL12, C-X-C motif chemokine 12; CXCR4, C-X-C chemokine receptor type 4; LPLN, lateral pelvic lymph nodes; CRT, chemoradiotherapy.

Immunohistochemistry for CXCL12 in primary cancer, MLN and LPLN metastasis following CRT

CXCL12 staining was confirmed in 1 patient from this study, who developed local LPLN recurrence at 58.7 months after surgery. Specifically, immunohistochemical staining for the CXCL12 protein was observed in the cytoplasm of cancer cells in the primary tumor, MLN metastasis and LPLN metastasis specimens harvested for staging biopsy (Fig. 4).

Figure 4.

Immunohistochemical staining for CXCL12 was observed in the cytoplasm of cancer cells in (A) primary cancer, (B) mesorectal lymph node metastasis and (C) lateral pelvic lymph node metastasis in 1 patient from the present study.

Discussion

The incidence of LPLN-positive status (18.3%) in our study was similar to that of pathological LPLN metastasis of previous reports, in which patients underwent surgery alone (1–5). Following preoperative CRT, 7 of the 19 (36.8%) initially LPLN-positive patients exhibited LPLN downsizing to <7 mm; none of these 7 patients developed recurrence. The remaining 12 patients who remained LPLN-positive after preoperative CRT exhibited significantly poorer CSS and RFS compared with the LPLN-negative after CRT group. Previously reported 5-year survival rates of patients who underwent TME with LPLN dissection in the presence of LPLN metastases are ~45% (2,3,16,17), which are inferior to that of our patients with enlarged LPLN after CRT who had TME alone. Although the survival rates of the present study cannot be compared to previously reported rates, a proportion of patients with LPLN metastasis may clearly be treated by CRT-TME alone. However, locally advanced RC with extended LPLN metastasis may not be associated with a good prognosis, even after preoperative CRT or LPLN dissection alone. Therefore, Western investigations have focused on the multidisciplinary management of patients with RC beyond TME planes (18). The National Comprehensive Cancer Network guidelines currently recommend that clinically suspicious nodes beyond the fields of resection should be biopsied or removed if possible (19).

A recent Japanese study demonstrated that 66% of patients undergoing preoperative CRT followed by LPLN dissection had pathological LPLN metastasis, with favorable 3-year local recurrence rates of 7.1% in the TME group and 2.7% in the LPLN dissection group (9). By contrast, Quadros et al reported that metastases to the LPLN indicated unfavorable survival at 50 months (28.6% for LPLN-positive vs. 84.5% for LPLN-negaitive cases) after preoperative CRT followed by LPLN dissection (20). Our study may help elucidate whether the survival rate of the irradiated patients with LPLN metastases would be worse if LPLN dissection was not performed. Our study used the morphological change of LPLN-positive status as a marker for prognosis of patients who underwent CRT-TME. We observed that the presence of clinically positive LPLN does not affect prognosis after TME alone when enlargement improves after CRT; however, the survival of patients who remained LPLN-positive after preoperative CRT was unsatisfactory.

In the present study, survival differences between pMLN metastasis and LPLN-positive status after CRT were confirmed >5 years after surgery, mainly due to delayed local recurrence. In addition, whether residual LPLN metastases promote the spread of cancer cells by amplifying their numbers after such a long time, thus serving as a launch pad for further systemic metastases, remains to be elucidated. As little is known on the underlying molecular mechanisms, several CRT-related genes in primary tumors were compared between LPLN-positive responders and non-responders to CRT. We confirmed that only CXCL12 expression in primary cancer cells was significantly higher in responders compared with that in non-responders, as determined by LPLN shrinkage following preoperative CRT. CXCL12 is a chemokine expressed by both cancer and stromal cells (21,22). Reportedly, CXCL12 and its receptor, CXCR4, play important roles in local progression, dissemination and immune evasion of colorectal cancer cells (23–25). Our recent study also suggested that stromal CXCL12 and CXCR4 expression following preoperative CRT is associated with distant recurrence and poor prognosis in RC (15). Therefore, we hypothesized that our RC patients with positive LPLN after CRT may have oncogenetic potential for cancer progression, resulting in delayed recurrence; thus, more intensive multimodality therapies, pre- as well as postoperatively, may improve survival in the light of these molecular characteristics.

The present study had certain limitations: It was a retrospective study with relatively few patients, and positive LPLN do not necessarily harbor metastases. However, to the best of our knowledge, the present study was the first to investigate the effect of preoperative CRT, including genetic potential, on the LPLN-positive status of patients not undergoing LPLN dissection.

In conclusion, enlarged LPLN identified on pretreatment imaging do not affect CSS or RFS after CRT-TME, except in cases that remain LPLN-positive after preoperative CRT. LPLN downsizing to <7 mm, as determined radiographically, may be a marker for prognosis of patients with RC who undergo CRT-TME, whereas LPLN dissection may be unnecessary when all LPLN become negative (<7 mm) after CRT. Strategies to improve survival in patients with LPLN-positive status after CRT may include selective LPLN dissection or more aggressive multimodality therapies.

References

1 

Ueno M, Oya M, Azekura K, Yamaguchi T and Muto T: Incidence and prognostic significance of lateral lymph node metastasis in patients with advanced low rectal cancer. Br J Surg. 92:756–763. 2005. View Article : Google Scholar : PubMed/NCBI

2 

Sugihara K, Kobayashi H, Kato T, Mori T, Mochizuki H, Kameoka S, Shirouzu K and Muto T: Indication and benefit of pelvic sidewall dissection for rectal cancer. Dis Colon Rectum. 49:1663–1672. 2006. View Article : Google Scholar : PubMed/NCBI

3 

Ueno H, Mochizuki H, Hashiguchi Y, Ishiguro M, Miyoshi M, Kajiwara Y, Sato T, Shimazaki H and Hase K: Potential prognostic benefit of lateral pelvic node dissection for rectal cancer located below the peritoneal reflection. Ann Surg. 245:80–87. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Kobayashi H, Mochizuki H, Kato T, Mori T, Kameoka S, Shirouzu K and Sugihara K: Outcomes of surgery alone for lower rectal cancer with and without pelvic sidewall dissection. Dis Colon Rectum. 52:567–576. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Akiyoshi T, Watanabe T, Miyata S, Kotake K, Muto T and Sugihara K: Japanese Society for Cancer of the Colon and Rectum: Results of a Japanese nationwide multi-institutional study on lateral pelvic lymph node metastasis in low rectal cancer: Is it regional or distant disease? Ann Surg. 255:1129–1134. 2012. View Article : Google Scholar : PubMed/NCBI

6 

Watanabe T, Tsurita G, Muto T, Sawada T, Sunouchi K, Higuchi Y, Komuro Y, Kanazawa T, Iijima T, Miyaki M and Nagawa H: Extended lymphadenectomy and preoperative radiotherapy for lower rectal cancers. Surgery. 132:27–33. 2002. View Article : Google Scholar : PubMed/NCBI

7 

Yano H, Saito Y, Takeshita E, Miyake O and Ishizuka N: Prediction of lateral pelvic node involvement in low rectal cancer by conventional computed tomography. Br J Surg. 94:1014–1019. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Dharmarajan S, Shuai D, Fajardo AD, Birnbaum EH, Hunt SR, Mutch MG, Fleshman JW and Lin AY: Clinically enlarged lateral pelvic lymph nodes do not influence prognosis after neoadjuvant therapy and TME in stage III rectal cancer. J Gastrointest Surg. 15:1368–1374. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Akiyoshi T, Ueno M, Matsueda K, Konishi T, Fujimoto Y, Nagayama S, Fukunaga Y, Unno T, Kano A, Kuroyanagi H, et al: Selective lateral pelvic lymph node dissection in patients with advanced low rectal cancer treated with preoperative chemoradiotherapy based on pretreatment imaging. Ann Surg Oncol. 21:189–196. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Lim SB, Yu CS, Kim CW, Yoon YS, Park SH, Kim TW, Kim JH and Kim JC: Clinical implication of additional selective lateral lymph node excision in patients with locally advanced rectal cancer who underwent preoperative chemoradiotherapy. Int J Colorectal Dis. 28:1667–1674. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Japanese Society for Cancer of the Colon and Rectum: Japanese classification of colorectal carcinoma. (2nd English). (Tokyo). Kanehara & Co. Ltd. 7–10. 2009.

12 

Yoshikawa R, Kusunoki M, Yanagi H, Noda M, Furuyama JI, Yamamura T and Hashimoto-Tamaoki T: Dual antitumor effects of 5-fluorouracil on the cell cycle in colorectal carcinoma cells: A novel target mechanism concept for pharmacokinetic modulating chemotherapy. Cancer Res. 61:1029–1037. 2001.PubMed/NCBI

13 

Inoue Y, Okigami M, Kawamoto A, Okugawa Y, Hiro J, Saigusa S, Toiyama Y, Tanaka K, Mohri Y and Kusunoki M: Phase I study of 5-fluorouracil, leucovorin and bevacizumab in combination with radiation therapy in patients with locally advanced rectal cancer. Mol Clin Oncol. 1:511–516. 2013.PubMed/NCBI

14 

Saigusa S, Tanaka K, Toiyama Y, Matsushita K, Kawamura M, Okugawa Y, Hiro J, Inoue Y, Uchida K, Mohri Y and Kusunoki M: Gene expression profiles of tumor regression grade in locally advanced rectal cancer after neoadjuvant chemoradiotherapy. Oncol Rep. 28:855–861. 2012.PubMed/NCBI

15 

Saigusa S, Toiyama Y, Tanaka K, Yokoe T, Okugawa Y, Kawamoto A, Yasuda H, Inoue Y, Miki C and Kusunoki M: Stromal CXCR4 and CXCL12 expression is associated with distant recurrence and poor prognosis in rectal cancer after chemoradiotherapy. Ann Surg Oncol. 17:2051–2058. 2010. View Article : Google Scholar : PubMed/NCBI

16 

Moriya Y, Sugihara K, Akasu T and Fujita S: Importance of extende lymphadenectomy with lateral node dissection for advanced lower rectal cancer. World J Surg. 21:728–732. 1997. View Article : Google Scholar : PubMed/NCBI

17 

Sugihara K, Moriya Y, Akasu T and Fujita S: Pelvic autonomic nerve preservation for patients with rectal carcinoma. Oncologic and functional outcome. Cancer. 78:1871–1880. 1996. View Article : Google Scholar : PubMed/NCBI

18 

Beyond TME Collaborative: Consensus statement on the multidisciplinary management of patients with recurrent and primary rectal cancer beyond total mesorectal excision planes. Br J Surg. 100:1009–1014. 2013. View Article : Google Scholar : PubMed/NCBI

19 

Benson AB III, Bekaii-Saab T, Chan E, Chen YJ, Choti MA, Cooper HS, Engstrom PF, Enzinger PC, Fakih MG, Fuchs CS, et al: Rectal cancer. J Natl Compr Canc Netw. 10:1528–1564. 2012.PubMed/NCBI

20 

Quadros CA, Falcão MF, Carvalho ME and Ladeia PA: Metastases to retroperitoneal or lateral pelvic lymph nodes indicated unfavorable survival and high pelvic recurrence rates in a cohort of 102 patients with low rectal adenocarcinoma. J Surg Oncol. 106:653–658. 2012. View Article : Google Scholar : PubMed/NCBI

21 

Salvucci O, Yao L, Villalba S, Sajewicz A, Pittaluga S and Tosato G: Regulation of endothelial cell branching morphogenesis by endogenous chemokine stromal-derived factor-1. Blood. 99:2703–2711. 2001. View Article : Google Scholar

22 

Müller A, Homey B, Soto H, Ge N, Catron D, Buchanan ME, McClanahan T, Murphy E, Yuan W, Wagner SN, et al: Involvement of chemokine receptors in breast cancer metastasis. Nature. 410:50–56. 2001. View Article : Google Scholar : PubMed/NCBI

23 

Kim J, Takeuchi H, Lam ST, Turner RR, Wang HJ, Kuo C, Foshag L, Bilchik AJ and Hoon DS: Chemokine receptor CXCR4 expression in colorectal cancer patients increases the risk for recurrence and for poor survival. J Clin Oncol. 23:2744–2753. 2005. View Article : Google Scholar : PubMed/NCBI

24 

Matsusue R, Kubo H, Hisamori S, Okoshi K, Takagi H, Hida K, Nakano K, Itami A, Kawada K, Nagayama S and Sakai Y: Hepatic stellate cells promote liver metastasis of colon cancer cells by the action of SDF-1/CXCR4 axis. Ann Surg Oncol. 16:2645–2653. 2009. View Article : Google Scholar : PubMed/NCBI

25 

Ottaiano A, Franco R, Aiello Talamanca A, Liguori G, Tatangelo F, Delrio P, Nasti G, Barletta E, Facchini G, Daniele B, et al: Overexpression of both CXC chemokine receptor 4 and vascular endothelial growth factor proteins predicts early distant relapse in stage II-III colorectal cancer patients. Clin Cancer Res. 12:2795–2803. 2006. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Inoue Y, Saigusa S, Hiro J, Toiyama Y, Araki T, Tanaka K, Mohri Y and Kusunoki M: Clinical significance of enlarged lateral pelvic lymph nodes before and after preoperative chemoradiotherapy for rectal cancer. Mol Clin Oncol 4: 994-1002, 2016.
APA
Inoue, Y., Saigusa, S., Hiro, J., Toiyama, Y., Araki, T., Tanaka, K. ... Kusunoki, M. (2016). Clinical significance of enlarged lateral pelvic lymph nodes before and after preoperative chemoradiotherapy for rectal cancer. Molecular and Clinical Oncology, 4, 994-1002. https://doi.org/10.3892/mco.2016.855
MLA
Inoue, Y., Saigusa, S., Hiro, J., Toiyama, Y., Araki, T., Tanaka, K., Mohri, Y., Kusunoki, M."Clinical significance of enlarged lateral pelvic lymph nodes before and after preoperative chemoradiotherapy for rectal cancer". Molecular and Clinical Oncology 4.6 (2016): 994-1002.
Chicago
Inoue, Y., Saigusa, S., Hiro, J., Toiyama, Y., Araki, T., Tanaka, K., Mohri, Y., Kusunoki, M."Clinical significance of enlarged lateral pelvic lymph nodes before and after preoperative chemoradiotherapy for rectal cancer". Molecular and Clinical Oncology 4, no. 6 (2016): 994-1002. https://doi.org/10.3892/mco.2016.855
Copy and paste a formatted citation
x
Spandidos Publications style
Inoue Y, Saigusa S, Hiro J, Toiyama Y, Araki T, Tanaka K, Mohri Y and Kusunoki M: Clinical significance of enlarged lateral pelvic lymph nodes before and after preoperative chemoradiotherapy for rectal cancer. Mol Clin Oncol 4: 994-1002, 2016.
APA
Inoue, Y., Saigusa, S., Hiro, J., Toiyama, Y., Araki, T., Tanaka, K. ... Kusunoki, M. (2016). Clinical significance of enlarged lateral pelvic lymph nodes before and after preoperative chemoradiotherapy for rectal cancer. Molecular and Clinical Oncology, 4, 994-1002. https://doi.org/10.3892/mco.2016.855
MLA
Inoue, Y., Saigusa, S., Hiro, J., Toiyama, Y., Araki, T., Tanaka, K., Mohri, Y., Kusunoki, M."Clinical significance of enlarged lateral pelvic lymph nodes before and after preoperative chemoradiotherapy for rectal cancer". Molecular and Clinical Oncology 4.6 (2016): 994-1002.
Chicago
Inoue, Y., Saigusa, S., Hiro, J., Toiyama, Y., Araki, T., Tanaka, K., Mohri, Y., Kusunoki, M."Clinical significance of enlarged lateral pelvic lymph nodes before and after preoperative chemoradiotherapy for rectal cancer". Molecular and Clinical Oncology 4, no. 6 (2016): 994-1002. https://doi.org/10.3892/mco.2016.855
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team