This article is mentioned in:

Introduction

Post-traumatic stress disorder (PTSD) is an anxiety disorder that may develop following exposure to the threat of death or serious injury and may cause affected invididuals to continuously re-experience the traumatic event (1,2) and react with intense fear, helplessness or horror for years. Patients with this disorder persistently re-experience their traumatic events in various ways, including intrusive and disturbing recollections, nightmares, flashbacks and distress and physiological reactivity on exposure to reminders of the event (3). These individuals often avoid reminders of the traumatic event and experience a restricted range of effects.

One of the core neuroendocrine abnormalities related to PTSD is the dysfunction of the hypothalamic-pituitary-adrenal (HPA) axis, characterized by low levels of adrenocorticotropic hormone (ACTH), plasma cortisol and urinary cortisol and enhanced suppression of cortisol in response to low-dose dexamethasone administration (4,5). These neuroendocrine findings specific to PTSD have served as the basis for animal models and are useful for elucidating the pathophysiology of PTSD. Single-prolonged stress (SPS) is a reliable animal model of PTSD based on the time-dependent dysregulation of the HPA axis which has been developed and employed for PTSD studies (6,7). SPS has been shown to induce enhanced inhibition of the HPA axis, which is a putative neuroendocrinological hallmark of PTSD (8). In addition, SPS rats also exhibit behavioral abnormalities (enhanced anxiety) that mimic the symptoms of PTSD. SPS paradigms have been extensively applied in the investigation of PTSD (9).

A convergent body of human and non-human studies suggests that the amygdala mediates the acquisition and expression of conditioned fear and the enhancement of emotional memory (10), whereas the medial prefrontal cortex (mPFC) mediates the extinction of conditioned fear and the volitional regulation of negative emotion (11). It has been theorized that the mPFC exerts an inhibitory effect on the amygdala and that a defect in this inhibition could account for the symptoms of PTSD (12). A study of brain-injured and trauma-exposed combat veterans confirmed that amygdala damage reduces the likelihood of developing PTSD (13). However, contrary to the prediction of the top-down inhibition model, mPFC damage also reduces the likelihood of developing PTSD. The mPFC contributes significantly to the modulation of memory consolidation with the storage of emotionally relevant information and is critical for the formation of long-term aversive memory, particularly for the modulation of anxiety, fear and aggression (14). In addition, the mPFC may inhibit the effect of the amygdala following SPS in PTSD rats and may also be related to impaired fear extinction. It has been confirmed by computed tomography and functional magnetic resonance imaging that the mPFC of patients with PTSD are notably smaller than normal.

Calcium (Ca2+) is an influential intracellular secondary messenger. Elevated Ca2+ binds to numerous proteins, including low-affinity/high-capacity buffer proteins. The influx of Ca2+ ions results in calmodulin (CaM) activation. A number of Ca2+/CaM targets modulate cellular signaling pathways. CaM kinase II (CaMKII) is a major mediator of calcium signaling and is of particular importance in the brain, contributing significantly to the regulation of nerve functions (15,16).

In this study, our team briefly examined the changes in Ca2+-CaM-CaMKIIα levels in the mPFC in order to ascertain how Ca2+-CaM-CaMKIIα cascades participate in PTSD.

Materials and methods

Animal model preparation and grouping

A total of 21 male Wistar rats were randomly divided into a control and SPS groups of 1 (1-day) and 7 days (7-day). The control rats remained in their home cages with no handling for 7 days and were sacrificed at the same time as the SPS groups. The SPS rats underwent the SPS procedure on the first day. The SPS protocol (7,9) consisted of: a 2-h immobilization (compression with plastic bags), a 20-min forced swim (25°C), and a 15-min rest, followed by ether anesthesia (until loss of consciousness). Following SPS, the rats were fed routinely. The study was approved by the ethics committee of China Medical University.

Intracellular free calcium in mPFC cells

Rats of the control and SPS groups were decapitated rapidly and the brains were removed and immediately placed in a dish standing on crushed ice. The mPFC was then dissected out according to the atlas of rats (17), snap-frozen in liquid nitrogen and prepared for cell suspension using a routine method. Furthermore, the cell suspension was loaded with 1 mmol/l fura-2-acetoxymethyl ester (Fura-2/AM) (Beyotime Institute of Biotechnology, Haimen, China) for 35 min and then detected with a spectrofluorometer.

Immunohistochemistry

Rats of the control and SPS groups were prepared by left ventricle perfusion fixation (18) with 4% buffered paraformaldehyde and the mPFCs were post-fixed in the same fixative at 4°C for 24 h and then embedded in paraffin. Paraffin sections (5-μm) were prepared for the morphological studies. The mPFC sections were treated with 5% bovine serum albumin (BSA) and 0.3% Triton X-100 in PBS for 30 min at room temperature for blocking of non-specific staining, followed by incubation with mouse monoclonal antibody against CaM (Sigma, St. Louis, MO, USA; 1:100) or CaMKIIα (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA; 1:200) overnight at 4°C. Following incubation with goat anti-mouse IgG (Boster, Wuhan, China; 1:100) for 2 h, sections were treated with the streptomycin-avidin-biotin-peroxidase complex (SABC) for 1 h at room temperature. Moreover, they were washed three times with PBS following each incubation and subsequently incubated with 3,3′-diaminobenzidine (DAB) and H2O2. In order to assess non-specific staining, a few sections in every experiment were processed with the omission of the antibody.

Western blotting

Fresh mPFC of the control and SPS rats were respectively homogenized with sample buffer containing 200 mM TBS, pH 7.5, 4% sodium dodecyl sulfate (SDS), 20% glycerol and 10% 2-mercaptoethanol and were denatured by boiling for 3 min. The protein fraction (30 μg/lane) extracted from each sample was separated by 12% (w/v) gradient SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to a PVDF membrane (Millipore, Bedford, MA, USA). After blocking with 5% dried skimmed milk in 0.05% Tween-20-containing TBST at room temperature for 2 h and incubating with a primary antibody comprising a mouse monoclonal antibody against CaM (1:1,000) or CaMKIIα (1:5,000) overnight at 4°C, respectively, the membrane was incubated with anti-mouse IgG-HRP (Santa Cruz Biotechnology, Inc.; 1:5000) secondary antibodies for another 2 h at room temperature. Finally, the PVDF membrane was washed three times with TBST prior to visualization using enhanced chemiluminescence (ECL; Amersham Pharmacia Biotech, Buckinghamshire, UK).

Reverse transcription-polymerase chain reaction

The total mRNA from the mPFC was extracted using the TRIzol kit according to the manufacturer’s instructions. The forward and reverse sequences of the primers (synthesized by Shenggong Biotech Co., Shanghai, China) were according to the serial numbers from GenBank and are listed in Table I(19). The cycling reaction for CaM was as follows: 94°C for 4 min, followed by amplification for 32 cycles of 30 sec at 94°C, 30 sec at 58°C and 40 sec at 72°C and a final 7-min extension at 72°C. For CaMKIIα, the reaction was started at 95°C for 2 min, followed by amplification for 33 cycles of 30 sec at 95°C, 30 sec at 55°C and 40 sec at 72°C and a final 5-min extension at 95°C. β-actin mRNA used as an internal control was co-amplified with CaM and CaMKIIα. The products were observed following electrophoresis on a 1.2% agarose gel and the density of each band was analyzed on the Gel Image Analysis System. The levels of CaM and CaMKIIα mRNA were determined by calculating the density ratios of CaM mRNA/β-actin mRNA and CaMKIIα mRNA/β-actin mRNA.

Table I Primer sequences for CaM and CaMKIIα.

Table I

Primer sequences for CaM and CaMKIIα.

Name	Upstream primer (5′-3′)	Downstream primer (5′-3′)	Product size (bp)
CaM	ggcatcctgctt tagcctgag	acatgctatccc tctcgtgtga	328
CaMKIIα	catcctcaccactatgctg	atcgatgaaagtccaggccg	284
β-actin	atcacccacactgtgcccatc	acagagtacttgcgctcagga	542

[i] CaM, calmodulin; CaMKIIα, CaM kinase IIα.

Statistical analysis

All data were expressed as the mean ± standard deviation (SD). Data analysis among groups was performed using one-way analysis of variance (ANOVA) with SPSS 13.0 software. P<0.05 was considered to indicate a statistically significant difference.

Results

Free Ca2+ concentration in mPFC

The intracellular free Ca2+ levels in the mPFC neurons were notably higher than in the control group 1 day after SPS and had returned to normal levels 7 days after SPS (Fig. 1).

Figure 1 Changes of intracellular calcium (Ca2+) levels (nmol/l) (mean ± SD). *P<0.05 vs. the control group, #P<0.05 vs. the single-prolonged stress (SPS) 1-day group.

Immunohistochemical observation of CaM and CaMKIIα

Our team observed the CaM and CaMKIIα levels in the mPFC of the control and SPS rats. The sites of expression of CaM and CaMKIIα were distributed mainly in the cytoplasm and appeared as buffy particles (Fig. 2A and D). In SPS rats, increased CaM levels were observed; the highest expression levels were identified 1 day after SPS stimulation (Fig. 2B and C); by contrast, decreased CaMKIIα levels were observed (Fig. 2E and F).

Figure 2 Expression of calmodulin (CaM) and CaM kinase IIα (CaMKIIα) in the medial prefrontal cortex (mPFC) in each group (A-F, magnification ×400). The quantity of CaM-immunoreactive cells in (B) the 1-day single-prolonged stress (SPS) rats exceeds that of (A) the control and (C) 7-day SPS rats. The quantity of CaMKIIα-immunoreactive cells in (E) the 1-day SPS rats was less than that in (D) the control and (F) 7-day SPS rats.

Western blotting of CaM and CaMKIIα

The CaM, CaMKIIα and β-actin immunoreactive signals appeared at 16.7, 50 and 42 kDa, respectively (data not shown), and the band density mean value of the control group was set as 100%. Data were expressed as normalized optical density.

In the SPS group, the expression of CaM protein in the mPFC was highest on day 1 and was downregulated a little on day 7, but remained higher than the control. Significantly lower protein expression of CaMKIIα was identified in the SPS group compared with the control on days 1 and 7 (Fig. 3).

Figure 3 (A) Protein expression levels and (B) quantitative analysis result of calmodulin (CaM) and CaM kinase IIα (CaMKIIα) in the medial prefrontal cortex (mPFC) of the control and single-prolonged stress (SPS) rats by western blotting. Increased CaM and decreased CaMKIIα expression levels were observed in the SPS rats compared with the control. *P<0.05 vs. the control group, #P<0.05 vs. the 1-day SPS group

mRNA expression of CaM and CaMKIIα

The mRNA levels of CaM and CaMKIIα were normalized to the β-actin mRNA level. The mRNA expression levels of CaM significantly increased in the mPFC of the SPS group compared with the control rats. However, the mRNA expression levels of CaMKIIα markedly decreased in the SPS group rats (Fig. 4).

Figure 4 (A) Expression levels of and (B) quantitative analysis results for the mRNA of calmodulin (CaM) and CaM kinase IIα (CaMKIIα) in the medial prefrontal cortex (mPFC) in control and single-prolonged stress (SPS) rats. Increased CaM and decreased CaMKIIα expression levels were observed in the SPS rats compared with the control. *P<0.05 vs. the control group, #P<0.05 vs. the 1-day SPS group.

Discussion

Over the past decade, basic animal research and human neuroimaging studies have begun to outline the specific neural circuitry dedicated to emotional functioning (20). These studies have partially inspired hypotheses with regard to the dysfunction in this circuitry that leads to the development and maintenance of PTSD. While they have provided useful initial information and guided the initial functional neuroanatomical and neurophysiological studies into PTSD, it is becoming increasingly clear that the scope of these studies does not fully capture the complexity of the changes occurring during trauma exposure and PTSD development.

Evidence that the mPFC is involved in a neural mechanism that modulates a differential susceptibility of multiple memory systems to emotional arousal during acquisition, memory consolidation (21) and/or memory retrieval, may provide a novel approach to elucidating the range of mnemonic dysfunctions in PTSD.

The mPFC is significantly involved in emotional adjustment. The function of emotional adjustment was induced in PTSD. With the extension of the SPS stimulation time, an increasing number of neurons of the mPFC of rats became smaller (22) and the outline of the small neurons was indistinct. In the future, this finding may help scientists to understand how brain damage is likely to affect thought, action and the ability to reflect.

The volitional control of negative emotion is another affective function that is germane to PTSD and one in which the mPFC and amygdala again are significant (23). That is, during emotional regulation, an increase in the activity of the mPFC is associated with a decrease in the activity of the amygdala as well as with the experience of negative effects. Furthermore, this normative mPFC-amygdala inverse coupling during emotional regulation is disrupted in patients with major depressive disorder, which is characterized by pathologically high levels of negative effects.

The special role of the mPFC in the processing of threat-related stimuli, particularly anger and fear, is well documented (24). Abundant evidence from animal and human investigations strongly suggests that the mPFC is responsible for the enhancement of explicit memory associated with emotional arousal (25,26). In addition, numerous lines of evidence have implicated the mPFC as a substrate for the stress-related modulation of memory.

CaM, as a ubiquitous Ca2+ sensor protein, is involved in almost all intracellular events. CaMKIIα is the molecular basis of learning and memory (27), but in the absence of bound Ca2+/CAM, CaMKII is in an inactive conformation. The influx of Ca2+ results in CaMKII activation. Ca2+/CaMKII is a major mediator of Ca2+ signaling and is of particular importance in the brain, contributing significantly to the regulation of nerve functions, including learning and memory (28). It is speculated that CaMKIIα responds to a strong and/or repeated stimulus in which the cellular Ca2+ concentration is relatively high. CaMKIIα is highly effective in synaptic plasticity and is considered as one of the best candidates for a memory molecule (29).

In this study, the detection of free Ca2+ in the mPFC neurons revealed Ca2+ overload 1 day after SPS stimulation. Further analysis of CaM, the main Ca2+-conjugated protein in the CNS, revealed that the expression of total CaM in the mPFC markedly increased 1 day after SPS stimulation, suggesting that the CaM content changed synchronously with changes in the Ca2+ concentration. This occurred as a result of the SPS increasing the intracellular free Ca2+ levels in the mPFC neurons and thereby inducing the overexpression of CaM. The change in CaMKIIα from inactive to active led to a decreased content of CaMKIIα in the mPFC following SPS exposure. Due to the importance of the Ca2+-CaM-CaMKIIα signaling pathway in the plasticity of the central nervous system, learning and memory, mind, behavior and other types of cognitive activities (30), the dysfunction of the Ca2+-CaM-CaMKIIα pathway of the mPFC might be the pathobiological basis for the abnormality of affect and behavior induced by PTSD.

To date, the pathogenesis of PTSD has not been entirely clarified. PTSD may result in a series of biochemical and physiological abnormalities in the brain, which lead to dysfunction of the mPFC. Thus, the pathogenesis of PTSD requires further study.

In conclusion, the SPS rats exhibit behavioral abnormalities that mimic the symptoms of PTSD. The dysfunction of Ca2+-CaM-CaMKIIα in the SPS rats decreases the inhibition of the amygdala, which might be the pathobiological basis of the abnormality of affect and behavior induced by PTSD.

Acknowledgements

The authors would like to thank all staff members of the China Medical University Experiment Center for their technical support. In addition, this study was supported by a grant from the National Natural Science Foundation of China (no. 81171282).

References