This article is mentioned in:

Introduction

As one class of newly identified regulatory molecules, miRNAs are important in numerous critical cell processes, including cell proliferation, differentiation and apoptosis (1–3). It has been found that ~30% of the mammalian genome is regulated by these short endogenous RNAs. As for their functions, it is widely recognized that microRNAs (miRNAs) are able to integrate with specific target mRNAs, forming close complementary structures and resulting in either mRNA degradation or inhibition of protein translation (4). In addition, miRNAs alter gene expression mainly through their effects on the methylation of genes or by the targeting of transcription factors significant to cell physiology (5,6).

Over the last several years, studies have demonstrated that these tiny regulators are able to tune organ development (7). However, few of those involved the physiological or pathological mechanisms of the lungs, particularly in mammalian fetal lung development, have been identified. The lung has a specific stable miRNA expression profile, which is conserved across mammalian species (8,9). Therefore, in theory it is comparable among different species. However, over the past several years, the number of expression profile studies on fetal development in mammals has been relatively small and these studies have been mostly confined to a few miRNAs, including the Let-7 family (10,11) and the miRNA-17-92 cluster (12,13). However, with the improvement of chip technology and the deepening understanding of the developmental mechanism, we are able to identify more of the significant miRNAs involved in fetal lung development using the latest microarrays. Therefore, in the present study, we used the miRCURY LNA™ microRNA Array (v.16.0) (containing >1891 probes) to determine expression profiles for fetal lung development at three key time points to identify new miRNAs. We then selected certain miRNAs for further study in order to attempt to clarify the possible mechanism involved.

Materials and methods

Rats

Healthy adult Sprague-Dawley rats (12 female and 12 male) were maintained in a specific-pathogen-free animal facility at the Animal Center of Nanjing Medical University. In this study, 3 time points (gestational days 16, 19 and 21) representing 3 stages of fetal lung development were selected. The 3 time points were designated as groups S1 (E21), S2 (E19) and S3 (E16). For each group, 4 pregnant rats were selected according to the random contrast rule.

The pregnant rats were sacrificed with CO2 and whole fetal lungs were immediately isolated from the fetuses. The superfluous extraneous tissues were then removed as thoroughly as possible. The procedures in this study followed the protocols approved by the Nanjing Medical University Animal Care and Use Committee.

Following isolation, a randomly selected fetal lung was retained for histological observation. Subsequently, the total RNA of the remaining lungs was isolated using TRIzol (Invitrogen Life Technologies, Carlsbad, CA, USA) and the miRNeasy mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. RNA quality and quantity were measured using a NanoDrop spectrophotometer (ND-1000, Nanodrop Technologies, Wilmington, DE, USA) and RNA integrity was evaluated by gel electrophoresis.

Histology

The lung tissues of the 3 groups were fixed with 4% paraformaldehyde solution, embedded in paraffin and cut into 4 μm continuous sections. The sections were stained with hematoxylin and eosin (H&E) for subsequent morphological observation. H&E sections were then viewed by optical microscopy at ×40 magnification to observe the structural changes of the fetal lungs in the 3 groups (S1, S2 and S3).

miRNA microarray

Following the isolation of the RNA from the fetal lungs, the miRCURY Hy3™/Hy5™ Power labeling kit (Exiqon, Vedbaek, Denmark) was used according to the manufacturer’s guidelines for miRNA labeling. Each sample (1 μg) was 3′-end-labeled with a Hy3™ fluorescent label using T4 RNA ligase by the following steps. RNA in 2.0 μl water was combined with 1.0 μl CIP buffer and CIP (Exiqon). The mixture was incubated for 30 min at 37°C and then the reaction was terminated by incubation at 95°C for 5 min. Then 3.0 μl labeling buffer, 1.5 μl fluorescent label (Hy3™), 2.0 μl DMSO and 2.0 μl labeling enzyme were added to the mixture. The labeling reaction was incubated for 1 h at 16°C and the reaction was terminated by incubation at 65°C for 15 min.

The Hy3™-labeled miRNA samples were hybridized using the miRCURY LNA™ microRNA array system (v.16.0) (Exiqon) according to the array manual. The total 25 μl mixture of Hy3™-labeled samples in 25 μl hybridization buffer was denatured for 2 min at 95°C, incubated on ice for 2 min and then hybridized to the microarray for 16–20 h at 56°C in the 12-Bay hybridization system (Nimblegen Systems, Inc., Madison, WI, USA), which provides an active mixing action and constant incubation temperature to improve hybridization uniformity and enhance the signals. Following hybridization, the slides were washed several times using a wash buffer kit (Exiqon) and dried by centrifugation for 5 min at 400 rpm. The slides were scanned using the Axon GenePix 4000B microarray scanner (Axon Instruments, Foster City, CA, USA).

The scanned images were imported into GenePix Pro 6.0 software (Axon Instruments) for grid alignment and data extraction. Replicated miRNAs were averaged and miRNAs that had intensities >50 in all samples were selected for calculation of the normalization factor. The expressed data were normalized by median normalization. Following normalization, the differentially expressed miRNAs were identified through fold-change filtering (fold change ≥1.0).

Scatter-plots and correlation coefficient matrices which were visualizations used to assess the variation (or reproducibility) between chips were prepared (Fig. 1 and Table I). The axes of the scatter-plot are the normalized signal values of the samples (ratio scale).

Figure 1 Scatter-plots were performed to assess the variation (or reproducibility) among the chips of the 3 groups (S1, S2 and S3). Axes of the scatter-plot are the normalized signal values of the samples (ratio scale).

Table I Correlation coefficient matrix among 3 microarrays (groups S1, S2 and S3).

Table I

Correlation coefficient matrix among 3 microarrays (groups S1, S2 and S3).

Group	S1	S2	S3
S1	1.0000	0.7084	0.5440
S2	0.7084	1.0000	0.8600
S3	0.5440	0.8600	1.0000

Quantitative real-time PCR

Total RNA was isolated from fetal lungs using the TRIzol reagent. Single-strand cDNA was synthesized using a reverse transcription mixture that contained 1 μg total RNA, 0.3 μl rno-miRNA reverse primer (1 μM) (Table II), 0.1 μl MMLV revertase (200 U/μl; Epicentre, Madison, WI, USA), 2 μl 10× RT buffer, 2 μl dNTP mix (2.5 mM each) and 0.3 μl ribonuclease inhibitor (40 U/μl) in a 20 μl total volume. The reaction was performed at 16°C for 30 min and at 42°C for 40 min, followed by heat inactivation at 85°C for 5 min. For real-time PCR, 1 μl cDNA was added to 24 μl master mix containing 2.5 μl dNTP (2.5 mM each), 2.5 μl 10× PCR buffer (Promega, Madison, WI, USA), 1 unit Taq polymerase (Promega), final concentration 0.25× SYBR-Green I (Invitrogen) and 2 μl reverse and forward primers. cDNA was then amplified for 35 cycles using the Applied Rotor-Gene 3000 (Corbett Research, Sydney, Australia) real-time PCR system. The primer sequences used are listed in Table III. RT and PCR for U6 snRNA were performed in each plate as an endogenous control. The amount of PCR product was calculated from the threshold cycle (Ct). In addition, the comparative CT method was used, and the relative amount of miRNA to U6 snRNA was calculated with the equation 2−(Ct microRNA - Ct U6).

Table II RT primer sequences.

Table II

RT primer sequences.

Gene	RT primers (5′-3′)
U6	CGCTTCACGAATTTGCGTGTCAT
rno-miR-126*	GTCGTATCCAGTGCGTGTCGTGGA GTCGGCAATTGCACTGGATACGAC CGCGTA

Table III Primers for real-time RT-PCR.

Table III

Primers for real-time RT-PCR.

Gene	Primers (5′-3′)	T (°C)
U6	F: GCTTCGGCAGCAC
	ATATACTAAAAT
	R: CGCTTCACGAAT	60
	TTGCGTGTCAT
rno-miR-126*	GSP: GGGCATTAT
	TACTTTTGG
	R: TGCGTGTC	60
	GTGGAGTC

Statistical analysis

Data were analyzed using the SPSS 13.0 statistical package and EXCEL 2003. The real-time PCR data were evaluated by one-way ANOVA. P<0.05 was considered to indicate a statistically significant result.

Results

Histology

In group S3 (E16), the epithelial cells had differentiated into original acinar-like structures. The structure of the interstitial tissue was extremely dense (Fig. 2A), while in group S2 (E19), the acinus cavities had expanded rapidly. The interstitium was arranged in cords and appeared to be thinner than in E16 (Fig. 2B); in group S1 (E21), more mature alveolars emerged and were arranged around the bronchioles. The interstitium was sparser than in the previous groups (Fig. 2C).

Figure 2 Observation of fetal lung tissue in 3 groups: (A) S1 (E21), (B) S2 (E19) and (C) S3 (E16) under an optical microscope; magnification, ×40. The tissue was stained with hematoxylin and eosin (H&E).

miRNA expression profile

The 6th generation miRCURY LNA™ microRNA array (v.16.0) that we used covers all mouse, rat, human and virus genomes. As a result, 202 differentially expressed miRNAs from the 3 groups (S1, S2 and S3) passed the fold-change filtering (fold change ≥1.0), including 4 different types of expression patterns (S2/S3 ↑or↓ and S1/S2 ↑or↓) (Table IV).

Table IV All differentially expressed miRNAs among the 3 groups (S1, S2 and S3), including 4 expression patterns (S2/S3 ↑or↓ and S1/S2 ↑or↓).

Table IV

All differentially expressed miRNAs among the 3 groups (S1, S2 and S3), including 4 expression patterns (S2/S3 ↑or↓ and S1/S2 ↑or↓).

S3-S2↑, S2-S1↑ (S2/S3>1 and S1/S2>1)a			S3-S2↓, S2-S1↓ (S2/S3<1 and S1/S2<1)a			S3-S2↑, S2-S1↓ (S2/S3>1 and S1/S2>1)a			S3-S2↓, S2-S1↑ (S2/S3<1 and S1/S2<1)a
Name	Fold changes		Name	Fold changes		Name	Fold changes		Name	Fold changes
rno-miR-3560	8.4211415	4.888905	rno-miR-186*	0.980325	0.68844749	rno-miR-195	13.549629	0.9854888	rno-miR-let-7b	0.99745790	1.470588872
rno-miR-126*	7.5239524	1.511816	rno-miR-466c*	0.977220	0.87722704	rno-miR-34a	12.426133	0.6040662	rno-miR-466b-1*	0.99315310	1.732802323
rno-miR-672*	5.2601791	1.175347	rno-miR-19a	0.971818	0.62082771	rno-miR-347	10.659673	0.6544392	rno-miR-107	0.95708310	1.453658569
rno-miR-146b	5.0163166	3.094662	rno-miR-25	0.963684	0.57179299	rno-miR-503*	7.3622807	0.2163902	rno-miR-291a-5p	0.94483460	1.724463405
rno-miR-34c	4.5061344	1.957254	rno-miR-144	0.951005	0.64339048	rno-miR-495	6.0282288	0.3506531	rno-miR-3572	0.93592810	1.020299247
rno-miR-653*	3.4649380	1.764355	rno-miR-329	0.923679	0.93020848	rno-miR-10a-3p	4.0970221	0.0661559	rno-miR-883*	0.92618030	2.217677800
rno-miR-411*	3.3178232	1.590243	rno-miR-331	0.903534	0.02509753	rno-miR-30c-1*	3.8809911	0.5900630	rno-miR-466b-2*	0.92215430	1.223710712
rno-miR-let-7a	3.1785206	2.289511	rno-miR-19b	0.900471	0.72076563	rno-miR-24-2*	3.8646984	0.9495285	rno-miR-375	0.91535550	1.059154957
rno-miR-let-7d	2.9136439	1.452478	rno-miR-151*	0.892133	0.39417882	rno-miR-339-5p	3.1913082	0.3121446	rno-miR-466c	0.89813410	1.398870274
rno-miR-26b	1.9370148	1.723152	rno-miR-451	0.878429	0.25339903	rno-miR-379	3.1248495	0.4766527	rno-miR-770*	0.89243770	1.651569420
rno-miR-874	1.8857111	2.413461	rno-miR-21*	0.874866	0.65841255	rno-miR-672	3.0738620	0.9356720	rno-miR-200c	0.87946140	1.146764503
rno-miR-1188-3p	1.7935323	2.298813	rno-miR-7a-2*	0.852774	0.38291656	rno-miR-376-3p	3.0653762	0.3206239	rno-miR-300-5p	0.87661250	1.733430021
rno-miR-23a	1.7799642	1.206440	rno-miR-652	0.846386	0.71646338	rno-miR-136*	2.8064011	0.7382026	rno-miR-325-3p	0.86575560	1.913369777
rno-miR-329*	1.7775597	1.262534	rno-miR-186	0.822947	0.05419442	rno-miR-127*	2.7881470	0.8166521	rno-miR-3573-3p	0.85555160	2.199396790
rno-miR-30d	1.7484931	3.044324	rno-miR-106b	0.817602	0.50922622	rno-miR-322	2.7181080	0.5153748	rno-miR-210	0.85130860	1.444849465
rno-miR-138-2*	1.7377907	1.740641	rno-miR-204*	0.797339	0.5891234	rno-miR-409-5p	2.7004505	0.2778741	rno-miR-30a	0.83405280	4.448185340
rno-miR-30b-5p	1.7229757	1.254918	rno-miR-20a	0.790606	0.33531233	rno-miR-16	2.4124438	0.5187975	rno-miR-30e*	0.82078630	1.911407722
rno-miR-26a	1.7208078	3.452369	rno-miR-99a	0.785670	0.28761068	rno-miR-194*	2.3146718	0.0961872	rno-miR-433*	0.78441850	1.462433489
rno-miR-let-7c	1.6864176	1.272732	rno-miR-345-5p	0.732098	0.79662712	rno-miR-15b	2.2900781	0.2570223	rno-miR-30c	0.78415490	1.641928548
rno-miR-743b	1.6569246	1.746423	rno-miR-106b*	0.721485	0.86241946	rno-miR-365	2.1816797	0.2143063	rno-miR-200a	0.77613210	1.728426011
rno-miR-352	1.6529537	2.337057	rno-miR-23b	0.712766	0.97392883	rno-miR-185	2.1641823	0.1573393	rno-miR-344b-2-3p	0.77200260	1.214345429
rno-miR-539*	1.6424152	2.621551	rno-miR-674-5p	0.695417	0.80928285	rno-miR-98	2.1485470	0.8302507	rno-miR-3596c	0.73287290	1.961526568
rno-miR-136	1.6394235	2.305536	rno-miR-431	0.690826	0.29360741	rno-miR-328a	2.0544097	0.0597691	rno-miR-551b*	0.70730060	4.873483536
rno-miR-138-1*	1.4810756	1.463674	rno-miR-152	0.682139	0.75124564	rno-miR-448*	2.0526945	0.4748063	rno-miR-500	0.69860000	1.352811809
rno-miR-376a	1.4443813	1.631507	rno-miR-758*	0.677330	0.72947047	rno-miR-335	1.9220501	0.6855958	rno-miR-450a*	0.69203410	3.284467450
rno-miR-664	1.4361529	1.661272	rno-miR-344b-1-3p	0.660900	0.51092973	rno-miR-466b	1.7737696	0.5701351	rno-miR-300-3p	0.67563510	1.421903839
rno-miR-127	1.4246079	1.449653	rno-miR-664-1*	0.656291	0.33467595	rno-miR-200b	1.7686778	0.8490812	rno-miR-675	0.66297150	1.881596970
rno-miR-145	1.4116241	1.584110	rno-miR-17-5p	0.651909	0.71146565	rno-miR-199a-3p	1.7519083	0.3819046	rno-miR-667	0.66158250	1.851774707
rno-miR-207	1.3967711	1.344485	rno-miR-183	0.645298	0.06785863	rno-miR-429	1.7345297	0.6532936	rno-miR-101a	0.63908846	1.599289011
rno-miR-331*	1.3332774	3.647136	rno-miR-298	0.622817	0.32752771	rno-miR-206	1.6451149	0.5619425	rno-miR-668	0.62312700	1.546920336
rno-miR-323	1.3300142	1.247038	rno-miR-199a-5p	0.619426	0.42597925	rno-miR-665	1.5267099	0.2914475	rno-miR-183*	0.61654370	2.938326520
rno-miR-294	1.2375557	1.770187	rno-miR-181d	0.618991	0.30448551	rno-miR-17-1-3p	1.4533188	0.2164874	rno-miR-181a	0.60586140	1.027205203
rno-miR-21	1.2271042	1.679205	rno-miR-140*	0.612127	0.17284846	rno-miR-99b*	1.4381097	0.9020220	rno-miR-22*	0.59792190	1.458050402
rno-miR-32*	1.2216227	1.257030	rno-miR-218	0.610725	0.02906206	rno-miR-30e	1.4249814	0.9009271	rno-miR-3571	0.59185380	1.660526533
rno-miR-378	1.2187415	1.174652	rno-miR-140	0.602168	0.17782928	rno-miR-664-2*	1.3842126	0.0870265	rno-miR-24-1*	0.58317060	2.889240932
rno-miR-let-7d*	1.1706845	1.128949	rno-miR-505*	0.546060	0.7634096	rno-miR-142-3p	1.3621145	0.6892047	rno-miR-145*	0.55848840	1.061437866
rno-miR-134*	1.1520524	2.038411	rno-miR-320	0.535097	0.53630321	rno-miR-423	1.3421092	0.7849327	rno-miR-99b	0.52918460	1.484742511
rno-miR-742	1.1370318	2.165993	rno-miR-361	0.521556	0.06827078	rno-miR-let-7i	1.3092522	0.4607812	rno-miR-872*	0.50684120	3.472207096
rno-miR-465	1.1331676	1.424808	rno-miR-483	0.518141	0.32997545	rno-miR-410	1.3015181	0.7325175	rno-miR-30b-3p	0.50448300	1.170676650
rno-miR-340-5p	1.1306514	1.900459	rno-miR-191	0.507004	0.14680991	rno-miR-490	1.2756753	0.7856162	rno-miR-877	0.48686730	1.339451220
rno-miR-34b*	1.0914578	2.423233	rno-miR-434	0.504917	0.86745761	rno-miR-466d	1.2712970	0.9663230	rno-miR-423*	0.44084070	1.653788675
rno-mir-141	1.0728281	1.002083	rno-miR-485*	0.498218	0.56491937	rno-miR-193	1.2541245	0.7348141	rno-miR-541	0.42540900	1.207167473
rno-mir-181b	1.0632784	1.197243	rno-miR-214	0.451194	0.59062997	rno-miR-22	1.1550101	0.7615345	rno-miR-124	0.39048060	2.030618140
rno-mir-27b	1.0548732	1.005943	rno-miR-185*	0.385377	0.74238926	rno-miR-374	1.1515834	0.6490015	rno-miR-351	0.38371410	3.656196612
rno-mir-465*	1.0445459	2.298723	rno-miR-1949	0.381056	0.42356006	rno-miR-2985	1.1071099	0.9055459	rno-miR-369-3p	0.37871630	2.411181539
rno-mir-382	1.0444827	1.091136	rno-miR-130a	0.374817	0.84478535	rno-miR-301a	1.0911573	0.4289909	rno-miR-125a-5p	0.34660480	1.113517147
rno-mir-503	1.0266687	1.160400	rno-miR-93	0.359659	0.24274816	rno-miR-142-5p	1.0873938	0.9302832	rno-miR-103-1*	0.31836890	1.464945944
			rno-miR-130b	0.353169	0.84478535	rno-miR-205	1.0665678	0.0960427	rno-miR-1193-3p	0.29953480	5.522615564
			rno-miR-125b-5p	0.350006	0.27382858	rno-miR-92b	1.0280013	0.3149766	rno-miR-33	0.29346730	1.899358020
			rno-miR-9*	0.304562	0.78517235	rno-miR-126	1.0129183	0.9994663	rno-miR-341	0.19430920	1.452073739
			rno-miR-296	0.248001	0.31706143	rno-miR-let-7e	1.0102800	0.9453700	rno-miR-542-3p	0.16812910	2.681449923
			rno-miR-101b	0.221090	0.94937991				rno-miR-148b-3p	0.09409170	2.009611745

a Arranged from high to low according to the fold changes between S2/S3.

In addition, in view of their classic status in lung development, we also selected some representative members of the rno-Let-7 family and rno-miRNA-17-92 cluster from the differentially expressed miRNAs (Table IV) to generate line charts reflecting their expression trends during fetal lung development (Fig. 3). Compared with these intensely investigated miRNAs, certain other miRNAs, including miRNA-126* and miRNA-126, have been scarcely reported on and studied in lung development. However, both have been revealed to be highly enriched in mouse embryonic stem cells (15). Additionally, more than one study has reported their significance in the vascular endothelial cells of the embryo (14,15). Therefore, we also prepared line charts to show the expression patterns of rno-miRNA-126* and rno-miRNA-126 in order to further study their possible effects in the lung development of embryos (Fig. 4).

Figure 3 (A) Data show the relative expression trends of the miRNA-17-92 cluster among the 3 groups (S1, S2 and S3). (B) Data show the relative expression trends of the Let-7 family among the 3 groups according to the microarray results.

Figure 4 (A) Data show the relative expression trends of the rno-miRNA-126 and rno-miRNA-126* according to the microarray results. (B) Data show the results of the rno-miRNA-126* real-time PCR assay. In real time PCR, data were normalized using U6 as an endogenous control for RNA input. Fold changes for rno-miRNA-126* from the array and real-time qRT-PCR are shown as the mean. Error bars are SE. Statistical significance of the real-time PCR was tested according to the one-way ANOVA (*P<0.05).

Real-time PCR

Due to the exhibition of marked differential expression between rno-miRNA-126* and rno-miRNA-126 in the microarray, we selected the former for analysis by real-time PCR (Fig. 4). The results revealed that the relative expression of rno-miRNA-126* determined by real-time PCR was consistent with the microarray result, revealing significant differences among the 3 groups (P<0.05; Fig. 4).

Discussion

In the present study, we used the latest microarray technology to prepare a miRNA expression profile among three time points of fetal lung development, with 202 differentially expressed miRNAs being identified, including four different expression patterns. Among these miRNAs, a number are reported for the first time in the field of lung development, including rno-miRNA-126*, rno-miRNA-186*, rno-miRNA-25, rno-miRNA-195 and rno-miRNA-107 (Table IV).

In addition to these newly identified miRNAs, we also found certain classical ones associated with lung development, for example, the Let-7 family and miRNA-17-92 cluster, and their expression patterns are shown as line charts in Fig. 3. For several years, these two types of miRNAs have been reported and studied repeatedly due to their important roles in lung development and lung cancer. Johnson et al(10) reported that Let-7 is highly expressed in the developing lungs during mouse embryogenesis. Furthermore, they demonstrated that the Let-7 family directly regulates a number of key cell cycle proto-oncogenes, including RAS, CDC25a, CDK6 and cyclin D, and thus may further regulate cell proliferation by promoting the G1 phase into the S phase. Compared with the high expression in lung development, certain members of this family have been found to be deregulated in specific processes involved in pathological mechanisms, including pulmonary allergy, asthma and lung cancer (11). These findings indicate that the Let-7 family is essential to lung homeostasis and development.

With regard to the miRNA-17-92 cluster, Lu et al(12) firstly reported that its expression is high at the embryo stage and steadily declines during the development into adulthood. The authors further reported that overexpression of the miRNA-17-92 cluster in murine models resulted in abnormalities, in particular, terminal air sacs were lacking and were replaced by undifferentiated and highly proliferative pulmonary epithelium. By contrast, Ventura et al(13) demonstrated that mice deficient in the miRNA-17-92 cluster exhibited an altered phenotype characterized by hypoplasia of the lung. Subsequently, these findings were confirmed by Jevnaker et al(16) and Carraro et al(17), respectively. In this study, we also screened these two important types of miRNA. Their expression patterns are additionally presented as line charts. Moreover, the expression trends are essentially in agreement with the former studies (Fig. 3). The expression of the Let-7 family increased gradually from group S3 (E16) to S1 (E21), while the expression of the miRNA-17-92 cluster manifested a downward trend as the fetal lung grew.

Compared with these intensely investigated miRNAs, certain other miRNAs, including miRNA-126* and miRNA-126, have rarely been discussed in relation to lung development. miRNA-126* and miRNA-126 originate from the same domain [both mapping to intron-9 of the epidermal growth factor-like domain 7 gene (Egfl7) (14)]; the common miRNA-126 (known as miRNA-126-3p) was firstly identified in mouse (18) and another less common miRNA-126 was later revealed to be processed from the 5′-half of the same pre-miRNA and was therefore renamed miRNA-126* (also known as miRNA-126-5p). Although introns occupy a large portion of all genomes of eukaryotes and have been generally considered to be sequences that exist only to be removed and destroyed (19,20), the finding of intronic miRNA has indicated that certain excised introns may have particular functions. These include intron-9 in the Egfl7 gene, which has been repeatedly demonstrated to be expressed at high levels in the vasculature associated with tissue proliferation and is abundant in specific organs, including the lungs (14,21-23).

miRNA-126 and miRNA-126* are processed from the same primary miRNA and located in the same intron of Egfl7, a well-known epidermal growth factor domain gene (14). These two miRNAs have been found to be highly enriched in endothelial cells derived from mouse embryonic stem cells (15). Consequently, they are likely to be critical in the regulation of vascular integrity and angiogenesis (15,24). During the past several years, related studies on miRNA-126 and miRNA-126* have mostly been limited to the pathogenesis of cancers. Due to miRNA-126 targeting the vascular endothelial growth factor A (VEGFA), sprouty-related, EVH1 domain-containing protein 1 (Spred-1) and phosphatidylinositol 3-kinase (PI3K), its expression has been found to be decreased in human breast cancer. By contrast, in lung cancer, miRNA-126 has been shown to be upregulated to decrease the growth rate of cell lines in vitro(25), partially through the VEGF/PI3K signaling pathway (26). Moreover, Liu et al(25) focused on the miRNA-126 interaction with VEGF in lung cancer cells and three other cancer cell lines infected with LV-miRNA-126, and revealed that miRNA-126 efficiently reduced the expression of VEGF and inhibited cell proliferation as a potential tumor suppressor. Moreover, two more studies demonstrated that the role of miRNA-126 as a tumor suppressor in lung cancers may be due to its regulation of chicken tumor virus no. 10 regulator of kinase (Crk), which has been described in lung cancer and associated with increased tumor invasiveness (27,28). These studies suggest that miRNA-126 and miRNA-126* have various roles in developmental angiogenesis as well as in carcinogenesis (29).

Compared with that of miRNA-126, the role of miRNA-126* is less understood, with the exception of its joint function with miRNA-126 in VEGF and angiogenesis. Musiyenko et al(30) reported that the natural absence of Egfl7 leads to the absence of its intronic mRNA (miRNA-126*), which indirectly promotes the invasiveness of LNCaP prostate cancer cells by allowing the expression of protein. This is one of the few studies concerning the function of miRNA-126*. Until several years ago, it was assumed that one strand of the RNA duplex preferentially binds to the silencing complex during the processing of miRNA, whereas the other strand, i.e., miRNA* is degraded (31), representing a functionally irrelevant carrier strand. However, subsequently, miRNA* species have been detected in increasing numbers with large-scale small RNA sequencing efforts. In the case of miRNA-126/miRNA-126*, they have been detected with high expression levels in the same tissue (32). In addition, the two strands of a miRNA pair are able to functionally suppress the expression of their target genes (33,34). Therefore, compared with common miRNA-126, miRNA-126* may also have its own special functions (29).

Since miRNA-126 and miRNA-126* originate from the Egfl7 gene and share a common mRNA, in previous reports, their expression appeared always to be generally in parallel (15,23). Nevertheless, there are currently a few studies which report that miRNA-126 expression is regulated independently of the EGFL7 protein (35), suggesting that independent promoters may exist which regulate the expression of miRNA-126 and miRNA-126*, further indicating that they may each have respective roles in different signaling pathways and physiological mechanisms. In the present study, following the microarray screening, we found that miRNA-126 did not exhibit the same differential expression as miRNA-126* in the three groups (Fig. 4), verifying the above hypothesis.

The results of a subsequent real-time PCR assay demonstrated that miRNA-126* has significant differences in expression among the three time points (group S3 → S2 → S1) (Fig. 4). This is the first time that the differential expression of miRNA-126* has been reported in fetal lung development and, according to these results, we suggest that miRNA-126* is important in the process of fetal lung development, since its expression increases gradually as the lung develops.

As previously stated, most of the studies on these two miRNAs have been conducted in cancers. However, cells at an early stage of development are known to share several characteristics with carcinoma cells, including high and rapid proliferation. The higher tissue levels of miRNA-126/126* in carcinoma cells are closely associated with their role in angiogenesis. Therefore, in the embryo, the two miRNAs may also promote lung development through the same mechanism since these two processes share the same characteristics. This hypothesis may also help to explain the role of miRNA-126* in fetal lung development in the rat embryo. Furthermore, we consider that these findings are likely to lay a certain physiological foundation for studies concerning neonatal lung developmental diseases, including RDS (respiratory distress syndrome) and BPD (bronchopulmonary dysplasia). Therefore, future studies are necessary.

Acknowledgements

The authors would like to thank Dr Shi for assistance in the revision of this manuscript. This study was funded by the Project Foundation of Jiangsu Province Health Department (no. H200642).

References