Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
February 2013 Volume 7 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February 2013 Volume 7 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Effects of siRNA‑mediated Cdc2 silencing on MG63 cell proliferation and apoptosis

  • Authors:
    • Xiang‑Yong Que
    • Yi Li
    • Yu Han
    • Xin‑Zhi Li
  • View Affiliations / Copyright

    Affiliations: Department of Orthopedics, Renhe Hospital of Three Gorges University, Yichang 443001, P.R. China, Institute of Molecular Biology, Medical College, Three Gorges University, Yichang 443002, P.R. China
  • Pages: 466-470
    |
    Published online on: November 28, 2012
       https://doi.org/10.3892/mmr.2012.1209
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The present study aimed to determine the effect of small interfering RNA (siRNA)‑induced inhibition of cyclin‑dependent kinase 2 (Cdc2) expression on osteosarcoma MG63 cell proliferation and apoptosis. An siRNA expression plasmid, psilencer 2.1‑U6/Cdc2, targeting the Cdc2 gene, and a control psilencer 2.1‑U6/Scramble plasmid were constructed and transfected into MG63 cells using liposomes. Cdc2 expression in the MG63 cells was investigated by western blot analysis and real‑time polymerase chain reaction. Cell morphology was also examined. The effects of psilencer 2.1‑U6/Cdc2 on MG63 cell proliferation and the cell cycle were detected via MTT and flow cytometry, respectively. Expression levels of apoptosis‑related molecules, B‑cell lymphoma 2 (Bcl‑2) and Bcl‑2‑associated X (Bax) were determined by western blot analysis. MG63 cells stably transfected with the psilencer 2.1‑U6/Cdc2 plasmid (MG63‑siRNA/Cdc2) and negative control cells, MG63‑siRNA/Scramble, were successfully obtained. The silencing efficiencies of the Cdc2‑expressing mRNA and protein in MG63‑siRNA/Cdc2 were 86 and 89% of that of the control MG63‑siRNA/Scramble cells, respectively. Interference of Cdc2 expression inhibited MG63 cell proliferation and was demonstrated to significantly increase and decrease cells in the G2/M and S phases, respectively. Cdc2 expression silencing had negligible effects on Bcl‑2 and Bax expression in MG63 cells. In conclusion, silencing of Cdc2 expression suppresses proliferation of osteosarcoma MG63 cells but has negligible effects on apoptosis.

Introduction

Osteosarcoma is one of the most common primary malignant tumour observed in children and adolescents, with a current annual incidence rate of 3/1,000,000 (1). At present, combined neoadjuvant chemotherapy and surgery are mainly used to treat osteosarcoma, however, patient survival rates remain low (2). Studies of potential gene therapy candidates for the treatment of osteosarcoma have increased with the development of molecular biology and genomic sciences (3,4). In previous studies (5,6), we utilised a limiting dilution to obtain an osteosarcoma MG63 monoclonal cell substrain. Cell electrophoresis and invasion assays were then used to identify MG63 monoclonal cell substrains with variations in transfer and malignant characteristics. A cell substrain with high transfer and malignant characteristics (M8) and another with low transfer and malignant characteristics (M6) were verified by tumour transfer experiments in vitro. A gene chip was then used to scan and compare M8 with M6. Cyclin-dependent kinase 2 (Cdc2) expression in M8 was high at 2.67. Following this, quantitative reverse-transcription polymerase chain reaction (qRT-PCR) was utilised to verify the increase in gene expression of Cdc2 in M8 compared with M6 cells (5,6) and Cdc2 was identified as a key gene for the proliferation and apoptosis of osteosarcoma MG63 cells. In addition, silencing of Cdc2 expression was demonstrated to inhibit proliferation and promote apoptosis of osteosarcoma MG63 cells. To verify these findings, a small interfering RNA (siRNA) expression plasmid targeting the Cdc2 gene was constructed in the current study and the effect of siRNA interference of Cdc2 expression on the proliferation and apoptosis of osteosarcoma MG63 cells was investigated. The results obtained may serve as an experimental basis for gene therapy of osteosarcoma.

Materials and methods

Cell culture

MG63 cells were grown in RPMI-1640 medium supplemented with 10% calf serum, 100 μg/ml streptomycin and 100 U/ml penicillin in a humidified 5% CO2 and 95% air incubator at 37°C.

Plasmid construction

The genetic code sequence for Cdc2 was obtained from GenBank (NM_001170406) in accordance with the principles of siRNA design. One siRNA-2 interference sequence was designed by Invitrogen Life Technologies (Carlsbad, CA, USA). An additional siRNA-1 interference sequence that was previously reported to be more effective (7) than that in the human genome was identified only as a Cdc2 gene interference sequence. A non-specific siRNA-scrambled (siRNA-Scramble) sequence, designed in a similar manner to serve as the negative control, was obtained from the Institute of Molecular Biology of (Three Gorges University; Table I). The three synthesised siRNA sequences were annealed using sticky ends and BamHI and HindIII digestion and then connected to a psilencer 2.1-U6 that had been cut by the same enzyme. The three restructured psilencer 2.1/siRNA plasmids were then transformed into Escherichia coli DH5, screened for ampicillin resistance on an agar plate and then amplified in culture. Following this, plasmids were selected and sequenced.

Table I

Template sequence of Cdc2 siRNA.

Table I

Template sequence of Cdc2 siRNA.

siRNASequence (5′-3′)
Negative
siRNA-Scramble
 Forward GATCCACTACCGTTGTTATAGGTGTTCAAGAGACACCTATAACAACGGTAGTTTTTTGGAAA
 Reverse AGCTTTTCCAAAAAACTACCGTTGTTATAGGTGTCTCTTGAACACCTATAACAACGGTAGG
Cdc2 siRNA-1
 Forward GATCCGGGGTTCCTAGTACTGCAATTCAAGAGATTGCAGTACTAGGAACCCCTTTTTTGGAAA
 Reverse AGCTTTTCCAAAAAAGGGGTTCCTAGTACTGCAATCTCTTGAATTGCAGTACTAGGAACCCCG
Cdc2 siRNA-2
 Forward GATCCGTTGATCAACTCTTCAGGATTTCAAGAGAATCCTGAAGAGTTGATCAATTTTTTGGAAA
 Reverse AGCTTTTCCAAAAAATTGATCAACTCTTCAGGATTCTCTTGAAATCCTGAAGAGTTGATCAACG

[i] Cdc2, cyclin-dependent kinase 2; siRNA, small interfering RNA.

Transient transfection

One day prior to transient transfection, the cells were plated in six-well plates at a concentration of 2×105 cells/well. When the cell density reached ~80%, transfection was performed using Lipofectamine™ 2000 in accordance with the manufacturer’s instructions. Following transfection (~24 h), the proteins were extracted from the cells. Western blot analysis was then performed to determine the siRNA silencing efficiency.

Stable transfection

MG63 cells were plated in six-well plates at a concentration of 2×105 cells/well and then cultured in a conventional culture medium, as previously described. Cells were transfected the following day according to the manufacturer’s instructions. In brief, diluted DNA and Lipofectamine™ 2000 complexes (total volume, 25 ml) were prepared and added to each MG63 cell-containing well. Cells were then incubated for 4–6 h. Post-transfection (~48 h), cells were incubated with 100 μg/ml hygromycin in RPMI-1640 medium with 10% calf serum for three weeks. Single clones with low Cdc2 expression were then identified via RT-PCR, western blot analysis and cell immunofluorescence.

Quantitative PCR

RNA from the cell lines was extracted using TRIzol reagent. cDNA was synthesised using SuperScript™ II Reverse Transcriptase according to the manufacturer’s instructions. The primers used for amplification were as follows: Cdc2, 5′-TACCTATGGAGTTGTGTATAA-3′ and 5′-ATTCCA CTTCTGGCCACACTT-3′; β-actin, 5′-CCACAGCTGAG AGGGAAATC-3′ and 5′-ATCCTCTTCCTCCCTGGAGA-3′. PCR cycling conditions were as follows: 94°C for 5 min, 25 cycles at 94°C for 30 sec, 55°C for 30 sec, 72°C for 30 sec and 78°C for 1 sec for plate reading and 72°C for 5 min. PCR products were separated via electrophoresis at 100 V for 30 min on a 1% agarose gel and then detected using ethidium bromide staining. The expected sizes of specific PCR products were verified using a 1-kb DNA reference ladder.

Western blot analysis

Cell lysates were prepared from six cloning strains. Normal MG63 and negative control cells were cultured for 24 h. Protein samples were subjected to 12% sodium dodecyl sulphate-polyacrylamide gel electrophoresis and then transferred onto polyvinylidene fluoride membranes. Following blocking with 5% non-fat dry milk in a Tris-buffered saline Tween-20 buffer for 1 h, the samples were probed with a primary antibody against Cdc2 and a horseradish peroxidase-conjugated secondary antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA). Protein bands were detected using an enhanced chemiluminescence detection system and X-ray film exposure (Kodak, Rochester, NY, USA). β-actin was used as a loading control.

Cell immunofluorescence

MG63 and MG63-siRNA-Cdc2 cells were seeded into 24-well culture plates. When the growth density reached 60%, cells were fixed with ice-cold 4% paraformaldehyde and incubated with 10% (v/v) goat serum as a blocking background. Following overnight incubation with the primary antibody against Cdc2, the cells were washed three times with phosphate-buffered saline (PBS) and then incubated with rhodamine-123-labeled anti-rabbit IgG for 1 h at 37°C. The cells were washed three times with PBS and then examined via fluorescence/phase-contrast microscopy (TE2000S; Nikon, Tokyo, Japan).

Assay of cellular proliferation

MG63, MG63-siRNA/Scramble and MG63-siRNA/Cdc2 cells were seeded into 96-well culture plates (2,000 cells/well in 100 μl RPMI-1640 medium). Culture medium was removed following culture for 0, 24, 48, 72 and 96 h. A 200 μl MTT solution (0.25 g/l in RPMI-1640 medium) was added to each well and the cells were incubated at 37°C for 4 h. The medium was removed and 200 μl dimethyl sulfoxide was added to each well. Absorbance (A) at 570 nm was recorded following 30 min incubation at room temperature. The cell survival rate was calculated as follows: Cell survival rate = Adrug/Acontrol × 100.

Apoptosis protein detection via western blot analysis

Experiments were conducted as described for Cdc2. Primary monoclonal antibodies against B-cell lymphoma 2 (Bcl-2) and Bcl-2-associated X (Bax) were utilised. Secondary antibodies were mouse and goat anti-rabbit IgG (both 1:2,000).

Flow cytometry

MG63, MG63-siRNA/Scramble and MG63-siRNA/Cdc2 were collected, washed twice with ice-cold PBS and then fixed in 75% ethanol overnight at 4°C. Following centrifugation at 2,000 rpm for 5 min, cell pellets were resuspended in PBS containing 0.1% Triton X-100 and 50 μg/ml RNase A. The cell samples were then stained with 50 mg/l propidium iodide for 30 min at 37°C in the dark prior to flow cytometry.

Statistical analysis

Data are expressed as mean ± SD. Differences between two groups were analysed using the Student’s t-test, whereas differences between three or more groups were analysed using ANOVA. P<0.05 was considered to indicate a statistically significant difference.

Results

Plasmid construction

The siRNA-restructured plasmid was connected to psilencer 2.1-U6. The identity of the restructured plasmid psilencer 2.1/siRNA was confirmed via DNA sequencing (Fig. 1).

Figure 1

DNA sequencing assay of siRNA plasmids. (A) Insert DNA fragment in plasmid psilencer 2.1/siRNA-1. (B) Insert DNA fragment in plasmid psilencer2.1/siRNA-2. siRNA, small interfering RNA.

Cdc2 low-expression cell line

siRNA was transiently transfected into MG63 cells. Western blot analysis was then performed to determine the siRNA silencing efficiency (Fig. 2). siRNA-Scramble had no effect on Cdc2 expression and siRNA-1 exhibited higher silencing efficiency than siRNA-2. Therefore, siRNA-1 was used in the stable transfection. Western blot analysis and RT-PCR detected Cdc2 expression in six clones (Figs. 3 and 4). The siRNA1-5 clone exhibited the highest silencing efficiencies: 89 and 86% at the protein and mRNA levels, respectively. Immunofluorescence results demonstrated that, compared with normal MG63, MG63-siRNA/Cdc2 cells shrank and their structures changed into short, irregular, oblate spheroids. In addition, a reduced number of MG63-siRNA/Cdc2 cells were identified to express Cdc2 protein. No Cdc2 expression was observed in MG63-siRNA/Cdc2 cells.

Figure 2

Western blot analysis of three siRNAs designed against Cdc2 to determine silencing efficiency following transient transfection. Cdc2, cyclin-dependent kinase 2; siRNA, small interfering RNA.

Figure 3

Cdc2 expression in six cloned strains was detected by western blot analysis. siRNA1-5 demonstrated the best effect in Cdc2 silencing. Lane 1, MG63; 2, siRNA-Scramble; 3, siRNA1-1; 4, siRNA1-2; 5, siRNA1-3; 6, siRNA1-5; 7, siRNA1-7; 8, siRNA1-8. Cdc2, cyclin-dependent kinase 2; siRNA, small interfering RNA.

Figure 4

Cdc2 expression in six cloned strains was analysed by RT-PCR.siRNA1-5 was identified to have the best silencing effect on Cdc2. Lane 1, MG63; 2, siRNA-Scramble; 3, siRNA1-1; 4, siRNA1-2; 5, siRNA1-3; 6, siRNA1-5; 7, siRNA1-7; 8, siRNA1-8. Cdc2, cyclin-dependent kinase 2; siRNA, small interfering RNA; RT-PCR, reverse-transcription polymerase chain reaction.

MTT assay

The MTT assay detected MG63 cell proliferation following Cdc2 expression silencing (Fig. 5). Following culture for 24 h, the growth rate of the MG63-siRNA/Cdc2 was identified as significantly lower than those of the MG63-siRNA/scramble and MG6 cells (P<0.01). These observations indicate that Cdc2 expression silencing inhibits cell proliferation.

Figure 5

Effect of Cdc2 on proliferation of MG63 cells. Cdc2, cyclin-dependent kinase 2; siRNA, small interfering RNA.

Bcl-2, Bax gene expression

Bcl-2 expression in the MG63-siRNA/Cdc2 was not revealed to decrease significantly compared with the MG63-siRNA/scramble and MG63 cells (126±16 vs. 148±18, 151±13, respectively; P>0.05). In addition, Bcl-2 expression in the MG63-siRNA/Cdc2 cells was not identified to increase significantly (198±21 vs. 186±26, 178±25, respectively; P>0.05; Fig. 6).

Figure 6

Expression of Bcl-2 and Bax in various MG63 cell groups (n=3). Lane 1, MG63; 2, MG63-siRNA/Scramble; 3, MG63-siRNA/Cdc2. Cdc2, cyclin-dependent kinase 2; Bcl-2, B-cell lymphoma 2; Bax, Bcl-2-associated X; siRNA, small interfering RNA.

Cell cycle

Following Cdc2 expression silencing, MG63-siRNA/Cdc2 accumulated at the G2/M and G0/G1 phases compared with MG63-siRNA/scramble and MG63 cells. However, the number of MG63-siRNA/Cdc2 cells in the S phase was observed to be significantly reduced (P<0.05; Table II).

Table II

Effect of Cdc2-siRNA on the cell cycle in MG63 cells (n=3).

Table II

Effect of Cdc2-siRNA on the cell cycle in MG63 cells (n=3).

G0/G1SG2/M
MG6363.1±0.825.0±0.711.9±0.2
MG63-siRNA/Scramble62.8±0.926.7±0.610.5±0.2
MG63-siRNA/Cdc2 66.8±0.7a 11.8±0.4b 21.4±0.3b

[i] aP<0.05 and bP<0.01, MG63-SiRNA/Cdc2 vs. MG63-SiRNA/Scramble. MG63 vs. MG63-SiRNA/Scramble was not identified to be statistically significant. Data are presented as the mean ± SD. Cdc2, cyclin-dependent kinase 2; siRNA, small interfering RNA.

Discussion

Osteosarcoma is the most common highly malignant tumour of the bone, often manifesting during the second or third decade of life. It accounts for ~60% of all malignant bone tumours that occur during the first 20 years of life (8). The development of neoadjuvant chemotherapy has increased long-term survival rates from 10–20 to 60–70%. However, although adjuvant chemotherapy effectively improves patient survival, as well as the treatment of primary tumours (9), patients who present with metastatic disease and/or tumour relapse remain associated with a poor prognosis. The estimated five-year survival rate following relapse is only 25% (10). To date, gene therapy studies of osteosarcoma pathogenesis and progression, have investigated p53, ezrin and surivin (11–16). However, few studies have focused on the molecular mechanism of Cdc2 in osteosarcoma cells.

In the present study, siRNA interference technology was used to obtain a low-Cdc2 expression cell line. The cell line was then used to study the effects of siRNA-induced interference of Cdc2 expression on the proliferation and apoptosis of osteosarcoma MG63 cells. Normal MG63 cells exhibit long shuttle-like or triangular structures. Following Cdc2 expression silencing, cells exhibited short, irregular, oblate shapes which accumulated easily. MTT results demonstrate that Cdc2 expression silencing inhibits cell proliferation by blocking the cell cycle at the G2/M phase. Expression of the apoptosis genes, Bcl-2 and Bax, was also analysed to determine the possible effects of Cdc2 expression silencing on cell apoptosis. Cdc2 expression silencing had no effect on Bcl-2 and Bax, indicating that Cdc2 silencing does not promote MG63 cell apoptosis. Results of the present study indicate that Cdc2 expression silencing in MG63 cells inhibits cell proliferation but does not promote cell apoptosis. However, we previously hypothesised that disruption of Cdc2 expression inhibits osteosarcoma MG63 cell proliferation and promotes apoptosis. The absence of an observable effect of Cdc2 expression silencing on the apoptosis of MG63 cells may be due to the large number of genes associated with the regulation of apoptosis of MG63 cells. Although Cdc2 expression in MG63 cells, itself a regulation mechanism, is silenced, additional genes may be activated to offset low Cdc2 expression. Therefore, cells do not undergo apoptosis when Cdc2 alone is silenced. Inhibition of cell proliferation by Cdc2 expression silencing is attributed to the association between Cdc2 and the eukaryotic cell division cycle gene CDC2, which codes for a serine/threonine protein kinase with a molecular weight of 3,400 Da. Cdc2 enzyme activation is an indicator of cell division. Cdc2 is vital to cell cycle regulation, inducing DNA replication and cell mitosis (17–19). Overexpression of Cdc2 is associated with cell cycle progression disorders, including abnormal growth and cell differentiation, as well as malignant cell proliferation and tumour formation (20). A number of previous studies have reported overexpression of Cdc2 in breast cancer (21,22), B-cell lymphoma (23), colon carcinoma (24), ovarian cancer (25) and glioma (7) cells, as well as a marked correlation with tumour stage, grade, relapse and prognosis. Results of the current study are consistent with these observations.

In the present study, the expression levels of Bax and Bcl-2 only were analysed to detect cell apoptosis. Therefore, additional data are required to verify these results. Future studies must include analyses using an anticancer drug. The effect of Cdc2 expression silencing on the strength of the anticancer drug activity may then be determined. Three cell lines will be implanted in mice to investigate the effect of Cdc2 expression silencing on tumour growth, transfer and prognosis in vivo.

Acknowledgements

The present study was supported by the Natural Science Foundation of Hubei Province (D20101206).

References

1 

Picci P: Osteosarcoma (osteogenic sarcoma). Orphanet J Rare Dis. 2:62007. View Article : Google Scholar

2 

Chou AJ, Geller DS and Gorlick R: Therapy for osteosarcoma: where do we go from here? Paediatr Drugs. 10:315–327. 2008. View Article : Google Scholar : PubMed/NCBI

3 

Tan ML, Choong PF and Dass CR: Osteosarcoma: Conventional treatment vs. gene therapy. Cancer Biol Ther. 8:106–117. 2009. View Article : Google Scholar : PubMed/NCBI

4 

Broadhead ML, Clark JC, Choong PF and Dass CR: Making gene therapy for osteosarcoma a reality. Expert Rev Anticancer Ther. 10:477–480. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Li XZ, Meng L, Chen AM, Guo FJ, Luo ZQ and Zeng H: Screening of differentially expressed genes in osteosarcoma cell lines with various metastatic potentialities. Zhonghua Zhong Liu Za Zhi. 1:71–76. 2010.(In Chinese).

6 

Li XZ, Meng L, Chen AM, Guo FJ, Luo ZQ and Zeng H: Differentially expressed gene in osteosarcoma cell lines with different metastatic potentials. J Nanjing Med Univ. 23:352–358. 2009. View Article : Google Scholar

7 

Chen H, Huang Q, Dong J, Zhai DZ, Wang AD and Lan Q: Overexpression of CDC2/CyclinB1 in gliomas, and CDC2 depletion inhibits proliferation of human glioma cells in vitro and in vivo. BMC Cancer. 8:292008. View Article : Google Scholar : PubMed/NCBI

8 

Winkler K, Beron G, Kotz R, et al: Neoadjuvant chemotherapy for osteogenic sarcoma: results of a Cooperative German/Austrian study. J Clin Oncol. 2:617–624. 1984.PubMed/NCBI

9 

Marina NM, Pratt CB, Rao BN, Shema SJ and Meyer WH: Improved prognosis of children with osteosarcoma metastatic to the lung(s) at the time of diagnosis. Cancer. 70:2722–2727. 1992. View Article : Google Scholar : PubMed/NCBI

10 

Kempf-Bielack B, Bielack SS, Jürgens H, et al: Osteosarcoma relapse after combined modality therapy: an analysis of unselected patients in the Cooperative Osteosarcoma Study Group (COSS). J Clin Oncol. 23:559–568. 2005. View Article : Google Scholar

11 

Oshima Y, Sasaki Y, Negishi H, et al: Antitumor effect of adenovirus-mediated p53 family gene transfer on osteosarcoma cell lines. Cancer Biol Ther. 6:1058–1066. 2007. View Article : Google Scholar : PubMed/NCBI

12 

Walkley CR, Qudsi R, Sankaran VG, et al: Conditional mouse osteosarcoma, dependent on p53 loss and potentiated by loss of Rb, mimics the human disease. Genes. 22:1662–1676. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Liang X, Da M, Zhuang Z, et al: Effects of Survivin on cell proliferation and apoptosis in MG-63 cells in vitro. Cell Biol Int. 33:119–124. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Wu YF, Liang XJ, Liu YY, et al: +Antisense oligonucleotide targeting survivin inhibits growth by inducing apoptosis in human osteosarcoma cells MG-63. Neoplasma. 57:501–506. 2010.

15 

Kim C, Shin E, Hong S, et al: Clinical value of ezrin expression in primary osteosarcoma. Cancer Res Treat. 41:138–144. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Wang YF, Shen JN, Xie XB, Wang J and Huang G: Expression change of ezrin as a prognostic factor in primary osteosarcoma. Med Oncol. 28(Suppl 1): S636–S643. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Xu N and Chang DC: Different thresholds of MPF inactivation are responsible for controlling different mitotic events in mammalian cell division. Cell Cycle. 6:1639–1645. 2007. View Article : Google Scholar : PubMed/NCBI

18 

Kim DH: Prognostic implications of cyclinB1, p34cdc2, p27(Kip1) and p53 expression in gastric cancer. Yonsei Med J. 48:694–700. 2007. View Article : Google Scholar : PubMed/NCBI

19 

Chang JT, Wang HM, Chang KW, et al: Identification of differentially expressed genes in oral squamous cell carcinoma (OSCC): overexpression of NPM, CDK1 and NDRG1 and underexpression of CHES1. Int J Cancer. 114:942–949. 2005. View Article : Google Scholar : PubMed/NCBI

20 

Diril MK, Ratnacaram CK, Padmakumar VC, et al: Cyclin-dependent kinase 1 (Cdk1) is essential for cell division and suppression of DNA re-replication but not for liver regeneration. Proc Natl Acad Sci USA. 109:3826–3831. 2012. View Article : Google Scholar : PubMed/NCBI

21 

Kim SJ, Nakayama S, Miyoshi Y, et al: Determination of the specific activity of CDK1 and CDK2 as a novel prognostic indicator for early breast cancer. Ann Onco. 19:68–72. 2008. View Article : Google Scholar : PubMed/NCBI

22 

Choi HJ and Zhu BT: Critical role of cyclin B1/Cdc2 up-regulation in the induction of mitotic prometaphase arrest in human breast cancer cells treated with 2-methoxyestradiol. Biochim Biophys Acta. 1823:1306–1315. 2012. View Article : Google Scholar : PubMed/NCBI

23 

Zhao MY, Auerbach A, D’Costa AM, et al: Phospho-p70S6K/p85S6K and cdc2/cdk1 are novel targets for diffuse large B-cell lymphoma combination therapy. Clin Cancer Res. 15:1708–1720. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Meyer A, Merkel S, Brückl W, et al: Cdc2 as prognostic marker in stage UICC II colon carcinomas. Eur J Cancer. 45:1466–1473. 2009. View Article : Google Scholar : PubMed/NCBI

25 

Shi HR and Zhang RT: Expression and significance of P53, P21WAF1 and CDK1 proteins in epithelial ovarian cancer. Ai Zheng. 28:882–885. 2009.(In Chinese).

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Que XY, Li Y, Han Y and Li XZ: Effects of siRNA‑mediated Cdc2 silencing on MG63 cell proliferation and apoptosis. Mol Med Rep 7: 466-470, 2013.
APA
Que, X., Li, Y., Han, Y., & Li, X. (2013). Effects of siRNA‑mediated Cdc2 silencing on MG63 cell proliferation and apoptosis. Molecular Medicine Reports, 7, 466-470. https://doi.org/10.3892/mmr.2012.1209
MLA
Que, X., Li, Y., Han, Y., Li, X."Effects of siRNA‑mediated Cdc2 silencing on MG63 cell proliferation and apoptosis". Molecular Medicine Reports 7.2 (2013): 466-470.
Chicago
Que, X., Li, Y., Han, Y., Li, X."Effects of siRNA‑mediated Cdc2 silencing on MG63 cell proliferation and apoptosis". Molecular Medicine Reports 7, no. 2 (2013): 466-470. https://doi.org/10.3892/mmr.2012.1209
Copy and paste a formatted citation
x
Spandidos Publications style
Que XY, Li Y, Han Y and Li XZ: Effects of siRNA‑mediated Cdc2 silencing on MG63 cell proliferation and apoptosis. Mol Med Rep 7: 466-470, 2013.
APA
Que, X., Li, Y., Han, Y., & Li, X. (2013). Effects of siRNA‑mediated Cdc2 silencing on MG63 cell proliferation and apoptosis. Molecular Medicine Reports, 7, 466-470. https://doi.org/10.3892/mmr.2012.1209
MLA
Que, X., Li, Y., Han, Y., Li, X."Effects of siRNA‑mediated Cdc2 silencing on MG63 cell proliferation and apoptosis". Molecular Medicine Reports 7.2 (2013): 466-470.
Chicago
Que, X., Li, Y., Han, Y., Li, X."Effects of siRNA‑mediated Cdc2 silencing on MG63 cell proliferation and apoptosis". Molecular Medicine Reports 7, no. 2 (2013): 466-470. https://doi.org/10.3892/mmr.2012.1209
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team