Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
September 2012 Volume 6 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September 2012 Volume 6 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Inhibitory effect of BMP-2 on the proliferation of breast cancer cells

  • Authors:
    • Anan Chen
    • Dingding Wang
    • Xueting Liu
    • Shuilian He
    • Zhihong Yu
    • Ju Wang
  • View Affiliations / Copyright

    Affiliations: Institute of Bioengineering, College of Life Science and Technology, Jinan University, Guangzhou, Guangdong 510632, P.R. China , Department of Biotechnology, Institute of Life Science and Biological Pharmacy, Guangdong Pharmaceutical University, Guangzhou Higher Education Mega Center, Guangzhou, Guangdong 510006, P.R. China
  • Pages: 615-620
    |
    Published online on: June 21, 2012
       https://doi.org/10.3892/mmr.2012.962
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Bone morphogenetic proteins (BMPs) are involved in diverse biological processes, including cell proliferation, differentiation and apoptosis. Results from the MTT assay revealed that BMP-2 significantly inhibited the proliferation of MDA-MB‑231 and MCF-7 breast cancer cells. The flow cytometric analysis demonstrated that BMP-2 caused G1 arrest and promoted apoptosis. An increase in p21 and cleaved caspase-3 in the two cell lines was detected by western blot analysis, which may be responsible for the suppression of cancer cell proliferation caused by BMP-2. BMP-2 protected MDA-MB-231 and MCF-7 cells from generating xenograft tumors in nude mice. Thus, BMP-2 may be considered as an inhibitor of breast cancer at the early stages of disease.

Introduction

Bone morphogenetic proteins (BMPs) are members of the transforming growth factor-β (TGF-β) superfamily that play important roles in the majority of morphogenetic processes during development. BMPs are able to induce the formation of bone at non-bony sites in adult animals by influencing the differentiation of mesenchymal progenitor cells along the cartilage lineage pathway (1,2). BMPs act not only on osteoblasts and chondrocytes, but also on numerous other cell types, including neuronal cells (3).

BMP-2 signaling involves two types of transmembrane serine/threonine kinases; type I (BRI) and type II (BRII) receptors (4–8). These two types of receptors are required to form a functional complex to initiate further signaling events. BRIs phosphorylate Smad1, Smad5 and Smad8 (R-Smads), which then assemble into heteromeric complexes with Smad4 (Co-Smad), and translocate into the nucleus to regulate the transcription of target genes (9,10). In addition, BMP receptors initiate other signaling pathways, distinct from the Smad pathway, resulting in the activation of p38 MAPK and JNK (11–13).

It has been revealed that BMP-2 is able to inhibit the proliferation of smooth muscle cells, primary glomerular mesangial cells and adrenocortical tumor cells (14–16). In breast cancer cell lines or tumor tissues, BMP-2 expression is often decreased (17,18). Ghosh-Choudhury et al studied the function of BMP2 and reported that BMP-2 led to G1 arrest by inducing the expression of p21 to inhibit the proliferation of breast cancer cells (19,20). However, a number of different lines of evidence have shown that BMP-2 inhibits apoptosis (21,22) rather than inhibiting the proliferation of breast cancer cells (23). The effect of BMP-2 on breast cancer is complicated and unclear, and therefore requires further study.

In this study, BMP-2 significantly inhibited the proliferation of the breast cancer cell lines MDA-MB-231 and MCF-7, by promoting cell cycle G1 arrest and apoptosis, and also inhibited the formation of cancer xenografts in nude mice in vivo.

Materials and methods

Cell culture and animals

Human breast cancer cell lines MDA-MB-231 and MCF-7 were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). MDA-MB-231 cells were maintained in Leiboviz’s L15 medium and MCF-7 cells were maintained in DMEM medium, both supplemented with 10% fetal bovine serum (FBS; HyClone Laboratories, Logan, UT, USA) in humidified air at 37°C. Anti-β-actin, anti-phospho-Smad1/5/8 and anti-cleaved-caspase-3 were obtained from Cell Signaling Technology (Beverly, MA, USA) and anti-Smad1/5/8, HRP-goat anti-rabbit conjugate and HRP-goat anti-mouse conjugate were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). BALB/c nude mice (4–5 weeks) were obtained from the Experimental Animal Research Centre of Zhongshan University and were maintained in a specific pathogen-free laboratory. All procedures involving animals were performed in accordance with the institutional animal welfare guidelines of the Experimental Animal Research Center of Sun Yat-Sen University.

Quantitative polymerase chain reaction (qPCR)

Total cellular RNA was extracted from cell cultures using a TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions, and resuspended in 50 μl of water treated with 0.1% DEPC (Sigma-Aldrich, Seelze, Germany). RNA concentration was determined using a BioPhotometer (Eppendorf Scientific, Hamburg, Germany). Reverse transcription of total RNA (2 μg) primed with an oligo(dT) oligonucleotide was performed using a SuperScript™ III First-Strand Synthesis SuperMix reverse transcription kit (Invitrogen) according to the manufacturer’s instructions. qRT-PCR was performed using an IQ SYBR-Green mix in an iCycler PCR machine (Bio-Rad, Hercules, CA, USA). β-actin was used as the housekeeping control gene. The mean value of 3 wells was calculated, and each experiment was repeated 3 times. The primers (Invitrogen, Shanghai, China) designed for the respective genes are shown in Table I.

Table I

Primers used for real-time PCR.

Table I

Primers used for real-time PCR.

GenesForwardReverse
β-actin ATTGCCGACAGGATGCAGA GAGTACTTGCGCTCAGGAGGA
BMPR1b AATGCCACCATTGTCCA CTAGGCAACCAGAAGTGACCACAG
BMPR1a AGTGTCTCCAGTCAAGCTCTGGGTA CCATCTCTGCTGCTGCGCTCATTTA
BMPR2 TGCAGATGGACGCATGGAA CGGCAAGAGCTTACCCAGTCA
Smad4 CAGCACTACCACCTGGACTGGA CTGGAATGCAAGCTCATTGTGAA
p21 TGAGCCGCGACTGTGATG GTCTCGGTGACAAAGTCGAAGTT

[i] BMPR, bone morphogenetic protein receptor.

Western blot analysis

To determine the effect of BMP-2 on the activation of Smad1/5/8, MDA-MB-231 and MCF-7 cells were starved in serum-free medium overnight to knock down the endogenous level of phosphorylated kinases. Cells were pretreated with 20 μg/l BMP-2 for 15 min, and then solubilized by incubation for 15 min at 4°C in cell lysis solution (Upstate Biotechnology, Inc., Waltham, MA, USA) containing a protease inhibitor cocktail (Roche). The protein concentration of the soluble extracts was determined using a BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA, USA). Separation of 50 μg of total protein was performed on 12% SDS-polyacrylamide gels and was transferred to a polyvinylidene difluoride membrane before immunoblotting with primary antibodies. Equal loading of protein samples was verified with antibodies (dilution, 1:3000) against Smad1/5/8, pi-Smad1/5/8 and β-actin. The specific proteins were detected using an enhanced chemiluminescence detection system (Thermo Fisher Scientific).

MTT assay

MDA-MB-231 and MCF-7 cells were used to detect the antitumor effects of BMP-2. Cells were cultured in 96-well plates (~5,000 cells per well) for 24 h. Cells were then starved with their respective medium plus 1% dialyzed fetal calf serum (A15-107; PAA Laboratories, Linz, Austria) for 24 h. The experiment included a control group and BMP-2 groups (2.5, 5, 10, 20 or 30 μg/l). After 48 h of BMP-2 induction, cell growth was measured using an MTT assay. Absorbance was recorded at 570 nm, with a reference at 630 nm serving as the blank. The effect of BMP-2 on cell viability was assessed as the percentage of cell viability compared with the control cells, which were arbitrarily assigned 100% viability. The mean value of 5 wells was calculated, and each experiment was repeated 3 times.

Flow cytometry

Human breast cancer cell lines MDA-MB-231 and MCF-7 in the logarithmic phase of growth were incubated with 20 μg/l BMP-2 for 24 h. For cell cycle analysis, samples (1×106 cells) were fixed and permeabilized by the addition of 1 ml of ice-cold 70% ethanol for 15 min on ice. Following washing, the cells were resuspended in 125 μl of 1.12% (w/v) sodium citrate containing 0.2 mg/ml RNase (Roche) and incubated for 15 min at 37°C. Propidium iodide (PI; 50 mg/ml; Sigma-Aldrich, St. Louis, MO, USA) was added to the cells for 30 min at room temperature in the dark. The cells were then stored at 4°C until they were assayed by flow cytometry (FACSCalibur; BD Biosciences, Franklin Lakes, NJ, USA). Cell cycle analysis was performed using ModFit LT software (Verity Software House, Inc., Topsham, ME, USA).

Quantification of apoptotic cells

Apoptosis induced by BMP-2 in MDA-MB-231 and MCF-7 cells was determined by flow cytometry using the Annexin V-conjugated Alexa Fluor 488 (Alexa488) Apoptosis Detection kit (Millipore), according to the manufacturer’s instructions. Following overnight serum starvation, cells were treated with BMP-2 (20 μg/l) for 48 h. The cells were then collected, washed in PBS and incubated with Alexa488 and PI for cell staining in the dark at room temperature for 10 min. The stained cells were analyzed by FACS using a FACSCalibur instrument (BD Biosciences) equipped with CellQuest 3.3 software.

Nude mice xenograft model of breast cancer cell lines

BALB/c 4- to-6-week-old female mice, weighing 18–22 g, were randomly divided into 4 groups. Two groups were intravenously injected with 1×107 MDA-MB-231 cells, and the other two groups were intravenously injected with 1×107 MCF-7 cells. The mice (n=6 per group) were treated with either PBS (vehicle) or 20 μg/l BMP-2 via the tail vein daily for 14 days. After the animals were sacrificed, the tumors were weighed.

Statistical analysis

Statistical analysis was performed using the Statistical Package for Social Sciences 13.0 (SPSS). Data were presented as the mean ± SEM. The Student’s t-test (two-tailed) was used to compare the two groups for independent samples assuming equal variances among all experimental data sets. P<0.05 was considered to indicate a statistically significant difference.

Results

BMP-2 signaling pathway assay in MDA-MB-231 and MCF-7 cells

The mRNA expression levels of BMPR1a, BMPR1b, BMPR2 and Smad4 in MDA-MB-231 and MCF-7 breast cancer cell lines are shown in Fig. 1A-D. The expression of the genes increased to varying degrees in the MDA-MB-231 cells when induced by BMP-2 for 24 or 48 h. However, the level of the genes was lower in the MCF-7 cells; only BMPR1a was distinctly upregulated by BMP-2 following 48 h.

Figure 1

Effects of BMP-2 on the BMP pathway of MCF-7 and MDA-MB-231 cells. (A–D) Quantitative real-time PCR analysis of BMPR1a, BMPR1b, BMPR2 and Smad4 mRNA in MCF-7 and MDA-MB-231 cells. The relative expression levels of these genes are shown in the indicated cells treated with 0 or 20 μg/l BMP-2. (E–F) Western blot analysis of the activation of the BMP signal pathway in MCF-7 and MDA-MB-231 cells. β-actin served as the internal control. BMP, bone morphogenetic protein.

Results of the western blot analysis showed that 20 μg/l BMP-2 is able to activate the BMP signaling pathway, which led to the rapid phosphorylation of Smad1/5/8 (Fig. 1E-F). This finding indicated that the BMP signaling pathway remained intact in the MDA-MB-231 and MCF-7 cells.

Inhibitory effect of BMP-2 on the proliferation of breast cancer cells

Cells were induced with 2.5, 5, 10, 20 or 30 μg/l BMP-2 for two days. Results of the MTT assay indicated that the strongest inhibition of BMP-2 on the proliferation of MDA-MB-231 and MCF-7 cells was 30 and 60%, respectively, following the addition of 20 μg/l BMP-2 (Fig. 2A). This finding may be due to the more rapid growth rate of MDA-MB-231 cells compared to MCF-7 cells.

Figure 2

Cell growth in vitro. (A) Effects of BMP-2 on the proliferation of MCF-7 and MDA-MB-231 cells revealed by the MTT assay. Cells were treated with 2.5, 5, 10, 20 or 30 μg/l BMP-2 for 48 h. Growth of the two cell lines was inhibited differently. (B) p21 induction folds were detected in MCF-7 and MDA-MB-231 cells by qRT-PCR after treatment with BMP-2 (20 μg/l) for 24 h. Results shown are representative of three separate experiments yielding similar results. (C) MCF-7 and MDA-MB-231 cells were treated with BMP-2 for 24 h. Cells were collected for cell cycle distribution analysis by flow cytometry. BMP, bone morphogenetic protein.

Effect of BMP-2 on the breast cancer cell cycle

The flow cytometric analysis demonstrated that cells treated with 20 μg/l BMP-2 for two days remained in the G1 phase from 46.7 to 62% in the MDA-MB-231 cells and 63.7 to 70.8% in the MCF-7 cells, respectively. This finding indicated that BMP-2 effectively inhibited cell proliferation by initating G1 arrest (Fig. 2C). BMP-2 was also able to induce a rapid expression of p21 (Fig. 2B), which was in accordance with results by Ghosh-Choudhury et al which revealed that the increase in p21 led to G1 arrest (19,20).

Pro-apoptotic function of BMP-2 on breast cancer cells

In MDA-MB-231 and MCF-7 cells, BMP-2 was able to promote apoptosis following the addition of 20 μg/l BMP-2 for two days. The early apoptotic cells increased from 10.3 to 34.3% in MDA-MB-231 cells (Fig. 3A) and from 1.0 to 7.3% in MCF-7 cells. In addition, there were ~20% of necrotic cells in the MDA-MB-231 cells. We also observed that the expression of cleaved caspase-3 in the two cell lines was upregulated (Fig. 3B and C).

Figure 3

Cell apoptosis in vitro. (A) Apoptosis of MCF-7 and MDA-MB-231 cells incubated with BMP-2 (20 μg/l) for 48 h was detected by flow cytometry. (B–C) Expression of cleaved caspase-3 was detected in the MCF-7 and MDA-MB-231 cells by the western blot analysis following treatment of BMP-2 (20 μg/l) for 24 and 48 h. BMP, bone morphogenetic protein.

Inhibitory effect of BMP-2 on the tumorigenesis of MDA-MB-231 and MCF-7 breast cancer cells in the Balb/c (nu/nu) nude mice xenograft model

Balb/c (nu/nu) nude mice were administered with breast cancer cells and xenograft tumors were allowed to form for 14 days. In the MDA-MB-231 group, subsequent tumor analysis demonstrated that 5/6 mice in the control subgroup generated tumors, while only 1/6 mice in the BMP-2 treatment subgroup generated tumors (Table II). In the remaining 5/6 mice, the cancer cells transplanted were necrotic and pulp-like (Fig. 4). We also found in the MCF-7 group that the mean tumor weights of the control subgroup and BMP-2 treatment subgroup were 0.4690 and 0.1793 g, respectively, demonstrating that BMP-2 was also an inhibitor of tumor formation in MCF-7 cells.

Figure 4

Detection of xenograft tumors in MCF-7 and MDA-MB-231 breast cancer cells in Balb/c (nu/nu) nude mice. The formation of tumors was detected as described in Materials and methods. The inhibitory effect of BMP-2 on the transplanted tumors was distinct in the MCF-7 and MDA-MB-231 groups. BMP, bone morphogenetic protein.

Table II

BMP-2 inhibits tumor formation in the MDA-MB-231 and MCF-7 breast cancer cells in nude mice.

Table II

BMP-2 inhibits tumor formation in the MDA-MB-231 and MCF-7 breast cancer cells in nude mice.

GroupTumor weight (g)Mean (g)P-value
MDA-MB-231
 Control0.31260.27550.5390.29630.32520.24220.33180.004
 BMP-2-----0.36020.0600
MCF-7
 Control0.86120.42010.38150.28310.62000.24800.46900.026
 BMP-20.08140.22920.36550.10210.2974-0.1793

[i] BMP, bone morphogenetic protein; -, no tumor.

Thus, BMP-2 significantly inhibited the formation of tumors in MDA-MB-231 and MCF-7 cells in nude mice (Fig. 4).

Discussion

As previously reported, BMPs described as either growth stimulators or growth inhibitors appear to depend on dosage, type of cells or tissue and tumor microenvironment (24,25). In this study, BMP-2 was found to inhibit cancer cell growth in vitro and in vivo by inducing G1 arrest and apoptosis in MDA-MB-231 and MCF-7 human breast cancer cell lines. The inhibitory effect on cell growth appears to be due to the G1 phase arrest caused by BMP-2-induced p21 upregulation. p21 is able to bind to cyclin E/CDK2 and inhibit CDK2 activity, thereby preventing cells progressing from G1 to S phase (26). Furthermore, the observed increase in cell apoptosis may be correlated with the upregulation of the caspase signaling pathway by BMP-2.

In this study, the expression of BMPRs and Smad4 in MDA-MB-231 cells was higher than that in MCF-7 cells. Furthermore, there was evident auto-enhancement of BMP signaling following the induction of BMP-2 in MDA-MB-231 cells. These results may explain the reason for the inhibitory effect of BMP-2 on tumor formation in MDA-MB-231 cells being stronger than that in MCF-7 cells in vivo.

To the best of our knowledge, this is the first study demonstrating that BMP-2 was able to inhibit MDA-MB-231 and MCF-7 tumor formation in nude mice. Although certain lines of evidence have demonstrated that BMP-2 promotes the metastasis of breast cancer (23,27–28), such an event was not observed in this study. It is worth mentioning that in this study the formation of breast tumors was terminated after two weeks, which may have been an insufficient period of time to observe the metastasis of breast xenograft tumors.

In conclusion, BMP-2 was an inhibitor of early tumor development through the induction of G1 arrest and apoptosis.

Acknowledgements

This study was funded by the Ministry of Science and Technology of China (2009ZX09103-632).

References

1 

Wozney JM, Rosen V, Celeste AJ, et al: Novel regulators of bone formation: molecular clones and activities. Science. 242:1528–1534. 1988. View Article : Google Scholar : PubMed/NCBI

2 

Hogan BL: Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes Dev. 10:1580–1594. 1996. View Article : Google Scholar : PubMed/NCBI

3 

Reddi AH: Role of morphogenetic proteins in skeletal tissue engineering and regeneration. Nat Biotechnol. 16:247–252. 1998. View Article : Google Scholar : PubMed/NCBI

4 

Hoodless PA, Haerry T, Abdollah S, et al: MADR1, a MAD-related protein that functions in BMP2 signaling pathways. Cell. 85:489–500. 1996. View Article : Google Scholar

5 

Nohe A, Hassel S, Ehrlich M, et al: The mode of bone morphogenetic protein (BMP) receptor oligomerization determines different BMP-2 signaling pathways. J Biol Chem. 277:5330–5338. 2002. View Article : Google Scholar : PubMed/NCBI

6 

Liu F, Ventura F, Doody J and Massague J: Human type II receptor for bone morphogenic proteins (BMPs): extension of the two-kinase receptor model to the BMPs. Mol Cell Biol. 15:3479–3486. 1995.PubMed/NCBI

7 

Nohno T, Ishikawa T, Saito T, et al: Identification of a human type II receptor for bone morphogenetic protein-4 that forms differential heteromeric complexes with bone morphogenetic protein type I receptors. J Biol Chem. 270:22522–22526. 1995. View Article : Google Scholar : PubMed/NCBI

8 

Rosenzweig BL, Imamura T, Okadome T, et al: Cloning and characterization of a human type II receptor for bone morphogenetic proteins. Proc Natl Acad Sci USA. 92:7632–7636. 1995. View Article : Google Scholar

9 

Massague J and Chen YG: Controlling TGF-beta signaling. Genes Dev. 14:627–644. 2000.

10 

Attisano L and Wrana JL: Smads as transcriptional co-modulators. Curr Opin Cell Biol. 12:235–243. 2000. View Article : Google Scholar : PubMed/NCBI

11 

Kimura N, Matsuo R, Shibuya H, Nakashima K and Taga T: BMP2-induced apoptosis is mediated by activation of the TAK1-p38 kinase pathway that is negatively regulated by Smad6. J Biol Chem. 275:17647–17652. 2000. View Article : Google Scholar : PubMed/NCBI

12 

Lee KS, Hong SH and Bae SC: Both the Smad and p38 MAPK pathways play a crucial role in Runx2 expression following induction by transforming growth factor-beta and bone morphogenetic protein. Oncogene. 21:7156–7163. 2002. View Article : Google Scholar : PubMed/NCBI

13 

Guicheux J, Lemonnier J, Ghayor C, Suzuki A, Palmer G and Caverzasio J: Activation of p38 mitogen-activated protein kinase and c-Jun-NH2-terminal kinase by BMP-2 and their implication in the stimulation of osteoblastic cell differentiation. J Bone Miner Res. 18:2060–2068. 2003. View Article : Google Scholar : PubMed/NCBI

14 

Johnsen IK, Kappler R, Auernhammer CJ and Beuschlein F: Bone morphogenetic proteins 2 and 5 are down-regulated in adrenocortical carcinoma and modulate adrenal cell proliferation and steroidogenesis. Cancer Res. 69:5784–5792. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Ghosh Choudhury G, Kim YS, Simon M, et al: Bone morphogenetic protein 2 inhibits platelet-derived growth factor-induced c-fos gene transcription and DNA synthesis in mesangial cells. Involvement of mitogen-activated protein kinase. J Biol Chem. 274:10897–10902. 1999.

16 

Wong GA, Tang V, El-Sabeawy F and Weiss RH: BMP-2 inhibits proliferation of human aortic smooth muscle cells via p21Cip1/Waf1. Am J Physiol Endocrinol Metab. 284:E972–E979. 2003. View Article : Google Scholar : PubMed/NCBI

17 

Reinholz MM, Iturria SJ, Ingle JN and Roche PC: Differential gene expression of TGF-beta family members and osteopontin in breast tumor tissue: analysis by real-time quantitative PCR. Breast Cancer Res Treat. 74:255–269. 2002. View Article : Google Scholar : PubMed/NCBI

18 

Alarmo EL and Kallioniemi A: Bone morphogenetic proteins in breast cancer: dual role in tumourigenesis? Endocr Relat Cancer. 17:R123–R139. 2010. View Article : Google Scholar : PubMed/NCBI

19 

Ghosh-Choudhury N, Ghosh-Choudhury G, Celeste A, et al: Bone morphogenetic protein-2 induces cyclin kinase inhibitor p21 and hypophosphorylation of retinoblastoma protein in estradiol-treated MCF-7 human breast cancer cells. Biochim Biophys Acta. 1497:186–196. 2000. View Article : Google Scholar

20 

Ghosh-Choudhury N, Woodruff K, Qi W, Celeste A, Abboud SL and Ghosh Choudhury G: Bone morphogenetic protein-2 blocks MDA MB 231 human breast cancer cell proliferation by inhibiting cyclin-dependent kinase-mediated retinoblastoma protein phosphorylation. Biochem Biophys Res Commun. 272:705–711. 2000. View Article : Google Scholar

21 

Raida M, Clement JH, Ameri K, Han C, Leek RD and Harris AL: Expression of bone morphogenetic protein 2 in breast cancer cells inhibits hypoxic cell death. Int J Oncol. 26:1465–1470. 2005.PubMed/NCBI

22 

Steinert S, Kroll TC, Taubert I, et al: Differential expression of cancer-related genes by single and permanent exposure to bone morphogenetic protein 2. J Cancer Res Clin Oncol. 134:1237–1245. 2008. View Article : Google Scholar : PubMed/NCBI

23 

Pouliot F, Blais A and Labrie C: Overexpression of a dominant negative type II bone morphogenetic protein receptor inhibits the growth of human breast cancer cells. Cancer Res. 63:277–281. 2003.PubMed/NCBI

24 

Alarmo EL, Parssinen J, Ketolainen JM, Savinainen K, Karhu R and Kallioniemi A: BMP7 influences proliferation, migration, and invasion of breast cancer cells. Cancer Lett. 275:35–43. 2009. View Article : Google Scholar : PubMed/NCBI

25 

Kim M and Choe S: BMPs and their clinical potentials. BMB Rep. 44:619–634. 2011. View Article : Google Scholar

26 

Harper JW, Adami GR, Wei N, Keyomarsi K and Elledge SJ: The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell. 75:805–816. 1993. View Article : Google Scholar : PubMed/NCBI

27 

Fong S, Itahana Y, Sumida T, et al: Id-1 as a molecular target in therapy for breast cancer cell invasion and metastasis. Proc Natl Acad Sci USA. 100:13543–13548. 2003. View Article : Google Scholar : PubMed/NCBI

28 

Clement JH, Marr N, Meissner A, et al: Bone morphogenetic protein 2 (BMP-2) induces sequential changes of Id gene expression in the breast cancer cell line MCF-7. J Cancer Res Clin Oncol. 126:271–279. 2000. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chen A, Wang D, Liu X, He S, Yu Z and Wang : Inhibitory effect of BMP-2 on the proliferation of breast cancer cells. Mol Med Rep 6: 615-620, 2012.
APA
Chen, A., Wang, D., Liu, X., He, S., Yu, Z., & Wang, . (2012). Inhibitory effect of BMP-2 on the proliferation of breast cancer cells. Molecular Medicine Reports, 6, 615-620. https://doi.org/10.3892/mmr.2012.962
MLA
Chen, A., Wang, D., Liu, X., He, S., Yu, Z., Wang, ."Inhibitory effect of BMP-2 on the proliferation of breast cancer cells". Molecular Medicine Reports 6.3 (2012): 615-620.
Chicago
Chen, A., Wang, D., Liu, X., He, S., Yu, Z., Wang, ."Inhibitory effect of BMP-2 on the proliferation of breast cancer cells". Molecular Medicine Reports 6, no. 3 (2012): 615-620. https://doi.org/10.3892/mmr.2012.962
Copy and paste a formatted citation
x
Spandidos Publications style
Chen A, Wang D, Liu X, He S, Yu Z and Wang : Inhibitory effect of BMP-2 on the proliferation of breast cancer cells. Mol Med Rep 6: 615-620, 2012.
APA
Chen, A., Wang, D., Liu, X., He, S., Yu, Z., & Wang, . (2012). Inhibitory effect of BMP-2 on the proliferation of breast cancer cells. Molecular Medicine Reports, 6, 615-620. https://doi.org/10.3892/mmr.2012.962
MLA
Chen, A., Wang, D., Liu, X., He, S., Yu, Z., Wang, ."Inhibitory effect of BMP-2 on the proliferation of breast cancer cells". Molecular Medicine Reports 6.3 (2012): 615-620.
Chicago
Chen, A., Wang, D., Liu, X., He, S., Yu, Z., Wang, ."Inhibitory effect of BMP-2 on the proliferation of breast cancer cells". Molecular Medicine Reports 6, no. 3 (2012): 615-620. https://doi.org/10.3892/mmr.2012.962
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team