Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
September 2012 Volume 6 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September 2012 Volume 6 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Microarray analysis of microRNA expression patterns in the semen of infertile men with semen abnormalities

  • Authors:
    • Te Liu
    • Weiwei Cheng
    • Yongtao Gao
    • Hui Wang
    • Zhixue Liu
  • View Affiliations / Copyright

    Affiliations: School of Environmental Science and Engineering, Donghua University, Shanghai 201620, P.R. China, International Peace Maternity and Child Health Hospital, Shanghai Jiaotong University, Shanghai 200030, P.R. China , School of Life Science and Technology, Tongji University, Shanghai 200092, P.R. China
  • Pages: 535-542
    |
    Published online on: June 25, 2012
       https://doi.org/10.3892/mmr.2012.967
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

microRNAs (miRNAs) play a crucial role in tissue development and the pathology of many diseases, however, the effects and roles of miRNAs in the development of semen abnormalities in infertile males have not yet been investigated. In this study, we analyzed and compared the miRNA expression profiles of abnormal semen from 86 infertile males with normal semen from 86 healthy males using an miRNA microarray. In total, 52 miRNAs were differentially expressed between the abnormal semen of infertile males and the normal semen of healthy males. The differential expression of selected miRNAs was validated by real time qRT-PCR and northern blotting: miR-574-5p, miR-297, miR-122, miR-1275, miR-373, miR-185 and miR-193b were upregulated (fold change >1.5, p<0.001) and miR-100, miR-512-3p, miR-16, miR-19b, miR-23b and miR-26a were downregulated (fold change <0.667, p<0.001) in the semen of infertile males with semen abnormalities. In conclusion, this study provides new insights into specific miRNAs that are associated with semen abnormalities in infertile males.

Introduction

Semen abnormalities are a form of male infertility which present in a variety of ways and may prevent the sperm from achieving fertilization (1–4). Previous studies have shown that there are several causes of abnormal semen, including infection with sexually transmitted diseases (STDs), retrograde ejaculation and an inability of the ejaculate to clot properly, all of which can significantly affect male fertility. In addition, sperm abnormalities may be inherited or due to a hormone imbalance, medication or previous infection (5). Narayana et al indicated that O,O-dimethyl O-4-nitrophenyl phosphorothioate could affect the sperm morphology and count in rats (6), and Padmalatha Rai et al demonstrated that the anticancer drug tamoxifen citrate acts as a germ cell mutagen by inducing sperm shape abnormalities in mice in vivo (7). Additionally, Calogero et al reported that a large proportion of patients with oligoasthenoteratozoospermia and teratozoospermia have an increased rate of sperm aneuploidy, and these patients also have semen abnormalities (8). Studies have also indicated that abnormal semen characteristics are induced by testicular cancer (9,10). Although a number of the factors which cause abnormal semen, including chemotherapeutic agents, testicular tumors and microwave radiation (5,11,12) have been identified, differences in epigenetic regulation between normal and abnormal sperm have not been fully investigated.

microRNAs (miRNAs) are a class of naturally occurring single-stranded short 21–23 nt non-coding RNAs (13,14) which exist in a wide range of eukaryotic organisms (13–18). Each mammalian miRNA can prevent the translation of a number of downstream target mRNAs and ultimately lead to the inhibition of target gene expression (19,20). Therefore, a shift away from the targeting of crucial target genes towards miRNA interference techniques may improve the effectiveness of current gene-based diagnostic and therapeutic strategies (15). However, most miRNA studies have focused on the growth and development of stem cells, differentiation, tumorigenesis and other pathological processes (19,20) and have given little consideration to the role of miRNAs in the development of abnormal semen and male infertility.

Several methods, including northern blot analysis, cloning and sequencing strategies, Invader assays, qRT-PCR and sequencing-based assays have been used to determine the expression of miRNAs in biological samples (21). However, miRNA microarrays have become the method of choice for global miRNA profiling studies, as large numbers of molecules can be screened simultaneously using a flexible probe design strategy (21). Additionally, miRNA microarrays provide a powerful tool for the analysis of miRNA expression patterns and quantitative miRNA expression levels. Microarray technology has become the most commonly utilized miRNA research tool, as it is more efficient than time-consuming traditional methods (22–27).

In this study, we used a miRNA microarray-based high throughput approach to identify and quantify the miRNAs that were differentially expressed between the total RNA isolated from the normal semen from healthy males and the abnormal semen from infertile males. The identification of differentially expressed miRNAs in the abnormal semen of infertile males may support further studies to elucidate the causes and characteristics of abnormal semen.

Materials and methods

Patients

The present study involved 86 infertile males (B) with abnormal semen and 86 normal healthy adult males (H) as the control. The samples were collected from the inpatient clinic of the International Peace Maternity and Child Health Hospital of the China Welfare Institute (Shanghai, China) between February and September 2010. All human materials were obtained according to consent regulations and approved by the Ethical Review Committee of the World Health Organization Collaborating Center for Research in Human Reproduction in Shanghai, China as authorized by the Shanghai Municipal Government. Due to material limitations, we could only analyze a limited number of severely abnormal sperm samples.

Semen collection and assessment of semen function

Semen samples were produced by masturbation, collected in sterile containers and immediately transported to the laboratory. A conventional semen profile was obtained for each sample using the procedures described by the World Health Organization (10).

Total RNA extraction

Total RNA was isolated from each semen sample using the TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions (28,29). The RNA samples were treated with DNase I (Sigma-Aldrich, St. Louis, MO, USA) and then quantified.

miRNA microarray analysis

RNA labeling and hybridization were performed on miRNA microarray chips as previously described (25,27,30). Briefly, 50 μg of total RNA was purified using the mirVana miRNA isolation kit (Ambion, Austin, TX, USA) to enrich the small RNA fraction. The purified RNA was labeled with fluorescein and hybridized using the CapitalBio mammalian miRNA array V3.0 (CapitalBio Corporation, Beijing, China) containing 2844 mature miRNA gene oligonucleotide probes in triplicate, corresponding to 1823 human, 648 mouse and 373 rat miRNAs. Each individual’s semen RNA was analyzed on a separate chip. Finally, scanned images of the microarray were captured and the hybridization signals were quantified. The signal intensity values were normalized to per-chip mean values.

Total RNA extraction and reverse transcription into cDNA

Following the detection of total RNA, we used a Poly(A) Tailing kit (Ambion) to add a poly(A) tail to the RNA products according to the kit’s instructions. The RNA samples were treated with DNase I, quantified and reverse-transcribed into cDNA using the ReverTra Ace-α First Strand cDNA Synthesis kit (Toyobo, Osaka, Japan). Notably, this reverse transcription reaction uses the oligo(dT) reverse transcription primer 5′-GCTGTCAACGATACGCTACCTAACGGCATGACAGTGTTTTTTTTTTTTTTT(C/G/A)-3′. All reaction steps were carried out according to the manufacturer’s instructions.

Quantitative real-time PCR validation miRNA expression

In accordance with the manufacturer’s instructions and as previously described (23), qRT-PCR was conducted in the realplex4 real-time PCR detection system from Eppendorf (Hamburg, Germany), using SYBR® Green RealTime PCR Master mix (Toyobo) as the detection dye. The qRT-PCR amplification process comprised 40 cycles of denaturation at 95°C for 10 sec and annealing at 57°C for 20 sec. The target cDNA was quantified using a relative quantification method. A comparative threshold cycle (Ct) was used to quantify the gene expression relative to the control (calibrator). The steady-state mRNA levels were expressed as an n-fold difference relative to the calibrator. For each sample, the Ct values were normalized using the formula: ΔCt = CtmiRNA − Ct18S rRNA. To detemine relative expression levels, the following formula was used: ΔΔCt = ΔCtB − ΔCtH. The values used to plot the relative miRNA expression levels were calculated using the expression 2−ΔΔCt. The miRNA levels were calibrated by 18S rRNA. The miRNA primers used in the cDNA amplification are shown in Table I.

Table I

The miRNA qRT-PCR primers used in the study.

Table I

The miRNA qRT-PCR primers used in the study.

Accession no.miRNAqRT-PCR primers (5′→3′)
MI0003581miR-574-5p 5′-TGAGTGTGTGTGTGTGAGTGTGT-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000063let-7b 5′-CTATACAACCTACTGCCTTCCC-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0005775miR-297 5′-ATGTATGTGTGCATGTGCATG-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000442miR-122 5′-AACGCCATTATCACACTAAATA-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0006415miR-1275 5′-GTGGGGGAGAGGCTGTC-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0006428miR-1281 5′-TCGCCTCCTCCTCTCCC-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000781miR-373 5′-GAAGTGCTTCGATTTTGGGGTGT-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000482miR-185 5′-AGGGGCTGGCTTTCCTCTGGTC-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0003137miR-193b 5′-AACTGGCCCTCAAAGTCCCGCT-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000461miR-145 5′-GGATTCCTGGAAATACTGTTCT-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000290miR-214 5′-ACAGCAGGCACAGACAGGCAGT-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000089miR-31 5′-TGCTATGCCAACATATTGCCAT-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0003513miR-455-3p 5′-GCAGTCCATGGGCATATACAC-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000102miR-100 5′-CAAGCTTGTATCTATAGGTATG-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0003161miR-517a 5′-ATCGTGCATCCCTTTAGAGTGT-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0003140miR-512-3p 5′-AAGTGCTGTCATAGCTGAGGTC-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000070miR-16 5′-CCAGTATTAACTGTGCTGCTGA-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0003153miR-523 5′-GAACGCGCTTCCCTATAGAGGGT-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000074miR-19b 5′-TGTGCAAATCCATGCAAAACTGA-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000439miR-23b 5′-ATCACATTGCCAGGGATTACC-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000083miR-26a 5′-CCTATTCTTGGTTACTTGCACG-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)

[i] miRNA, microRNA; qRT-PCR, quantitative real-time PCR.

Northern blot analysis

All steps in the northern blotting process were carried out as previously described (28,29). For all samples, 20 μg good quality total RNA was analyzed on a 7.5 M urea 12% PAA denaturing gel and transferred to a Hybond-N+ nylon membrane (Amersham, Freiburg, Germany). The membranes were crosslinked using UV light for 30 sec at 1200 mJ/cm2. Hybridization was performed using miRNA antisense StarFire probes to detect the 22-nt miRNA fragments, according to the manufacturer’s instructions. After washing, the membranes were exposed for 20–40 h to Kodak XAR-5 films (Sigma-Aldrich). The ethidium bromide-stained gels prior to the transfer of tRNA were used as controls to ensure equal loading of the RNA samples.

Statistical analysis

Each experiment was performed at least three times and data are the mean ± SE, where applicable. Differences were evaluated using the Student’s t-test. p<0.05 was considered to indicate a statistically significant result.

Results

Comparison of the characteristics and semen parameters of the healthy males and infertile males

A total of 172 males were invited to participate in this study: 86 healthy males with normal semen and 86 infertile males with semen abnormalities. The only significant difference between the populations was the percentage of progressive motile (a+b) forms (p<0.001). The results of laboratory tests indicated that asthenozoospermia was the most frequent finding in the 86 infertile males. The characteristics of the study participants are presented in Table II.

Table II

Comparison of the clinical characteristics of the infertile males with semen abnormalities and the healthy adult males.

Table II

Comparison of the clinical characteristics of the infertile males with semen abnormalities and the healthy adult males.

ParameterInfertile males (n=86)Healthy males (n=86)
Age (years)32±1 (27–41)32±2 (29–42)
Volume (ml)1.92±0.08 (1–2)2
Concentration (105/ml)97.59±18.05 (24.0–224.7)57.37±13.17 (39.0–117.4)
a+b (%)23.11±5.03 (0–46.2)45.17±6.34 (12.6–65.7)
a+b+c (%)32.85±5.52 (5.9–63.3)62.66±5.72 (49.3–82.6)
Total RNA quality analysis

A 260 to 280 nm absorbance ratio (260/280)>1.8 is usually considered to be an acceptable indicator of RNA purity for miRNA microarrays and indicates an absence of detectable protein contamination in the RNA sample (15). Following the extraction of total RNA from the samples, the 260/280 ratio of each extract was determined using a spectrophotometer (15,31). The 260/280 ratios ranged from 1.83 to 1.97. Formaldehyde denaturing gel electrophoresis was used to confirm the presence of clear 28S, 18S and 5S bands (Fig. 1) and the absence of marked RNA degradation. This analysis indicated that the purity and integrity of each RNA sample met the requirements of the miRNA microarray and qRT-PCR experiments (15).

Figure 1

Differential miRNA expression patterns in the abnormal semen of infertile males and the semen of healthy adult males. (A) Gel electrophoresis analysis of semen total RNA. [B] is the sample from the 86 infertile males with semen abnormalities and [H] is the sample from the 86 healthy adult males. (B) Morphocytology of the abnormal semen from infertile males. Abnormal semen (arrows) and healthy semen were observed; original magnification ×400. (C) Representative microarray hybridization signals for the RNA isolated from the abnormal semen of infertile males [B] and the normal semen of healthy adult males [H]. The two subarrays of each microarray are marked, as well as the 16 controls and 2844 oligonucleotide probes. (D) miRNA microarray clustering tree (left) and sample clustering tree (top) for the 86 infertile males with semen abnormalities and the 86 healthy adult males. The same amount of total RNA was used on each slide, so the hybridization signals are normalized according to the total RNA concentration. The colour scale illustrates the miRNA expression levels across all samples: red denotes expression above the mean, blue denotes expression lower than the mean and grey represents a signal lower than the background. miRNA, microRNA.

miRNA microarray quality control and results analysis

In order to identify miRNAs which are differentially expressed between the abnormal semen of infertile males and the normal semen of healthy males, we prepared a miRNA microarray containing 2844 oligonucleotide probes (1823 human, 648 mouse and 373 rat) complementary to known mammalian miRNAs (23,24,32). All probes were repeated three times in each microarray and each microarray contained 16 controls (Zip5, Zip13, Zip15, Zip21, Zip23, Zip25, Y2, Y3, U6, New-U2-R, tRNA-R, has-let-7a, has-let-7b, has-let-7c, 50% DMSO and Hex). In order to increase the reliability of the results, each miRNA microarray assay was repeated twice (24) and the scatter plots for all spots indicated that a high reproducibility and reliability were achieved (Fig. 2A).

Figure 2

Confirmation of the differential expression of miRNAs in the abnormal semen from infertile males using qRT-PCR. (A) Scatter plots of the expression levels of miRNAs in the semen of 10 infertile males with semen abnormalities [B] and 10 healthy adult males [H] determined by qRT-PCR. Compared with the normal semen from healthy adult males, seven miRNAs were overexpressed and six miRNAs were underexpressed in abnormal semen. (B) Scatter plot showing the averaged background-subtracted raw intensity for each miRNA probe in the semen of 10 infertile males with semen abnormalities [B] and the normal semen of 10 healthy adult males [H]; each dot represents one miRNA probe. (C) Correlation between the microarray results and the qRT-PCR analysis. The 21 miRNAs which were identified by the microarray as being differentially expressed in the abnormal semen of infertile males were also tested by qRT-PCR. The differential expression of 13 miRNAs was confirmed by the two methods (overlap). The correlation was arbitrarily determined as a similar miRNA expression change in each assay. miRNA, microRNA; qRT-PCT, quantitative real-time PCR.

The miRNA expression patterns for abnormal semen from infertile males (B) and normal semen from healthy males (H) were compared. Significance analysis of microarray (SAM) and a fold change criterion (B/H ratio) >1.50 or <0.667 and p<0.001 were used to identify significant differences (32,33). Using these criteria, we identified 52 miRNAs which were differentially expressed between the semen of infertile males and normal males. Analysis of the microarray expression levels confirmed that 21 miRNAs (mi-574-5p, let-7b, miR-297, miR-122, miR-1275, miR-1281, miR-373, miR-185, miR-193b, miR-145, miR-214, miR-574-3p, miR-483-5p, miR-324-3p, miR-372, miR-484, miR-933, miR-663, miR-1268, miR-923 and miR-1234) were significantly overexpressed in the abnormal semen compared with the normal semen. Conversely, 31 miRNAs (miR-1826, miR-493, miR-371-5p, miR-516a-5p, miR-512-5p, miR-498, miR-30a, miR-23a, miR-130a, miR-103, miR-30b, miR-27a, miR-18a, miR-525-3p, miR-517c, miR-199b-3p, miR-517b, miR-107, miR-199a-3p, miR-1323, miR-515-5p, miR-31, miR-455-3p, miR-100, miR-517a, miR-512-3p, miR-16, miR-523, miR-19b, miR-23b and miR-26a) were significantly underexpressed in the abnormal semen compared with the normal semen (Table III).

Table III

Summary of the SAM results for miRNA expression in the abnormal semen of infertile males and the normal semen of healthy adult males.

Table III

Summary of the SAM results for miRNA expression in the abnormal semen of infertile males and the normal semen of healthy adult males.

miRNAFold change (B/H)Mature miRNA sequenceChromosome locationSequence length (nt)
miR-574-5p7.0715 UGAGUGUGUGUGUGUGAGUGUGU423
let-7b5.7958 UGAGGUAGUAGGUUGUGUGGUU2222
miR-2974.8753 AUGUAUGUGUGCAUGUGCAUG421
miR-1222.7916 UGGAGUGUGACAAUGGUGUUUG1822
miR-12752.3772 GUGGGGGAGAGGCUGUC617
miR-12811.9876 UCGCCUCCUCCUCUCCC2217
miR-3731.9799 GAAGUGCUUCGAUUUUGGGGUGU1923
miR-1851.9584 UGGAGAGAAAGGCAGUUCCUGA2222
miR-193b1.9558 AACUGGCCCUCAAAGUCCCGCU1622
miR-1451.9218 GUCCAGUUUUCCCAGGAAUCCCU523
miR-2141.9027 ACAGCAGGCACAGACAGGCAGU122
miR-574-3p1.7689 CACGCUCAUGCACACACCCACA422
miR-483-5p1.7640 AAGACGGGAGGAAAGAAGGGAG1122
miR-324-3p1.7295 ACUGCCCCAGGUGCUGCUGG1720
miR-3721.7001 AAAGUGCUGCGACAUUUGAGCGU1923
miR-4841.6988 UCAGGCUCAGUCCCCUCCCGAU1622
miR-9331.6101 UGUGCGCAGGGAGACCUCUCCC222
miR-6631.6083 AGGCGGGGCGCCGCGGGACCGC2022
miR-12681.6016 CGGGCGUGGUGGUGGGGG1518
miR-9231.5892 GUCAGCGGAGGAAAAGAAACU1721
miR-12341.5736 UCGGCCUGACCACCCACCCCAC822
miR-18260.6548 AUUGAUCAUCGACACUUCGAACGCAAU1627
miR-4930.6536 UGAAGGUCUACUGUGUGCCAGG1422
miR-371-5p0.6517 ACUCAAACUGUGGGGGCACU1920
miR-516a-5p0.6441 UUCUCGAGGAAAGAAGCACUUUC1923
miR-512-5p0.6322 CACUCAGCCUUGAGGGCACUUUC1923
miR-4980.6191 UUUCAAGCCAGGGGGCGUUUUUC1923
miR-30a0.6070 UGUAAACAUCCUCGACUGGAAG622
miR-23a0.6058 AUCACAUUGCCAGGGAUUUCC1921
miR-130a0.5913 CAGUGCAAUGUUAAAAGGGCAU1122
miR-1030.5886 AGCAGCAUUGUACAGGGCUAUGA2023
miR-30b0.5771 UGUAAACAUCCUACACUCAGCU822
miR-27a0.5577 UUCACAGUGGCUAAGUUCCGC1921
miR-18a0.4980 UAAGGUGCAUCUAGUGCAGAUAG1323
miR-525-3p0.4817 GAAGGCGCUUCCCUUUAGAGCG1922
miR-517c0.4783 AUCGUGCAUCCUUUUAGAGUGU1922
miR-199b-3p0.4700 ACAGUAGUCUGCACAUUGGUUA922
miR-517b0.4672 UCGUGCAUCCCUUUAGAGUGUU1922
miR-1070.4641 AGCAGCAUUGUACAGGGCUAUCA1923
miR-199a-3p0.4452 ACAGUAGUCUGCACAUUGGUUA1922
miR-13230.4352 UCAAAACUGAGGGGCAUUUUCU1922
miR-515-5p0.4279 UUCUCCAAAAGAAAGCACUUUCUG1924
miR-310.4137 AGGCAAGAUGCUGGCAUAGCU921
miR-455-3p0.4117 GCAGUCCAUGGGCAUAUACAC921
miR-1000.3938 AACCCGUAGAUCCGAACUUGUG1122
miR-517a0.3889 AUCGUGCAUCCCUUUAGAGUGU1922
miR-512-3p0.3884 AAGUGCUGUCAUAGCUGAGGUC1922
miR-160.3455 UAGCAGCACGUAAAUAUUGGCG1322
miR-5230.3075 GAACGCGCUUCCCUAUAGAGGGU1923
miR-19b0.2670 UGUGCAAAUCCAUGCAAAACUGA1323
miR-23b0.2616 AUCACAUUGCCAGGGAUUACC921
miR-26a0.2221 UUCAAGUAAUCCAGGAUAGGCU1222

[i] SAM, significance analysis of microarray; B/H, ratio of miRNA expression in the abnormal semen of infertile males [B] to that in the normal semen of healthy adult males [H].

qRT-PCR confirmation of the miRNA microarray results

Following common procedures for the confirmation of microarray analysis (23,24,32–34), qRT-PCR was used to confirm the results of the miRNA microarray analysis. Of the 11 miRNAs identified by the microarray as being the most overexpressed in the abnormal semen of infertile males compared with normal semen (miR-574-5p, let-7b, miR-297, miR-122, miR-1275, miR-1281, miR-373, miR-185, miR-193b, miR-145 and miR-214), qRT-PCR confirmed that seven (miR-574-5p, miR-297, miR-122, miR-1275, miR-373, miR-185 and miR-193b) were overexpressed. Of the ten miRNAs identified as being underexpressed in abnormal semen by the microarray (miR-31, miR-455-3p, miR-100, miR-517a, miR-512-3p, miR-16, miR-523, miR-19b, miR-23b and miR-26a), the qRT-PCR analysis confirmed that six of these (miR-100, miR-512-3p, miR-16, miR-19b, miR-23b and miR-26a) were underexpressed.

Scatter plot analysis of the qRT-PCR results confirmed that seven miRNAs (miR-574-5p, miR-297, miR-122, miR-1275, miR-373, miR-185 and miR-193b) were overexpressed and six miRNAs (miR-100, miR-512-3p, miR-16, miR-19b, miR-23b and miR-26a) were underexpressed in the semen of infertile males compared with the normal semen (Fig. 2B).

A Venn diagram (Fig. 2C) was used to depict the correlation between the results of the miRNA microarray and the 21 miRNAs tested by qRT-PCR. The differential expression of 13 miRNAs (miR-574-5p, miR-297, miR-122, miR-1275, miR-373, miR-185, miR-193b, miR-100, miR-512-3p, miR-16, miR-19b, miR-23b and miR-26a) in the abnormal semen of the infertile males was confirmed by qRT-PCR (indicated by the overlap in the diagram). The expression levels of the other miRNAs correlated in some or other methods. Overall, the qRT-PCR analysis indicated that the miRNA microarray results had some small errors, however, it confirmed that a significant number of miRNAs are differentially regulated in the abnormal semen of infertile males.

Northern blot validation of miRNA expression

The expression levels of the 13 miRNAs which were confirmed to be differently expressed by qRT-PCR were further investigated by northern blotting of the RNA isolated from the abnormal semen of three infertile males and the normal semen of three healthy adult males. Anti-sense miRNA locked nucleic acid probes were used for each miRNA (Fig. 3). The northern blotting hybridization signals for miR-574-5p, miR-297, miR-122, miR-1275, miR-373, miR-185 and miR-193b were weaker in the semen of healthy adult controls than that of the infertile males, confirming that these miRNAs are upregulated in the abnormal semen. The miR-100, miR-512-3p, miR-16, miR-19b, miR-23b and miR-26a hybridization bands were barely detectable and, therefore, we could not confirm the differential regulation of these miRNAs using northern blotting.

Figure 3

Northern blot analysis of the differential expression of miRNAs in abnormal semen from infertile men. Representative hybridization signals for the expression of the indicated miRNAs in abnormal semen from infertile males [B] and normal semen from healthy adult males [H].

Discussion

Mature miRNAs are an abundant class of 21–23 nt non-coding RNAs which regulate the expression of their target genes and are involved in many biological processes (15,21,23,24,32–34). To date, more than 1600 miRNAs have been identified in plants, animals and viruses (16,21,35,36). It is currently estimated that miRNAs account for approximately 1% of all predicted genes and that up to 30% of the genes in higher eukaryotic genomes may be regulated by miRNAs (21); therefore, many miRNAs remain to be identified in mammalian genomes. Little is known concerning the patterns or levels of miRNA expression in the abnormal semen of infertile males (24,33).

The aim of the study was to identify which miRNAs are differentially expressed between abnormal and normal sperm, in order to provide a foundation for future studies on the function and role of miRNAs in semen abnormalities. We profiled the expression of a number of miRNAs using a miRNA microarray and demonstrated that the expression of 52 miRNAs was significantly different in the abnormal semen of infertile males compared with the semen of healthy males. These results suggest that miRNAs are involved in the development of male infertility associated with semen abnormalities.

We used qRT-PCR to confirm the expression levels of 21 of the 52 miRNAs which were differentially expressed in the microarray. In total, 13 of the 21 miRNAs tested were identified as being differentially expressed in abnormal semen by the microarray and qRT-PCR. Although, there were some discrepancies in the results of the microarray and the qRT-PCR analysis, the miRNA microarray provided a rapid method for identifying a large number of differentially expressed miRNAs in abnormal semen which could then be confirmed by qRT-PCR.

This study describes the global expression patterns of miRNAs in the abnormal semen from infertile males and contributes to the growing understanding of the role of miRNAs in the development of semen abnormalities. Moreover, the differential expression patterns of miRNAs between normal and abnormal semen may enable the direct diagnosis of semen abnormalities or provide novel therapeutic targets for infertile males.

Acknowledgements

This study was supported by a grant from the Shanghai Committee Medical Science Foundation of China (No. 10411967100) to Te Liu.

References

1 

Zenzmaier C, Gerth R, Gruschwitz M, Lindner H, Plas E and Berger P: Decreased levels of genuine large free hCG alpha in men presenting with abnormal semen analysis. Reprod Biol Endocrinol. 9:1142011. View Article : Google Scholar : PubMed/NCBI

2 

Hu W, Yang H, Sun J, et al: Polymorphisms in CYP1B1 modify the risk of idiopathic male infertility with abnormal semen quality. Clin Chim Acta. 412:1778–1782. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Chatzimeletiou K, Sioga A, Oikonomou L, et al: Semen analysis by electron and fluorescence microscopy in a case of partial hydatidiform mole reveals a high incidence of abnormal morphology, diploidy, and tetraploidy. Fertil Steril. 95:e2431–e2435. 2011. View Article : Google Scholar

4 

Moretti E, Castellini C, Mourvaki E, et al: Distribution of α- and δ-tocopherols in seminal plasma and sperm fractions of men with normal and abnormal semen parameters. J Androl. 32:232–239. 2011.

5 

Kowalczuk CI, Saunders RD and Stapleton HR: Sperm count and sperm abnormality in male mice after exposure to 2.45 GHz microwave radiation. Mutat Res. 122:155–161. 1983. View Article : Google Scholar : PubMed/NCBI

6 

Narayana K, Prashanthi N, Nayanatara A, Kumar HH, Abhilash K and Bairy KL: Effects of methyl parathion (O,O-dimethyl O-4-nitrophenyl phosphorothioate) on rat sperm morphology and sperm count, but not fertility, are associated with decreased ascorbic acid level in the testis. Mutat Res. 588:28–34. 2005. View Article : Google Scholar : PubMed/NCBI

7 

Padmalatha Rai S and Vijayalaxmi KK: Tamoxifen citrate induced sperm shape abnormalities in the in vivo mouse. Mutat Res. 492:1–6. 2001.PubMed/NCBI

8 

Calogero AE, De Palma A, Grazioso C, et al: Aneuploidy rate in spermatozoa of selected men with abnormal semen parameters. Hum Reprod. 16:1172–1179. 2001. View Article : Google Scholar : PubMed/NCBI

9 

Jacobsen R, Bostofte E, Engholm G, et al: Risk of testicular cancer in men with abnormal semen characteristics: cohort study. BMJ. 321:789–792. 2000. View Article : Google Scholar : PubMed/NCBI

10 

Torra R, Sarquella J, Calabia J, et al: Prevalence of cysts in seminal tract and abnormal semen parameters in patients with autosomal dominant polycystic kidney disease. Clin J Am Soc Nephrol. 3:790–793. 2008. View Article : Google Scholar

11 

Ravnborg TL, Jensen TK, Andersson AM, Toppari J, Skakkebaek NE and Jørgensen N: Prenatal and adult exposures to smoking are associated with adverse effects on reproductive hormones, semen quality, final height and body mass index. Hum Reprod. 26:1000–1011. 2011. View Article : Google Scholar

12 

Barratt CL, Björndahl L, Menkveld R and Mortimer D: ESHRE special interest group for andrology basic semen analysis course: a continued focus on accuracy, quality, efficiency and clinical relevance. Hum Reprod. 26:3207–3212. 2011. View Article : Google Scholar

13 

Sumazin P, Yang X, Chiu HS, et al: An extensive microRNA-mediated network of RNA-RNA interactions regulates established oncogenic pathways in glioblastoma. Cell. 147:370–381. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Poulton JS, Huang YC, Smith L, et al: The microRNA pathway regulates the temporal pattern of Notch signaling in Drosophila follicle cells. Development. 138:1737–1745. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Lei P, Li Y, Chen X, Yang S and Zhang J: Microarray based analysis of microRNA expression in rat cerebral cortex after traumatic brain injury. Brain Res. 1284:191–201. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function (Review). Cell. 116:281–297. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Yoo AS, Sun AX, Li L, et al: MicroRNA-mediated conversion of human fibroblasts to neurons. Nature. 476:228–231. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Dai Y, Diao Z, Sun H, Li R, Qiu Z and Hu Y: MicroRNA-155 is involved in the remodelling of human-trophoblast-derived HTR-8/SVneo cells induced by lipopolysaccharides. Hum Reprod. 26:1882–1891. 2011. View Article : Google Scholar : PubMed/NCBI

19 

He L and Hannon GJ: MicroRNAs: small RNAs with a big role in gene regulation (Review). Nat Rev Genet. 5:522–531. 2004. View Article : Google Scholar : PubMed/NCBI

20 

El Ouaamari A, Baroukh N, Martens GA, Lebrun P, Pipeleers D and van Obberghen E: miR-375 targets 3′-phosphoinositide-dependent protein kinase-1 and regulates glucose-induced biological responses in pancreatic beta-cells. Diabetes. 57:2708–2717. 2008.

21 

Yang Y, Bai W, Zhang L, et al: Determination of microRNAs in mouse preimplantation embryos by microarray. Dev Dyn. 237:2315–2327. 2008. View Article : Google Scholar : PubMed/NCBI

22 

Calin GA, Liu CG, Sevignani C, et al: MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias. Proc Natl Acad Sci USA. 101:11755–11760. 2004. View Article : Google Scholar : PubMed/NCBI

23 

Bloomston M, Frankel WL, Petrocca F, et al: MicroRNA expression patterns to differentiate pancreatic adenocarcinoma from normal pancreas and chronic pancreatitis. JAMA. 297:1901–1908. 2007. View Article : Google Scholar : PubMed/NCBI

24 

Yan N, Lu Y, Sun H, et al: A microarray for microRNA profiling in mouse testis tissues. Reproduction. 134:73–79. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Wang LL, Zhang Z, Li Q, et al: Ethanol exposure induces differential microRNA and target gene expression and teratogenic effects which can be suppressed by folic acid supplementation. Hum Reprod. 24:562–579. 2009. View Article : Google Scholar : PubMed/NCBI

26 

Barshack I, Meiri E, Rosenwald S, et al: Differential diagnosis of hepatocellular carcinoma from metastatic tumors in the liver using microRNA expression. Int J Biochem Cell Biol. 42:1355–1362. 2010. View Article : Google Scholar : PubMed/NCBI

27 

Li W, Xie L, He X, et al: Diagnostic and prognostic implications of microRNAs in human hepatocellular carcinoma. Int J Cancer. 123:1616–1622. 2008. View Article : Google Scholar : PubMed/NCBI

28 

Cheng W, Liu T, Jiang F, et al: microRNA-155 regulates angiotensin II type 1 receptor expression in umbilical vein endothelial cells from severely pre-eclamptic pregnant women. Int J Mol Med. 27:393–399. 2011.PubMed/NCBI

29 

Zhang L, Liu T, Huang Y and Liu J: microRNA-182 inhibits the proliferation and invasion of human lung adenocarcinoma cells through its effect on human cortical actin-associated protein. Int J Mol Med. 28:381–388. 2011.PubMed/NCBI

30 

Li S, Chen X, Zhang H, et al: Differential expression of microRNAs in mouse liver under aberrant energy metabolic status. J Lipid Res. 50:1756–1765. 2009. View Article : Google Scholar : PubMed/NCBI

31 

Wang WX, Wilfred BR, Baldwin DA, et al: Focus on RNA isolation: obtaining RNA for microRNA (miRNA) expression profiling analyses of neural tissue. Biochim Biophys Acta. 1779:749–757. 2008. View Article : Google Scholar : PubMed/NCBI

32 

Liu HH, Tian X, Li YJ, Wu CA and Zheng CC: Microarray-based analysis of stress-regulated microRNAs in Arabidopsis thaliana. RNA. 14:836–843. 2008. View Article : Google Scholar : PubMed/NCBI

33 

Wu H, Neilson JR, Kumar P, et al: miRNA profiling of naive, effector and memory CD8 T cells. PLoS One. 2:e10202007. View Article : Google Scholar : PubMed/NCBI

34 

Kuhn DE, Nuovo GJ, Martin MM, et al: Human chromosome 21-derived miRNAs are overexpressed in down syndrome brains and hearts. Biochem Biophys Res Commun. 370:473–477. 2008. View Article : Google Scholar : PubMed/NCBI

35 

Ambros V: The functions of animal microRNAs (Review). Nature. 431:350–355. 2004. View Article : Google Scholar : PubMed/NCBI

36 

Du T and Zamore PD: microPrimer: the biogenesis and function of microRNA (Review). Development. 132:4645–4652. 2005. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu T, Cheng W, Gao Y, Wang H and Liu Z: Microarray analysis of microRNA expression patterns in the semen of infertile men with semen abnormalities. Mol Med Rep 6: 535-542, 2012.
APA
Liu, T., Cheng, W., Gao, Y., Wang, H., & Liu, Z. (2012). Microarray analysis of microRNA expression patterns in the semen of infertile men with semen abnormalities. Molecular Medicine Reports, 6, 535-542. https://doi.org/10.3892/mmr.2012.967
MLA
Liu, T., Cheng, W., Gao, Y., Wang, H., Liu, Z."Microarray analysis of microRNA expression patterns in the semen of infertile men with semen abnormalities". Molecular Medicine Reports 6.3 (2012): 535-542.
Chicago
Liu, T., Cheng, W., Gao, Y., Wang, H., Liu, Z."Microarray analysis of microRNA expression patterns in the semen of infertile men with semen abnormalities". Molecular Medicine Reports 6, no. 3 (2012): 535-542. https://doi.org/10.3892/mmr.2012.967
Copy and paste a formatted citation
x
Spandidos Publications style
Liu T, Cheng W, Gao Y, Wang H and Liu Z: Microarray analysis of microRNA expression patterns in the semen of infertile men with semen abnormalities. Mol Med Rep 6: 535-542, 2012.
APA
Liu, T., Cheng, W., Gao, Y., Wang, H., & Liu, Z. (2012). Microarray analysis of microRNA expression patterns in the semen of infertile men with semen abnormalities. Molecular Medicine Reports, 6, 535-542. https://doi.org/10.3892/mmr.2012.967
MLA
Liu, T., Cheng, W., Gao, Y., Wang, H., Liu, Z."Microarray analysis of microRNA expression patterns in the semen of infertile men with semen abnormalities". Molecular Medicine Reports 6.3 (2012): 535-542.
Chicago
Liu, T., Cheng, W., Gao, Y., Wang, H., Liu, Z."Microarray analysis of microRNA expression patterns in the semen of infertile men with semen abnormalities". Molecular Medicine Reports 6, no. 3 (2012): 535-542. https://doi.org/10.3892/mmr.2012.967
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team