This article is mentioned in:

Introduction

Retroviruses, found in all mammals and in a wide range of other vertebrates, provide unique opportunities to study the biology and evolution of virus-host relationships. Occasionally, infection of a germline cell by a retrovirus may lead to an integrated provirus that is passed to the offspring and inherited in a Mendelian fashion; known as an endogenous retrovirus (ERV). Human endogenous retroviruses (HERVs) constitute ~8% of the human genome and are distributed in ~700,000 different loci (1). Expression of HERVs has been associated with several positive physiological functions as well as certain diseases, although their role as an etiological agent, a possible contributing factor or a disease marker remains to be established (2).

The proviral structure of HERV elements mainly consists of 5′LTR-gag-pro-pol-env-3′LTR, in which the 4 genes (gag, group-specific antigen; pro, protease; pol, polymerase; and env, envelope) encode structural/functional proteins essential to a replication-competent retrovirus (3). The long terminal repeats (LTRs) at both ends differentiate HERVs from other retrotransposons, such as long interspersed nuclear elements (LINEs). The majority of the remnants of HERVs are simply isolated LTR copies, with the internal sequence having been lost during integration or via homologous recombination. HERV families are defined by different criteria, such as homogeneity to their exogenous counterparts, sequence similarity of the pol genes and the primer binding site (PBS) immediately downstream of the 5′LTR. H family HERV (HERV-H) contain a PBS with a sequence similar to human tRNAHis(4).

HERV-H is one of the most abundant endogenous retroviral families in the human genome, consisting of full-length elements (~100 copies, of which only 18 are relatively complete) (3), elements deleted in pol and env [800–900 copies, of which only 3 have been identified to contain intact env open reading frames (ORFs)] (5), and solitary LTRs (~1,000 copies) (6). HERV-H was inserted into primate genomes prior to the divergence of New and Old World monkeys, and the elements lacking in pol and env were integrated with the Old World monkey lineage (5,7,8). HERV-H env fragments are found on human chromosomes 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, X and Y. These new HERV-H env fragments showed 82–99% sequence similarity to that of HERV-H. The HERV-H members evolved by intra-chromosomal spread during hominid radiation (9).

Using the inter-retrotransposon amplified polymorphism (IRAP) technique, which is one of the retrotransposon-based markers, regions flanked by two LTR-retrotransposons or solo LTRs are amplified (10). In this method, polymorphisms are detected by the presence or absence of the PCR product, where the lack of amplification indicates the absence of a retrotransposon at that particular region (11). IRAP was used to investigate genetic relationships between different and related species (12), for gene mapping (13) and for the characterization of the somaclonal variants in plants (14–16).

ERVs differ between host species, most likely in correlation with differences in expression conditions, and in the evolutionary and environmental history of each host (17). There are very limited data on environmentally and developmentally (ED) regulated genomic variation. Further research is required to understand the cytogenetic, DNA-structural and gene regulation basis of ED-genomic variation, and to study the importance of ED-genomic variation for population genetics, adaptation, domestication, evolution, medical science, plant science and agriculture (18).

In recent years, there have been a number of studies on the different expression profiles of HERV-H in various clinical situations (3,19,20). However, there are no data on HERV-H provirus integration variations between healthy individuals. In this study, we report the HERV-H integration polymorphisms between healthy individuals.

Materials and methods

Subjects

This study included 20 individuals (10 males and 10 females; age, 18–30 years) with different ethnic origins (Turkey, Azerbaijan, Indonesia, China and Somalia; Table I). The study design was approved as a Master’s Thesis (Project no. T-17640) by the Istanbul University, Istanbul, Turkey. The blood samples were collected by the Istanbul University Medico-Social Center, Istanbul, Turkey. Blood samples were obtained by the Istanbul University Medico-Social Center, Turkey, with the written consent of the healthy individuals.

Table I Evaluation forms of subjects.

Table I

Evaluation forms of subjects.

				Exposure to
Subject	Gender	Age (years)	Ethnic group	Radiation	Infectious disease
1	M	28	Asia (Azerbaijan)	x
2	M	21	Asia (Azerbaijan)	x
3	M	19	Asia (Azerbaijan)	x	x
4	F	24	Asia (Azerbaijan)		x
5	M	26	Asia (Azerbaijan)
6	F	23	Asia (Azerbaijan)
7	M	28	Asia (Azerbaijan)	x
8	M	28	Asia (Iran - Azerbaijan)	x
9	F	23	Asia (Turkey)
10	F	25	Asia (China-Eastern Turkmenistan)	x	x
11	F	23	Asia (Turkey)
12	M	22	Asia (Turkey)		x
13	F	22	Asia (Turkey)	x
14	M	22	Asia (Turkey)
15	F	22	Asia (Turkey)	x
16	M	23	Asia (Turkey)		x
17	F	20	Asia (Turkey)
18	F	20	Asia (Indonesia)	x
19	F	22	Africa (Somali)
20	M	24	Asia (Turkey)	x

Genomic DNA isolation

Genomic DNA was extracted from blood samples using a High Pure PCR Template Preparation kit (Roche Diagnostics, Mannheim, Germany). The DNA concentrations were measured using a spectrophotometer (Nanodrop2000) and genomic DNA samples were separated on an EtBr-stained, 1% agarose gel to estimate the quality of the DNA.

IRAP analysis

HERV-H integration polymorphisms were investigated using the IRAP technique. LTR primers were used for IRAP analysis. The primers shown in Table II were designed using the online primer design site of Integrated DNA Technologies (http://eu.idtdna.com/PrimerQuest/Home/Index). A pair of primers was designed for each LTR7A, LTR7B and LTR7C region. HERV-H LTR sequences were obtained from a relevant database (www.girinst.org, AC D11078). PCR was performed using a thermal cycler (Techne, TC3000) in a total volume of 20 μl, containing 75 ng of template DNA, 10 μM of forward and reverse primers and SapphireAmp Master Mix (2X). PCR conditions were as follows: initial denaturation at 95°C (3 min) followed by 30 cycles of denaturation at 94°C (30 sec), annealing at 65°C for LTR7A, 68.2°C for LTR7B and 67°C for LTR7C (30 sec) and extension at 72°C (3 min). The reaction was completed by an additional extension at 72°C for 5 min. A total of 20 μl of IRAP-PCR products were mixed with 4 μl 6X loading buffer (10 mM Tris-HCl, 60 mM EDTA, pH 8.0, 0.3% bromophenol blue, 60% glycerol) and resolved by 2% agarose gel electrophoresis at 180 V for 2 h in 1X TAE buffer (90 mM Tris, 90 mM boric acid and 2 mM EDTA, pH 8.0). A molecular weight marker (GeneRuler™ DNA Ladder Mix, SM0331, Fermentas, Waltham, MA, USA) was also loaded to determine the size of the amplicons. After running, the gels were photographed on a UV transilluminator and analyzed visually using Kodak Molecular Imaging Software (1994–2007 Carestream Health, Inc., Rochester, NY, USA).

Table II Primers used for IRAP analyses for HERV-H integration polymorphism study.

Table II

Primers used for IRAP analyses for HERV-H integration polymorphism study.

Primers	G + C ratio (%)	Tm (°C)	Sequence (5′-3′)
LTR7A
Forward	50	72	TGTTTGGTGGTCTCTTCACACGGA
Reverse	50	72	ATGGTATGGCTTAGCTTGGGCTCA
LTR7B
Forward	50	72	TGTTTGGTGGTCTCTTCACACGGA
Reverse	50	72	ATGATGGCTTAGCTTGGGCTCAGA
LTR7C
Forward	50	72	TTGCACCCAAGTGAATAAACGGCC
Reverse	50	72	TTACAATGGCTGAGCTTCGGCTCA

[i] IRAP, inter-retrotransposon amplified polymorphism; HERV-H, human endogenous retrovirus-H; Tm, melting temperature.

Statistical analysis

Polymorphism rates were calculated using Jaccard similarity coefficient and the scores were evaluated statistically by ANOVA test. P<0.05 was considered to indicate a statistically significant difference.

Results

IRAP-PCR analyses using HERV-H LTR7A primers with 20 human DNA samples are shown in Fig. 1. Kodak Molecular Imaging Software analyses are presented in Fig. 2. As can be observed in Fig. 2, polymorphisms between individuals were between 0–86%. Under the same experimental conditions with HERV-H LTR7B primers, we also observed polymorphisms (Fig. 3). Using Kodak Molecular Imaging Software, the polymorphism rate between the individuals was calculated to be between 0–87% with HERV-H LTR7B (Fig. 2). These polymorphism rates were used to calculate the p value by ANOVA test. The polymorphism rates between individuals were found to be significant (P≤0.05). However, we were not able to detect any amplification products using HERV-H LTR7C primers. No significant data were obtained by comparison of the ethnic groups. In the Azerbaijani group, variations were calculated to be between 2.65–9.73% in terms of HERV-H LTR7A and 1.40–5.63% in terms of HERV-H LTR7B.

Figure 1 Inter-retrotransposon amplified polymorphism (IRAP)-PCR analyses using human endogenous retrovirus (HERV)-H LTR7A primers.

Figure 2 Polymorphism calculation using HERV-H LTR7A and HERV-H LTR7B primers by Jaccard similarity coefficient.

Figure 3 Inter-retrotransposon amplified polymorphism (IRAP)-PCR analyses using human endogenous retrovirus (HERV)-H LTR7B primers.

Discussion

In the present study, LTR7A (450 bp), LTR7B (445 bp) and LTR7C (471 bp) regions of HERV-H were analyzed by IRAP-PCR and the integration patterns between the individuals were compared. Blood samples from 20 individuals of various ethnic origins were used for determination of the integration variations at the genomic level. Isolated genomic DNA was screened using 3 pairs of primers covering LTR regions of the HERV-H gene. The IRAP technique was performed for polymorphism analyses. We observed integration polymorphism patterns in all the tested individuals. To date, there has been no report on HERV-H integration polymorphisms between individuals; however, there are limited reports on integration polymorphisms of HERV-K families (21–23). Recently, database documentation relating to Alu retrotransposon insertion polymorphisms (RIPs) was presented (24).

Insertion polymorphism of retroelements (REs) has also attracted considerable attention due to certain advantageous features that make REs useful tools for human population genetic studies (25–27). These include known ancestral state (absence of the RE), stability of insertion (there are no mechanisms for removing inserted repeats) and relatively easy detection. Moreover, an event of two independent integrations into one and the same locus is very improbable, making this type of polymorphism essentially homoplasy-free (28,29). Previously, a number of cases of RIPs have been studied for evolutionarily young groups of short interspersed elements (SINEs) and long interspersed elements (LINEs) (30,31). Although insertion polymorphisms of HERVs appear to be a rare event, in our study we observed a high number of insertion polymorphisms between individuals in terms of HERV-H insertion. We were not able to observe significant differences between ethnic groups, since we observed different degrees of polymorphisms between all the test subjects.

The HERV-H family is the largest group among the HERVs (19,32) with ~100 copies of full-length HERV-H elements, 800–900 copies of HERV-H lacking pol and env genes and solitary LTRs (up to ~1000 copies) in the human genome (6,19). HERV-H elements integrated into the primate genome 40 million years ago and their numbers have been increasing over the past 30–35 million years (8,19,32). Our results showed that HERV-H is still active in the human genome. These data are also important from an evolutionary point of view.

HERV-H contains regions of the gene caused by mutations known to be due to integration into the human genome. An important gene mutation of retroviruses in the env ORF was detected (33). The total size of HERV-H is 9 kb in the human genome and HERV-H has ORFs for gag, pro, pol and env genes. LTR sequences have variants of 1.1% due to mutations in the env gene. Research on the env gene has demonstrated new alternative reading frames (8,22) and env expression was observed in normal tissues and colon tumors.

To date, HERV-H research has been focused in particular on investigating the relationship between neurological diseases, cancer and gene expression (19,20). In our study we were able to observe, for the first time, that major genomic variations between individuals derive from the integration of various elements. These polymorphic HERVs may be associated with diseases. A gene that has an RIP may have potential alternative transcripts, a promoter activity of alternative splice sites, or create a poly-A signal (35).

IRAP is a valuable technique for searching the retrotransposon movements in the plant kingdom (11,15). We also demonstrated that this valuable technique can be successfully applied to human research. Although the experiment was conducted with a limited number of subjects, we were able to observe polymorphisms and variants of inter-retrotransposon regions. Our data may contribute to the understanding of the variation of HERV-H in human populations. This study provides new research areas on possible integration sites, and the existence of infectious HERV-H variants may also be considered.

Acknowledgements

This study was supported by the Istanbul University Research Foundation Project (no. T-17640).

References