Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
December 2013 Volume 8 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December 2013 Volume 8 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

TGF-β‑induced miR10a/b expression promotes human glioma cell migration by targeting PTEN

  • Authors:
    • Shihai Liu
    • Junfeng Sun
    • Qing Lan
  • View Affiliations / Copyright

    Affiliations: Department of Neurosurgery, The Second Affiliated Hospital of Suzhou University, Suzhou, Jiangsu 215004, P.R. China, Department of Surgical Oncology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310003, P.R. China
  • Pages: 1741-1746
    |
    Published online on: October 1, 2013
       https://doi.org/10.3892/mmr.2013.1709
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Human gliomas are associated with high rates of morbidity and mortality. In the brain, increased mRNA levels of transforming growth factor β (TGF‑β) correlate with the degree of malignancy of human gliomas. miR10a/10b expression has been demonstrated to be associated with TGF‑β expression in brain tumors, and it is reported that TGF‑β induces miR10 expression. Therefore, miR10a/10b expression may be induced by TGF‑β expression and may be involved in the TGF‑β‑induced migration of brain tumor cells. The present study examined the expression of TGF‑β and miR10a/10b in the tissues of 10 patients with brain tumors using quantitative PCR (qPCR), and the correlation between TGF‑β and miR10a or miR10b expression was analyzed. Additionally, U251 and SHG‑44 cells were treated with TGF‑β and the expression of miR10a/10b was examined. Further, cell migration was analyzed following transfection of U251 cells with miR10a/10b and the association between miR10a/10b and phosphatase and tensin homolog deleted on chromosome 10 (PTEN) was investigated. U251 cells were transfected with miR10a/10b inhibitors and a PTEN expression plasmid prior to TGF‑β treatment and then cell migration was assessed. A significant correlation was identified between TGF‑β and miR10a expression (r2=0.6936, P=0.007) and between TGF‑β and miR10b expression (r2=0.5876, P=0.02) in the tissues of patients with brain tumors. The results also showed that TGF‑β induces miR10a/10b expression and that TGF‑β‑induced miR10a/10b expression promotes cell migration through the suppression of PTEN. In conclusion, TGF‑β‑induced miR10a/10b promotes brain tumor migration. This study may provide a number of suggestions for the clinical treatment of brain tumors.

Introduction

Human gliomas are one of the main types of malignancy in the central nervous system. Gliomas are the most aggressive form of brain tumor and are associated with high rates of morbidity and mortality (1). Despite the recent advances in surgery, radiotherapy and chemotherapy, the survival chances of patients with glioma remain poor. The median overall survival of patients with malignant glioma is <1 year and local recurrence occurs in >90% of patients (2). As the survival rates of cancer patients improve, the incidence of brain metastases is rising (3). Transforming growth factor β (TGF-β) promotes cancer metastases (4).

TGF-β is a multifunctional cytokine involved in the regulation of cell proliferation, differentiation and survival or apoptosis of numerous types of cell. It induces epithelial mesenchymal transition (EMT) through the activation of downstream signaling pathways, including Smad and non-Smad signaling pathways. TGF-β induces Akt activation through PI3K during EMT in various cell types. Once activated, Akt initiates the mTOR signaling pathway which is involved in cell survival, growth, migration and invasion (5). In the brain, TGF-β is normally expressed at a very low level, which increases markedly following injury. Increased mRNA levels of the three TGF-β isoforms (5) correlate with the degree of malignancy of human gliomas (6). Blocking the action of TGF-β inhibits tumor viability, migration and metastases in mammary cancer, melanoma and prostate cancer models.

MicroRNAs (miRNAs), a class of small noncoding RNAs, are a novel type of gene expression regulator as they target mRNAs for translational repression or cleavage. Deregulation of miRNAs has been demonstrated in a variety of tumors, including breast cancer, leukemia, lung cancer and colon cancer, which indicates a significant correlation between miRNAs and human tumor malignancy (7). miRNAs are targets for anticancer therapies as their activity is efficiently blocked by sequence-specific oligonucleotides or other antisense approaches (8). miR10a and miR10b have been demonstrated to be upregulated in glioblastomas and anaplastic astrocytomas, reaching >100-fold overexpression in certain cases (9,10). The miRNAs miR10a and miR10b are close homologs, differing by a single central nucleotide. In the mouse embryo, miR10a is mainly expressed in a region of the posterior trunk (11), whereas miR10a in adult mice is broadly expressed, with the highest levels identified in the kidney, muscle, lung and liver. The miR10a homolog miR10b is highly overexpressed in several tumor types and is reportedly involved in the progression of cancer (12).

miR10a regulates the metastatic properties of hepatocellular cancer (HCC) by directly targeting EphA4 (13) and is involved in the metastatic behavior of pancreatic cancer (14). The homolog of miR10a, miR10b, has been suggested to enhance the migration and invasion of metastatic breast cancer cells by repressing the translation of HoxD10 (15–17). In addition, it is reported that miR-10b is expressed in glioma tumors but not in normal brain cells, neural progenitor cells or mature glia or neurons (18–20). Therefore, miR10a/10b is considered a target for anti-glioma therapy (21).

The present study investigated whether miR10a/10b expression is associated with TGF-β expression levels in brain tumor tissues. It has previously been reported that TGF-β induces miR10a expression in Treg cells (22). Furthermore, the present study evaluated the hypothesis that the 3′ untranslated region (3′UTR) of phosphatase and tensin homolog deleted on chromosome 10 (PTEN) contains binding sequences for miR10a and miR10b. Tumor suppressor PTEN is a dual-specific phosphatase that is a negative regulator of the PI3K-AKT-mTOR signaling pathway, thus controlling a variety of processes associated with cell survival, proliferation and growth (23). Therefore, the theory that miR10a and miR10b are induced by TGF-β and involved in TGF-β-induced metastasis by suppressing PTEN expression in brain tumors was evaluated.

Materials and methods

Human tissue samples

Fresh, frozen human brain tumor samples were obtained from the Department of Neurosurgery at the Integrated Chinese and Western Medicine Hospital of Zhejiang Province (Hangzhou, China). The study protocol was approved by the institutional Ethics Committee of the Integrated Chinese and Western Medicine Hospital of Zhejiang Province and informed consent was obtained from all patients or patients’ families.

Cell cultures and treatment

Human glioma U251 and SHG-44 cells were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). The U251 and SHG-44 cells were cultured in RPMI-1640 medium (Gibco-BRL, Carlsbad, CA, USA) supplemented with 10% fetal calf serum (PAA Laboratories GmbH, Linz, Austria) at 37°C under 5% humidified CO2 and 100 μg/ml each of streptomycin and penicillin G was added (Amresco, Solon, OH, USA). Cells were treated with TGF-β (5 ng/ml) and were transfected with miR10a and/or 10b mimics, miR10a and/or 10b inhibitors (Guangzhou RiboBio Co., Ltd., Guangzhou, China) or the PTEN expression plasmid pCDNA3.1-PTEN.

RNA isolation and quantitative PCR (qPCR)

RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA, USA). Total RNA (1μg) was reverse-transcribed using a RevertAid First Strand cDNA Synthesis kit (Fermentas, Waltham, MA, USA). miR10a/10b, U6, TGF-β, PTEN and β-actin expression levels were measured using SYBR-Green (Roche, Mannheim, Germany). The expression of each target gene was determined by triplicates from three to six separate experiments and normalized using β-actin and miR10a/10b normalized using U6. qPCR Assays-on-Demand were performed using the ABI PRISM 7300 Sequence Detection system 2.1 (PE Applied Biosystems, Foster City, CA, USA) using relative quantification. Analysis and fold differences were determined using the comparative cycle threshold (CT) method. Fold change was calculated from the ΔΔCT values with the formula 2−ΔΔCT.

Western blot analysis

Anti-PTEN and anti-GAPDH rabbit monoclonal antibodies were obtained from Cell Signaling Technology, Inc. (Danvers, MA, USA). Protein (100 μg) was subjected to 12% SDS-PAGE and transferred onto polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA). The membranes were blocked for 1 h in PBST (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.05% Tween-20) containing 2% nonfat dried milk. Subsequently, Anti PTEN (1:1,000) and anti GAPDH (1:1,000) rabbit monoclonal antibodies were incubated with the membranes. After 2 h, the primary antibodies were washed and the mouse anti-rabbit secondary antibodies (Cell Signaling Technology) were incubated with the membranes. Protein bands were detected by an enhanced chemiluminescence reaction (ECL Detection; Millipore).

Migration assay

The migration assay was performed using 24-well transwell chambers (8 μm; Millipore). The U251 cells transfected with miR10a/10b mimics, miR10a/10b inhibitors or pCDNA3.1-PTEN were suspended in RPMI-1640 medium without serum and 2×104 cells were seeded onto Matrigel™ inserts in triplicate. They were then placed into a 24-well culture plate containing 500 μl RPMI-1640 medium with or without 5 ng/ml TGF-β. Following culture for a total of 48 h, cells on the upper side of the filters were removed with cotton-tipped swabs and the filters were washed with PBS. Cells on the underside of the filters were examined and counted under a microscope. Images were obtained with four randomly selected fields from each insert The number of cells in each field was counted and averaged. Migration is expressed as fold increase compared with the control.

Constructs for luciferase reporter assays

Primers were designed to the region of the PTEN 3′UTR believed to contain miR10a/b binding sequences using Primer Premier 5 (Premier Biosoft, Palo Alto, CA, USA). The primers were as follows: forward, AATGGCAATAGGACATTGTG and reverse, TACATGACACAGCTACACAA. The PTEN 3′UTR fragment was cloned from human genomic DNA into the pGL3-control-luciferase vector (Promega, Madison, WI, USA). Constructed plasmids were confirmed by sequencing.

Luciferase assays

Cells were plated in 24-well plates at a density of 1.5×104 cells per well. Each well received 250 ng of a pGL3-pro-luciferase reporter and 5 ng of a Renilla luciferase reporter (Promega). The cells were harvested using Passive Lysis buffer (Promega) following co-transfection with PTEN 3′UTR constructs and miR10a/10b or their inhibitor for 24 h. Luciferase and Renilla luciferase activities were determined using a Dual-Luciferase Reporter assay system (Promega) in a Plate Chameleon luminometer (BioScan, Inc., Washington, DC, USA). Firefly luciferase was normalized by Renilla luciferase to correct for transfection efficiency. Fold induction was determined by dividing the averaged normalized values from each treatment by the control value for each transfection condition within that experiment. Values were averaged from multiple experiments, as indicated in the figure legends.

Statistical analysis

Statistical analyses were performed using GraphPad Prism 5.01 software, version (GraphPad Software, San Diego, CA, USA). Two-tailed Student’s t-tests were used for the pair-wise comparison of experimental groups. Statistical significance was defined at the ≥95% confidence interval or P≤0.05. In each figure, asterisks indicate significant differences from the controls (P<0.05). Bar graphs represent the mean ± standard error of the mean of the number of independent experiments indicated in each figure legend. In addition, the analysis of the correlations among miR10a/10b, TGF-β and PTEN expression in human glioma patients was conducted by bivariate analysis using Spearman’s correlation coefficient.

Results

miR10a/10b expression is associated with TGF-β expression levels in human glioma samples

The expression of TGF-β and miR10a/10b was measured in the tissues of 10 patients with brain tumors using qPCR. The correlation between TGF-β and miR10a or miR10b expression was analyzed according to the method described in Materials and methods. As shown in Fig. 1, there was a significant association between TGF-β and miR10a expression (r2=0.6936, P=0.007) and between TGF-β and miR10b expression (r2=0.5876, P=0.02) in the tissues of the patients with brain tumors.

Figure 1

miR10a and 10b expression is associated with TGF-β expression levels in the tumor tissues of glioma patients. (A) Spearman’s correlation coefficient [rs]=r2=0.6936, P=0.007 (miR10a). (B) r2=0.5876, P=0.02 (miR10b). TGF-β, transforming growth factor β.

TGF-β promotes migration and miR10a/10b expression in glioma cells

TGF-β is believed to promote cell EMT and migration. As miR10a/10b expression is associated with the expression levels of TGF-β in brain tumor patients and it is reported that miR10a/b also promotes cell migration, further investigations were carried out to determine whether miR10a/10b is the direct target gene of TGF-β. U251 and SHG-44 cells were treated with TGF-β, and the levels of miR10a/10b expression were measured by qPCR (Fig. 2). The miR10a and miR10b expression levels were significantly upregulated by TGF-β in the two cell lines (Fig. 2A and B). Concentration-response experiments demonstrated a maximal miR10a/10b induction with 10 ng/ml TGF-β after 12 h of treatment in U251 and SHG-44 cells, which was ~5–8 fold above that in the control groups (Fig. 2C and D). Since 5 ng/ml TGF-β is close to the physiological concentration (24), this concentration was used in the following experiments.

Figure 2

TGF-β induces the expression of miR10a and miR10b in U251 and SHG-44 cells. miR10a/10b expression was determined by qPCR as described in Materials and methods. (A) U251 cells and (B) SHG-44 cells were treated with 5 ng/ml TGF-β for the time indicated and as described in Materials and methods; (C) U251 cells and (D) SHG-44 cells were treated with the different concentrations of TGF-β as indicated. The results are shown as the mean ± SE. from three representative independent experiments. *P<0.05, **P<0.01 compared with the control. TGF-β, transforming growth factor beta.

TGF-β-induced miR10a/10b expression strengthens glioma cell migration

To define the functional impact of TGF-β-induced miR10a/10b expression, a migration assay was conducted as described in Materials and methods. miR10a and miR10b mimics were transfected into U251 cells and after 24 h, miR10a and miR10b expression was evaluated by qPCR. As shown in Fig. 3A, the miR10a and miR10b mimics significantly increased the expression levels of miR10a/10b and their inhibitors significantly decreased the expression levels of miR10a/10b compared with the control levels. Following transfection with miR10a/10b mimics or inhibitors, U251 cell migration was assessed. As shown in Fig. 3B, treatment of U251 cells with miR10a/10b mimics resulted in brain tumor cell migration. However, in cells pretreated with miR10a/10b inhibitor, cell migration was inhibited (Fig. 3C).

Figure 3

miR10a and miR10b promote human glioma cell migration. (A) miR10a/10b mimics and inhibitors were transfected into U251 cells for 24 h, then miR10a and miR10b expression was confirmed by qPCR for transfection efficiency analysis. (B) miR10a and miR10b mimics and (C) miR10a and miR10b inhibitors were transfected or co-transfected into U251 cells for 48 h. Cell migration was then assessed using a transwell assay. The results are shown as the mean ± SE. from three representative independent experiments. *P<0.05, **P<0.01 compared with the control.

TGF-β-induced miR10a/10b expression promotes glioma cell migration through targeting PTEN

PTEN as a tumor suppressor inhibits cell proliferation and migration by blocking PI3K-AKT signaling. Through online software [miRanda (http://diana.cslab.ece.ntua.gr/microT/), TargetScan (http://www.targetscan.org/) and PicTar (http://pictar.mdc-berlin.de/)], it was identified that the PTEN 3′UTR contains binding sequences for miR10a and miR10b (Fig. 4A). To further establish that miR10a/10b targets PTEN, miR10a and miR10b mimics and inhibitors were transfected into U251 cells. The results demonstrated that miR10a and miR10b mimics downregulated PTEN expression levels and their inhibitors upregulated PTEN expression levels (Fig. 4B and C). Furthermore, the luciferase reporter analysis results identified that miR10a and miR10b mimics significantly suppressed the expression of a luciferase reporter gene fused to the 3′UTR region of PTEN, which was reversed by the further introduction of a miR10a/10b inhibitor in U251 cells (Fig. 4D). These results confirmed that miR10a/10b suppresses PTEN expression through binding to its 3′UTR. To further investigate whether TGF-β-induced cell migration occurs through miR10a/10b targeting PTEN, U251 cells were transfected with miR10a/10b inhibitors or the pCDNA3.1-PTEN plasmid prior to TGF-β treatment. After 48 h, the migrated cells were analyzed and the results demonstrated that the miR10a/10b inhibitor inhibits TGF-β-induced cell migration and that the PTEN overexpression plasmid has a similar effect to the inhibitor (Fig. 5A). These results indicate that TGF-β-induced miR10a/10b expression inhibits PTEN expression, which results in brain tumor cell migration.

Figure 4

miR10a and 10b target PTEN. (A) The PTEN 3′UTR has binding sequences for miR10a and miR10b. (B) U251 cells were transfected with the indicated miRNAs for a total of 24 h. PTEN expression was evaluated by qPCR. (B) U251 cells were transfected with the indicated miRNAs for a total of 48 h. (C) Representative western blots of PTEN and GAPDH are shown. (D) The luciferase activity of U251 cells was measured following co-transfection with the indicated PTEN 3′UTR constructs and miR10a/10b or their inhibitor for 24 h. The results are shown as the mean ± SE. from three representative independent experiments. **P<0.01 vs control. PTEN, phosphatase and tensin homolog deleted on chromosome 10; 3′UTR, 3′ untranslated region.

Figure 5

TGF-β-induced miR10a/10b promotes glioma cell migration through targeting PTEN. (A) Prior to TGF-β treatment, U251 cells were transfected with miR10a/10b inhibitors or a PTEN expression plasmid for a total of 48 h. Subsequently, cell migration was analyzed. The results are shown as the mean ± SE. from three representative independent experiments. Correlations of the expression levels of (B) miR10a and (C) miR10b with that of PTEN in brain tumor patients *P<0.05, **P<0.01 vs control. TGF-β, transforming growth factor beta; PTEN, phosphatase and tensin homolog deleted on chromosome 10.

miR10a/10b expression positively correlates with PTEN expression in clinical human glioma patients

As TGF-β-induced miR10a and miR10b expression promotes cell migration via targeting PTEN, it was further investigated whether PTEN expression was associated with the miR10a/10b expression detected in the cells of human clinical glioma specimens. As shown in Fig. 5B and C, PTEN and miR10a/10b expression is correlated in brain tumor patients.

Discussion

Metastatic brain tumors are malignant neoplasms that spread to the brain from elsewhere in the body and represent the most common neurologic manifestation of cancer, occurring in up to 15% of cancer patients. Brain metastases are the most common type of intracranial tumor in adults, accounting for ~40% of intracranial neoplasms (25). With the improving survival rates of cancer patients, the incidence of brain metastases has been rising (2).

TGF-β elicits tumor-promoting effects through its ability to induce EMT, which enhances invasiveness and metastasis (26). TGF-β induces EMT through the activation of downstream signaling pathways, including Smad and non-Smad signaling pathways. TGF-β induces Akt activation through PI3K during EMT in various cell types. Once activated, Akt initiates the mTOR signaling pathway which is involved in cell survival, growth, migration and invasion (5).

It has been reported that TGF-β promotes the expression of miR181b, miR192 and miR21 (27–29). In addition, Takahashi et al reported that TGF-β induced the expression of miR10a in Treg cells (22). The present study demonstrated that TGF-β promotes the expression of miR10a and miR10b.

The microRNAs miR10a and mi10b enhance cell migration. The homolog of miR10a, miR10b, has been suggested to enhance tumor cell migration and the invasion of metastatic breast cancer cells by repressing the translation of HoxD10 (16). In addition, miR10a is believed to regulate the metastatic properties of HCC by directly targeting EphA4 (13). miR-10b inhibits translation of the mRNA of HOXD10, a transcription factor known for its roles in cell motility, resulting in the increased expression of a pro-metastatic gene, RHOC. It also promotes the cell migration and invasion of human esophageal squamous cell carcinoma cells by the direct regulation of KLF4 (30). In addition, miR-10b targets neurofibromin 1 mRNA, leading to the activation of RAS signaling in neurofibromatosis type I (31). The overexpression of miR10b in non-metastatic cell lines has been demonstrated to promote tumor invasion and metastasis in a xenograft mouse model (21).

TGF-β-induced miR10a/10b targets PTEN. It has been reported that PTEN, an important tumor suppressor, is regulated by multiple miRNAs (32). It has also been demonstrated that miR21 increases tumor cell proliferation, migration and invasion through targeting PTEN (33). The present study indicated that miR10a and miR10b target PTEN.

In conclusion, the present study demonstrated that miR10a/10b expression is associated with TGF-β expression in human glioma tissues and it further affirmed that TGF-β induces the expression of miR10a/10b in human glioma cells. Furthermore, it demonstrated that TGF-β-induced miR10a/10b expression promotes the migration of human glioma cells through targeting the tumor suppressor, PTEN. This study may provide a number of suggestions for human glioma clinical treatment.

References

1 

Chan XH, Nama S, Gopal F, Rizk P, Ramasamy S, Sundaram G, et al: Targeting glioma stem cells by functional inhibition of a prosurvival oncomiR-138 in malignant gliomas. Cell Rep. 2:591–602. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Zhang X, Yang H, Gong B, Jiang C and Yang L: Combined gene expression and protein interaction analysis of dynamic modularity in glioma prognosis. J Neurooncol. 107:281–288. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Mathupala SP, Mittal S, Guthikonda M and Sloan AE: MicroRNA and brain tumors: a cause and a cure? DNA Cell Biol. 26:301–310. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Fu H, Hu ZL, Wen JF, Wang KS and Liu Y: TGF-β promotes invasion and metastasis of gastric cancer cells by increasing fascin1 expression via ERK and JNK signal pathways. Acta Biochim Biophys Sin (Shanghai). 41:648–656. 2009.

5 

Kaminska B, Kocyk M and Kijewska M: TGF beta signaling and its role in glioma pathogenesis. Adv Exp Med Biol. 986:171–187. 2013. View Article : Google Scholar : PubMed/NCBI

6 

Connolly EC, Freimuth J and Akhurst RJ: Complexities of TGF-β targeted cancer therapy. Int J Biol Sci. 8:964–978. 2012.

7 

Nicoloso MS and Calin GA: MicroRNA involvement in brain tumors: from bench to bedside. Brain Pathol. 18:122–129. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Hwang HW and Mendell JT: MicroRNAs in cell proliferation, cell death, and tumorigenesis. Br J Cancer. 94:776–780. 2006. View Article : Google Scholar : PubMed/NCBI

9 

Gaur A, Jewell DA, Liang Y, Ridzon D, Moore JH, Chen C, Ambros VR and Israel MA: Characterization of microRNA expression levels and their biological correlates in human cancer cell lines. Cancer Res. 67:2456–2468. 2007. View Article : Google Scholar : PubMed/NCBI

10 

Pang JC, Kwok WK, Chen Z and Ng HK: Oncogenic role of microRNAs in brain tumors. Acta Neuropathol. 117:599–611. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Mansfield JH, Harfe BD, Nissen R, Obenauer J, Srineel J, Chaudhuri A, et al: MicroRNA-responsive ‘sensor’ transgenes uncover Hox-like and other developmentally regulated patterns of vertebrate microRNA expression. Nat Genet. 36:1079–1083. 2004.

12 

Garzon R, Pichiorri F, Palumbo T, Iuliano R, Cimmino A, Aqeilan R, et al: MicroRNA fingerprints during human megakaryocytopoiesis. Proc Natl Acad Sci USA. 103:5078–5083. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Yan Y, Luo YC, Wan HY, et al: MicroRNA-10a is involved in the metastatic process by regulating Eph tyrosine kinase receptor A4-mediated epithelial-mesenchymal transition and adhesion in hepatoma cells. Hepatology. 57:667–677. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Weiss FU, Marques IJ, Woltering JM, Vlecken DH, Aghdassi A, Partecke LI, et al: Retinoic acid receptor antagonists inhibit miR-10a expression and block metastatic behaviour of pancreatic cancer. Gastroenterology. 137:2136–2145. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Ørom UA, Nielsen FC and Lund AH: MicroRNA-10a binds the 5′UTR of ribosomal protein mRNAs and enhances their translation. Mol Cell. 30:460–471. 2008.PubMed/NCBI

16 

Ma L, Teruya-Feldstein J and Weinberg RA: Tumour invasion and metastasis initiated by microRNA-10b in breast cancer. Nature. 449:682–688. 2007. View Article : Google Scholar : PubMed/NCBI

17 

Liu Z, Zhu J, Cao H, Ren H and Fang X: miR-10b promotes cell invasion through RhoC-AKT signaling pathway by targeting HOXD10 in gastric cancer. Int J Oncol. 40:1553–60. 2012.PubMed/NCBI

18 

Tian Y, Luo A, Cai Y, Su Q, Ding F, Chen H and Liu Z: MicroRNA-10b promotes migration and invasion through KLF4 in human esophageal cancer cell lines. J Biol Chem. 285:7986–7994. 2010. View Article : Google Scholar : PubMed/NCBI

19 

Sasayama T, Nishihara M, Kondoh T, Hosoda K and Kohmura E: MicroRNA-10b is overexpressed in malignant glioma and associated with tumor invasive factors, uPAR and RhoC. Int J Cancer. 125:1407–1413. 2009. View Article : Google Scholar : PubMed/NCBI

20 

Garzon R, Garofalo M, Martelli MP, Briesewitz R, Wang L, Fernandez-Cymering C, et al: Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin. Proc Natl Acad Sci USA. 105:3945–3950. 2008. View Article : Google Scholar : PubMed/NCBI

21 

Lund AH: miR-10 in development and cancer. Cell Death Differ. 17:209–214. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Takahashi H, Kanno T, Nakayamada S, Hirahara K, Sciumè G, Muljo SA, et al: TGF-β and retinoic acid induce the microRNA miR-10a, which targets Bcl-6 and constrains the plasticity of helper T cells. Nat Immunol. 13:587–595. 2012.

23 

Luo H, Yang Y, Duan J, Wu P, Jiang Q and Xu C: PTEN-regulated AKT/FoxO3a/Bim signaling contributes to reactive oxygen species-mediated apoptosis in selenite-treated colorectal cancer cells. Cell Death Dis. 4:e4812013. View Article : Google Scholar : PubMed/NCBI

24 

Wakefield LM, Letterio JJ, Chen T, Danielpour D, Allison RS, Pai LH, Denicoff AM, Noone MH, Cowan KH, O’Shaughnessy JA, et al: Transforming growth factor-beta1 circulates in normal human plasma and is unchanged in advanced metastatic breast cancer. Clin Cancer Res. 1:129–136. 1995.PubMed/NCBI

25 

Patel RR and Mehta MP: Targeted therapy for brain metastases: improving the therapeutic ratio. Clin Cancer Res. 13:1675–1683. 2007. View Article : Google Scholar : PubMed/NCBI

26 

Heldin CH, Vanlandewijck M and Moustakas A: Regulation of EMT by TGF-β in cancer. FEBS Letters. 586:1959–1970. 2012.

27 

Wang B, Hsu SH, Majumder S, Kutay H, Huang W, Jacob ST and Ghosal K: TGFbeta-mediated upregulation of hepatic miR-181b promotes hepatocarcinogenesis by targeting TIMP3. Oncogene. 29:1787–1797. 2010. View Article : Google Scholar : PubMed/NCBI

28 

Chung AC, Huang XR, Meng X and Lan HY: miR-192 mediates TGF-beta/Smad3-driven renal fibrosis. J Am Soc Nephrol. 21:1317–1325. 2010. View Article : Google Scholar : PubMed/NCBI

29 

Dey N, Ghosh-Choudhury N, Kasinath BS and Choudhury GG: TGFβ-stimulated microRNA-21 utilizes PTEN to orchestrate AKT/mTORC1 signaling for mesangial cell hypertrophy and matrix expansion. PLoS One. 7:e423162012.

30 

Tian Y, Luo A, Cai Y, Su Q, Ding F, Chen H and Liu Z: MicroRNA-10b promotes migration and invasion through KLF4 in human esophageal cancer cell lines. J Biol Chem. 285:7986–7994. 2010. View Article : Google Scholar : PubMed/NCBI

31 

Chai G, Liu N, Ma J, Li H, Oblinger JL, Prahalad AK, et al: MicroRNA-10b regulates tumorigenesis in neurofibromatosis type 1. Cancer Sci. 101:1997–2004. 2010. View Article : Google Scholar : PubMed/NCBI

32 

Zhang BG, Li JF, Yu BQ, Zhu ZG, Liu BY and Yan M: microRNA-21 promotes tumor proliferation and invasion in gastric cancer by targeting PTEN. Oncol Rep. 27:1019–1026. 2012.PubMed/NCBI

33 

Meng F, Henson R, Wehbe-Janek H, Ghoshal K, Jacob ST and Patel T: MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer. Gastroenterology. 133:647–658. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu S, Sun J and Lan Q: TGF-β‑induced miR10a/b expression promotes human glioma cell migration by targeting PTEN. Mol Med Rep 8: 1741-1746, 2013.
APA
Liu, S., Sun, J., & Lan, Q. (2013). TGF-β‑induced miR10a/b expression promotes human glioma cell migration by targeting PTEN. Molecular Medicine Reports, 8, 1741-1746. https://doi.org/10.3892/mmr.2013.1709
MLA
Liu, S., Sun, J., Lan, Q."TGF-β‑induced miR10a/b expression promotes human glioma cell migration by targeting PTEN". Molecular Medicine Reports 8.6 (2013): 1741-1746.
Chicago
Liu, S., Sun, J., Lan, Q."TGF-β‑induced miR10a/b expression promotes human glioma cell migration by targeting PTEN". Molecular Medicine Reports 8, no. 6 (2013): 1741-1746. https://doi.org/10.3892/mmr.2013.1709
Copy and paste a formatted citation
x
Spandidos Publications style
Liu S, Sun J and Lan Q: TGF-β‑induced miR10a/b expression promotes human glioma cell migration by targeting PTEN. Mol Med Rep 8: 1741-1746, 2013.
APA
Liu, S., Sun, J., & Lan, Q. (2013). TGF-β‑induced miR10a/b expression promotes human glioma cell migration by targeting PTEN. Molecular Medicine Reports, 8, 1741-1746. https://doi.org/10.3892/mmr.2013.1709
MLA
Liu, S., Sun, J., Lan, Q."TGF-β‑induced miR10a/b expression promotes human glioma cell migration by targeting PTEN". Molecular Medicine Reports 8.6 (2013): 1741-1746.
Chicago
Liu, S., Sun, J., Lan, Q."TGF-β‑induced miR10a/b expression promotes human glioma cell migration by targeting PTEN". Molecular Medicine Reports 8, no. 6 (2013): 1741-1746. https://doi.org/10.3892/mmr.2013.1709
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team