Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
2014-February Volume 9 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
2014-February Volume 9 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Influence of cytotoxic T lymphocyte-associated antigen 4 polymorphisms on the outcomes of hepatitis B virus infection

  • Authors:
    • Man Chen
    • Ying Chang
    • Feng Tang
    • Qiong-Hui Xie
    • Jin Li
    • Hong Yang
    • Xing-Xing  He
    • Ju-Sheng Lin
  • View Affiliations / Copyright

    Affiliations: Institute of Liver Diseases, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei 430030, P.R. China
  • Pages: 645-652
    |
    Published online on: November 22, 2013
       https://doi.org/10.3892/mmr.2013.1825
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Cytotoxic T lymphocyte‑associated antigen 4 (CTLA‑4) regulates T‑cell activation and Th1/Th2 cytokine production and is involved in the immune response against Hepatitis B virus (HBV) infection. To detect the association of the CTLA‑4 gene polymorphisms with susceptibility to HBV infection a hospital‑based case‑control study was conducted. A total of 1,119 unrelated individuals were recruited. The CTLA‑4 variants rs5742909, rs231775 and rs3087243 were genotyped via the TaqMan method in this cohort. A comparison with a chronic active hepatitis B group revealed that the SNP rs231775 exhibited significant susceptibility to HBV progression, with the highest odds ratio (OR) reaching 1.659 and P=0.009‑0.049. Although an HBV clearance group was used as a control, results of the present study demonstrated an association of rs5742909 with viral persistence [OR=1.694, 95% confidence intervals (CI)=1.124‑2.553 and P=0.012]. Subsequent analyses revealed risk haplotypes (C‑A‑A and T‑A‑G, for which the highest OR reached 1.865) compared with the protective haplotype C‑G‑G. Therefore, SNPs in the CTLA‑4 gene may be associated with HBV progression and viral persistence which is consistent with its emerging role in the T regulatory cells in the pathogenesis of disease.

Introduction

Hepatitis B virus (HBV) infection is a worldwide health problem and more than two billion people have been infected with HBV (1). Although many individuals eventually achieve a state of non-replicative infection, the prolonged immunological response to infection leads to the development of cirrhosis, liver failure or hepatocellular carcinoma (HCC) in up to 40% of patients (2). In China, ~120 million people are HBV chronic carriers, and 50–80% of cirrhosis patients are infected with HBV (1). Persistent HBV infection has been considered a multifactorial and polygenic disequilibrium among viral, environmental and host genetic components (3). Single-nucleotide polymorphisms (SNPs) are the most abundant form of DNA variation in the human genome and contribute to human phenotypic differences (4). A number of studies have demonstrated the role of host genetic factors and their interactions with environmental factors leading to various outcomes following HBV infection (5–8). Understanding the key factors that influence the clinical outcomes of HBV infection is crucial for early diagnosis and optimal treatment (9).

Cytotoxic T lymphocyte-associated antigen 4 (CTLA-4), mapped to chromosome 2q33 (10) and expressed in the activated and regulatory T cells, regulates T-cell activation and tolerance (11), Th1/Th2 differentiation and cytokine production (12) following B7 engagement. CTLA-4 has been established as a significant negative regulator of T-cell responses, leading to the preservation of T-cell homeostasis (13). Previously, it was reported that CTLA-4 may downregulate the immune response strength of tumor immunity (14), allergy (15), autoimmune disease (16), infection (17) and vaccination (18). In addition to inhibiting T-cell activation and proliferation, CTLA-4 may also induce Fas-independent apoptosis of activated T cells (19). Cytokines including TNF-α and IFN-β are critical, not only for viral clearance, but also for the immunopathogenesis of HBV infection (20,21). Therefore, the interaction of CTLA-4 with B7 molecules in regulating T-cell activation and Th1/Th2 cytokine production is involved in the immune response against HBV infection (22).

SNPs in CTLA-4 have been connected to the susceptibility to autoimmune disease and various types of cancer (23). Findings from recent studies have demonstrated that CTLA-4 gene polymorphisms may affect the susceptibility and chronicity of the disease in patients with HBV infection (24–29). However, the results remain controversial and whether CTLA-4 gene polymorphisms are associated with the status of HBV infection including chronic carriers and cirrhosis, and hepatitis B e antigen (HBeAg) positivity in the infected patients remains to be determined. In addition, the criteria for the control and case groups were not completely equal among these studies. Thus, whether there is an association between CTLA-4 genetic variations and HBV infection in the Chinese population using equal criteria remains to be clarified. In the present study, three SNPs were selected from the CTLA-4 gene: rs5742909 (−318 C/T) at the promoter region, rs231775 (+49 A/G), a non-synonymous at the exon 1 and rs3087243 (+6230 G/A) at the downstream in the 3′ untranslated region (UTR). The three polymorphisms were genotyped in a hospital-based case-control study, including 1,119 unrelated Han Chinese subjects from the Hubei province (Central China).

Materials and methods

Study subjects

In this hospital-based case-control study, a total of 1,119 unrelated Han Chinese individuals were recruited from Tongji Hospital and Union Hospital, Wuhan, China, between July 2007 and September 2009. All the subjects were divided into four groups: i) the HBV clearance group (clear); ii) the chronic active hepatitis B group (CHB); iii) the HBV-related liver cirrhosis group (LC) and iv) the HBV-related hepatocellular carcinoma group (HCC). The diagnostic criteria for study inclusion were described previously (6). Moreover, patients with positive laboratory tests for human immunodeficiency virus (HIV), alcoholic liver disease, suspected autoimmune diseases or schistosomiasis were excluded from the study.

All the study subjects were of unrelated ethnic background, Han Chinese who lived in Wuhan or the surrounding region. Informed consent was obtained from each participant for study enrollment. An information questionnaire was used and the demographic information included gender, age and place of origin. The study was approved by the local Research Ethics Committee at the Tongji Hospital, Huazhong University of Science and Technology in accordance with the principle of the Helsinki Declaration II.

DNA isolation and genotyping

Genomic DNA was isolated from the peripheral whole blood using a TIANamp blood DNA kit [Tiangen Biotech (Beijing) Co., Ltd., Beijing, China]. The concentration and purity of the DNA were determined with a NanoDrop spectrophotometer (Thermo Fisher Scientific, Wilimington, DE, USA), then diluted to a final concentration of 8 ng/ml and distributed to a 96-well plate. Genotyping of genetic polymorphisms was performed via the TaqMan method according to the instructions of TaqMan®R SNP Genotyping Assays (Applied Biosystems, Carlsbad, CA, USA). To detect the three SNPs (rs5742909, rs231775 and rs3087243), TaqMan®R MGB Probes and the primers for PCR amplification (Table I) were customized. The probes were labeled with FAM and VIC dyes to denote the two different alleles, respectively, and the allelic category was measured automatically using the Sequence Detection System 2.3 software (Applied Biosystems) according to the intensity of the VIC and FAM dyes.

Table I

TaqMan® probe and primer for three SNPs.

Table I

TaqMan® probe and primer for three SNPs.

SNP (NCBI reference no.)rs5742909ars231775rs3087243
Forward primerCommercialized GCACAAGGCTCAGCTGAAC CCATCCTCTTTCCTTTTGATTTCTTCAC
Reverse primerCommercialized CAGAAGACAGGGATGAAGAGAAGAA TGTGTTAAACAGCATGCCAATTGATT
MGB probe 1Commercialized VIC-CCAGGTCCTGGTAGCCA-MGB VIC-TCTGTGTTAACCCATGTTATA-MGB
MGB probe 2Commercialized FAM-CAGGTCCTGGCAGCCA-MGB FAM-TGTGTTAACCCACGTTATA-MGB

a The Taqman probes and primers for the SNP locus rs5742909 were commercialized (Applied Biosystems).

{ label (or @symbol) needed for fn[@id='tfn2-mmr-09-02-0645'] } SNPs, single nucleotide polymorphisms.

Statistical analysis

A statistical analysis was conducted using Arlequin 3.5 (30), haploview 4.2 (Cambridge, MA, USA) and SPPS 17.0 (SPSS, Inc., Chicago, IL, USA) softwares. The Hardy-Weinberg equilibrium was tested separately for cases and controls by Arlequin 3.5. Linkage disequilibrium (LD) and haplotypes were assessed by the haploview 4.2 software. Genotypic analyses included allele, dominant, recessive and additive genetic models. The χ2 test or Fisher’s-exact test was applied to a row-by-column contingency table in the four genetic models. Age- and gender-adjusted odds ratios (ORs) and 95% confidence intervals (CIs) were calculated on the basis of the unconditional binary logistic regression model. The strength of association between the genotypes or alleles and HBV infection was estimated by the SPSS17.0. ORs and 95% CIs were calculated using the major allele as a reference. All the tests were two sided with P<0.05 considered to indicate a statistically significant difference.

Results

Clinical and demographic characteristics

The clinical and demographic characteristics of the case-control study included gender, age, drinking habits, serum α-fetoprotein level, serum total bilirubin level, alanine transaminase, HBV-DNA load and serum markers of hepatitis B virus (Table II). Although an effort was made to obtain a good match on the age and gender, there were more male subjects in the three HBV infection groups (CHB+LC+HCC; average 78.7%) compared with those in the clear group (59.3%, P<0.05). The individuals in the CHB group were younger compared with those in the LC and HCC groups (P<0.001). However, populations in the LC and HCC groups demonstrated no significant difference with the clear group with regard to age (P>0.05). No significant difference was observed in the percentage of hepatitis B e antigen (HBeAg)-positive (P>0.05) between the patients in the LC group (11.74%) and those in the HCC group (10.24%). In addition, there was more alcohol consumption in patients (P<0.05) with the LC (29.11%) and HCC (34.19%) groups compared with those in the clear (13.17%) and CHB (18.63%) groups. The difference in the alcohol consumption status may be due to the limited number of drinkers within the Chinese female population.

Table II

Clinical characteristics of the study subjects.

Table II

Clinical characteristics of the study subjects.

CharacteristicsClear, n=205CHB, n=467LC, n=213HCC, n=234
Gender, no. (%)
 Male121 (59.3)343 (73.4)184 (86.4)192 (82.1)
 Female83 (40.7)124 (26.6)29 (13.6)42 (17.9)
Age in years, mean ± SD48.85±12.5235.42±12.8946.21±10.8347.84±13.23
Drinkers, no. (%)27 (13.17)87 (18.63)62 (29.11)80 (34.19)
HBsAg All− All+ All+ All+
Anti-HBs IgG All+All All− All−
HBeAg-positive, no. (%) All−94 (20.13)25 (11.74)24 (10.24)
Anti-HBc IgG All+ All+ All+ All+
Family history, no. (%)No69 (14.78)27 (12.68)47 (20.09)
ALT, U/lNo420.33±399.23110.46±115.2490.63±75.17
TBil, mmol/lNo180.23±171.45132.28±120.8664.36±60.74
HBV-DNA, copy/mlNo(3.05±3.67) E7(2.34±4.02) E6(5.59±2.34) E6

[i] Total number for gender was not in accordance with the sum of each group as not all of the information was completelely collected. No, non-detected. Drinkers, alcohol consumption of 40 g/week, which included occasional and daily drinkers. Clear, HBV clearance group; CHB, chronic active hepatitis B group; LC, HBV-related liver cirrhosis group; HCC, HBV-related hepatocellular carcinoma group. HbsAg, hepatitis B antigens; ALT, alanine transaminase; TBil, total bilirubin level; HBV, hepatitis B virus.

Hardy-Weinberg equilibrium test

Hardy-Weinberg equilibrium was estimated by the Fisher’s exact test via Arlequin 3.5 software. The allele and genotype distributions are shown in Tables III and IV. No significant difference was revealed between the observed and expected frequencies of each genotype in these groups (P>0.05). All the genotype distributions of the three SNPs (rs231775, rs5742909 and rs3087243) conformed to the Hardy-Weinberg equilibrium (P>0.05) in all the groups, making it suitable for subsequent statistical analysis.

Table III

Association of three SNPs (rs5742909, rs231775 and rs3087243) with HBV infection progression and clearance in the Han Chinese populations (dominant model).

Table III

Association of three SNPs (rs5742909, rs231775 and rs3087243) with HBV infection progression and clearance in the Han Chinese populations (dominant model).

Dominant model

SNPsSampleAllele distributionP-valueaGenotypesP-valueOR (95%CI)b
rs5742909(−318C>T)C/TCC/CT/TTCC vs. CT+TTCC vs. CT+TT
Clear358/42Ref.160/38/2Ref.Ref.
CHB+LC1126/2060.013478/170/180.0121.694 (1.124–2.553)
rs231775(+49A>G)A/GAA/GA/GGGG vs. AG+AAGG vs. AG+AA
CH320/610Ref.53/214/198Ref.Ref.
LC189/229 1.53*10E446/97/660.0091.659 (1.137–2.421)
HCC184/2840.07142/100/920.5371.119 (0.782, 1.602)
HCC+LC373/5130.00188/198/1580.0491.353 (1.001–1.829)
rs3087243(+6230G>A)G/AGG/GA/AAGG vs. GA+AAGG vs. GA+AA
CH750/184Ref.301/148/18Ref.Ref.
LC314/1080.015121/72/180.1671.294 (0.898–1.866)
HCC349/1130.041134/81/160.2351.247 (0.866–1.771)
LC+HCC663/2210.007255/153/340.1911.224 (0.904–1.656)

{ label (or @symbol) needed for fn[@id='tfn4-mmr-09-02-0645'] } Total number for the polymorphism was not in accordance with the sum of each genotype as not all the samples were successfully genotyped.

a P-values were obtained by the χ2 test.

b The P-values, odds ratios (ORs) and 95% confidence intervals (CIs) were calculated on the basis of the binary logistic regression analysis and adjusted for gender and age.

{ label (or @symbol) needed for fn[@id='tfn7-mmr-09-02-0645'] } Bold text denotes statistically significant differences. SNPs, single-nucleotide polymorphisms; HBV, hepatitis B virus.

Table IV

Alleles and genotypes distribution of the three SNPs in the cases and controls.

Table IV

Alleles and genotypes distribution of the three SNPs in the cases and controls.

SNP IDClearCHBLCHCC
rs5742909
 C358 (89.5)796 (85.8)330 (81.7)400 (89.3)
 T42 (10.5)132 (14.2)74 (18.3)48 (10.7)
 CC160 (80.0)342 (73.7)136 (67.3)176 (78.6)
 CT38 (19.0)112 (24.1)58 (28.7)48 (21.4)
 TT2 (1.0)10 (2.2)8 (4.0)0 (0.0)
 Hardy-Weinberg equilibrium0.880.820.570.07
rs231775
 A142 (34.8)320 (34.4)189 (45.2)184 (34.4)
 G266 (65.2)610 (65.6)229 (54.8)284 (60.7)
 AA20 (9.8)53 (11.4)46 (22.0)42 (17.9)
 GA102 (50.0)214 (46)97 (46.4)100 (42.7)
 GG82 (40.2)198 (42.6)66 (31.6)92 (39.3)
 Hardy-Weinberg equilibrium0.150.670.360.11
rs3087243
 G311 (76.6)750 (80.3)314 (74.4)349 (75.5)
 A95 (23.4)184 (19.7)108 (25.6)113 (24.5)
 GG116 (57.1)301 (64.5)121 (64.5)134 (58.0)
 GA79 (38.9)148 (31.7)72 (34.1)81 (35.1)
 AA8 (3.9)18 (3.9)18 (8.5)16 (6.9)
 Hardy-Weinberg equilibrium0.220.970.130.44

[i] All groups conformed to the Hardy-Weinberg equilibrium: P>0.05. Clear, HBV clearance group; CHB, chronic active hepatitis B group; LC, HBV-related liver cirrhosis group; HCC, HBV-related hepatocellular carcinoma group. SNPs, single nucleotide polymorphisms.

Associations of the CTLA-4 polymorphisms with HBV progression

To investigate which genotypic models were significantly associated with various outcomes, a comparison of the four models was conducted (multiplicative, additive, dominant and recessive models) in the Hubei Han Chinese population (data not shown). The best-fitting genotypic effect of the three SNPs (rs5742909, rs231775, rs3087243) was observed in the dominant model (Table III). Distributions of the CTLA-4 polymorphisms in the case and control groups are summarized in Tables III and IV. At the SNP site rs231775, the significant difference in allele distribution was observed only between the CHB and LC groups (P=1.53*10E4). Following adjustment for age and gender and analysis by unconditional binary logistic regression, the difference remained significant (P=0.009; OR=1.659 and 95% CI=1.137–2.421). At SNP site rs3087243, compared with the CHB group, the allele distributions revealed significant differences in the LC and HCC groups (P=0.015 and 0.041, respectively). However, no differences were evident following the adjustment for age and gender. Although there was no difference between the CHB and HCC groups at the SNPs rs231775 and rs3087243 following adjustment for age and gender, a trend for the correlation was observed between the polymorphisms and HCC susceptibility. The present study found that subjects with an A allele of the two polymorphisms appeared to have a greater susceptibility to HBV-related LC and HCC compared with those with a G allele.

According to the clinical considerations, LC and HCC could be lumped together since they are involved in different steps in HBV progression. In the present study, these two HBV infection populations were combined into one group by using the CHB group as the reference. At the SNP site rs231775, a significant difference was found, not only in the allele frequencies (P<0.05), but also in the genotype distributions (P<0.05) when the combined group (LC+HCC) was compared with the CHB group (P=0.049, OR=1.353 and 95% CI=1.001–1.829). However, for the SNP site rs3087243, the significant difference only appeared in the χ2 test for allele (P=0.007) and genotype distribution (P=0.017; data not shown). Although they were adjusted for age and gender and analysed by unconditional binary logistic regression, the difference in the CHB and the combined group (LC+HCC) was not significant in the site rs3087243, and a trend (OR=1.224 and CI=0.904–1.656)) was still observed. From these data, the subjects with A allele appeared to have a greater susceptibility to HBV progression compared with those with G allele in the two CTLA-4 polymorphisms, in particular in the rs231775. In addition, no association of the CTLA-4 polymorphism rs5742909 was found with HBV progression.

Associations of the CTLA-4 polymorphisms with viral persistence

According to the clinical considerations of this study and our previous study (6), CHB and LC could be lumped together, since both of them were chronic HBV carriers. The populations of the CHB and LC were combined in a similar manner to the HBV persistence group by using the clear group as the reference. Following a series of statistical analyses, the associations of the CTLA-4 polymorphisms with viral persistence were noted only at the SNP site rs5742909 of these three SNPs (Table III). In the HBV persistence group (including CHB and LC), the proportions of the C and T alleles were 89.5 and 10.5%, respectively, which were significantly different from those observed in the clear group (P=0.013). Following adjustment for age and gender and analysis by unconditional binary logistic regression, the statistical level remained significant (P=0.012, OR=1.694 and 95% CI=1.124–2.553) compared with the clear group under the best-fitting model (dominant model). In addition, under the additive model, the frequencies of the C/T and T/T genotypes in HBV persistence patients were higher compared with those in the clear subjects (25.53 vs. 19% and 2.7 vs. 1%, respectively). Their ORs reached 1.636 (95% CI=1.074–2.492 and P=0.022) and 2.695 (95% CI=0.599–12.131 and P=0.196) compared with the C/C genotype (Table V). These results indicated that the T/T and C/T genotypes and T allele of the polymorphism rs5742909 may increase the risk of HBV persistence.

Table V

Associations of the three SNPs (rs5742909, rs231775 and rs3087243) with HBV infection progression and clearance in the Han Chinese populations (recessive and additive models).

Table V

Associations of the three SNPs (rs5742909, rs231775 and rs3087243) with HBV infection progression and clearance in the Han Chinese populations (recessive and additive models).

Recessive modelAdditive model


SNP IDGroupP-valueOR (95%CI)GenotypesP-valueOR (95%CI)
rs5742909CC+CT vs TTCC+CT vs TTCC/CT/TTCC/CT/TT
ClearRef.Ref.Ref.Ref.
CHB+LC0.252.412, (0.537, 10.824)(CC vs. CT)0.0221.636, (1.074, 2.553)
(CC vs. TT)0.1962.695, (0.599, 12.131)
rs231775GG+GA vs. AAGG+GA vs. AAGG/GA/AAGG/GA/AA
CHBRef.Ref.Ref.Ref.
LC0.0171.78 (1.111–2.852)(GG vs. GA)P1=0.0541.487 (0.993–2.226);
(GG vs. AA)P1=0.0032.212 (1.310–3.735)
HCC+LC0.0171.78 (1.111–2.852)(GG vs. GA)P2=0.1721.252 (0.907–1.728)
(GG vs. AA)P2=0.0221.673 (1.079–2.595)
rs3087243GG+GA vs. AAGG+GA vs. AAGG/GA/AAGG/GA/AA
CHBRef.Ref.Ref.Ref.
LC0.181.667 (0.789–3.519)(GG vs. GA)P1=0.4321.169 (0.791–1.728)
(GG vs. AA)P1=0.1461.757 (0.822–3.754)
LC+HCC0.3031.410 (0.734–2.709)(GG vs. GA)P2=0.4271.138 (0.827–1.568)
(GG vs. AA)P2=0.2511.474 (0.760–2.858)

[i] P-value is for Pearson’s χ2 test. P1, LC vs. CHB; P2, LC+HCC vs. CHB. P1 and P2 are in the genotype ratios of GG/GA and GG/AA. The P-values, odds ratios (ORs), and 95% confidence intervals (CIs) were calculated on the basis of the binary logistic regression analysis, adjusted for gender and age. SNPs, single-nucleotide polymorphisms.

Results of the haplotype analysis

In order to understand the contributions of these loci to the HBV susceptibility, three-locus haplotypes were constructed for the SNPs rs5742909, rs231775 and rs3087243 (Table VI). Pairwise LD analyses (Fig. 1) were performed using all the individuals from the clear group. Results of the analyses revealed that the SNPs rs5742909, rs231775 and rs3087243 were in LD with each other (D′=1, r2=0.233 between rs5742909 and rs231775; D′=1, r2=0.564 between rs231775 and rs3087243; D′=1, r2=0.035 between rs5742909 and rs3087243). In order to derive HBV infection-specific haplotypes, haplotypes with frequencies <0.05 were not considered and three haplotypes were observed. When a protective haplotype C-G-G was selected as a baseline, haplotypes C-A-A and T-A-G exhibited an increased susceptibility to progressed hepatitis and the haplotype T-A-G revealed an increased risk for viral persistence (P-value and OR are shown in Table VI). Three-loci haplotyping was performed only for the subjects with complete genotyping.

Figure 1

Linkage disequilibrium analysis of the SNPs rs5742909, rs231775 and rs3087243 in HBV clearance population (n=200) generated by HaploView 4.2 software. SNPs, single-nucleotide polymorphisms; HBV, hepatitis B virus.

Table VI

Results of the association test for the three SNPs haplotypes in the Han Chinese populations.

Table VI

Results of the association test for the three SNPs haplotypes in the Han Chinese populations.

Haplotype/SNP−318C>T+49A>G+6230G>AClear (2n=400)CH (2n=928)LC (2n=404)HCC+LC (2n=1332)CH+LC (2n=852)
1CGG261 (65.2)609 (65.6)219 (54.3)828 (62.6)491 (59.9)
2CAA93 (23.3)186 (20.0)103 (25.4)289 (21.9)211 (25.7)
3TAG46 (11.5)133 (14.3)72 (17.9)205 (15.5)118 (14.4)
P1-valueaRef.0.2830.1020.849
OR (95%CI)10.854 (0.640–1.139)1.320 (0.946–1.841)0.974 (0.742–1.279)
P2-valueaRef.0.2460.0030.054
OR (95%CI)11.246 (0.861–1.778)1.865 (1.236–2.814)1.406 (0.992–1.993)
P1-valuebRef.0.0030.004
OR (95%CI)11.546 (1.161–2.058)1.403 (1.114–1.767)
P2-valuebRef.0.0140.512
OR (95%CI)11.503 (1.085–2.082)1.096 (0.833–1.443)

{ label (or @symbol) needed for fn[@id='tfn10-mmr-09-02-0645'] } P1-value: CGG vs. CAA; P2-value: CGG vs. TAG. P1 and P2 represent P-value calculated on the binary logistic regression analysis and adjusted for sex and age. Haplotypes with frequencies <0.05 were not considered.

a Three SNPs haplotypes C-G-G, C-A-A, T-A-G in the clear group compared with those in the HBV infection groups.

b Three SNPs haplotypes C-G-G, C-A-A, T-A-A in the CHB group compared with those in the other HBV infection groups.

{ label (or @symbol) needed for fn[@id='tfn13-mmr-09-02-0645'] } SNPs, single-nucleotide polymorphisms.

Discussion

The outcomes of the HBV infection vary according to the vigor of the immune response, a process that is regulated by a number of molecules, including the cell surface receptor CTLA-4 (25). The CTLA-4 gene is expressed by T-lymphocytes and functions as an inhibitory receptor, acting as a negative regulator of T-cell responses (31). Mohammad Alizadeh et al (26) and Schott et al (27) demonstrated a significant association between the genotypes or alleles of the mutation rs5742909 and the susceptibility to chronic hepatitis B. In their studies, Gu et al and Hu et al demonstrated that the SNP site rs231775 was associated with HCC (23,29). However, Gu et al only identified the association in a male Chinese population and Hu et al included HCC subjects with a virus infection as well as with HBV. Thio et al (25) reported that presence of allele +6230A in the 3′UTR of the CTLA4 gene (at SNP site rs3087243) was suspected to have viral persistence and that allele +49G (at SNP site rs231775) was detected more often in individuals who recovered from HBV infection. Although the association between various outcomes of HBV infection and the CTLA-4 gene has become increasingly evident (24,28), their diagnosis criteria were not completely equal and the ethnic background difference should be considered. Different results are therefore likely to arise with different diagnosis criteria and ethic backgrounds although the control and case groups are similar.

In the analysis of the present study, three SNPs sites (rs5742909, rs231775 and rs3087243) in the gene CTLA-4 were confirmed to be significantly associated with HBV infection. Additionally, CTLA-4 haplotypes are significant determinants of the HBV infection in the Hubei Han Chinese population. Haplotypes containing the +49G allele were protective against HBV progression and viral persistence. Since these haplotypes may alter the ability of CTLA-4 to downregulate the immune response, these data indicated that the vigor of counter-regulatory mechanisms contributes to HBV infection. Although the present study may not have indicated that the genotypes distribution in all these three sites (rs5742909, rs231775 and rs3087243) was significantly different between the control and case groups, the frequencies of susceptible alleles were similar compared with those in other Chinese populations. Thus, it may be confirmed that the polymorphisms of the CTLA-4 gene play a crucial role in HBV progression and viral persistence in the Hubei Han Chinese population.

Following HBV infection, the inflammatory immune response of the host induces hepatocellular damage and is followed by the pathogenesis of liver cirrhosis and cancer (32). Liver cancer arises most frequently in the setting of chronic liver inflammation (33). In the present study, the allele +49A was identified as a risk factor for HBV progression while the mutation allele +49G may be protective against HBV progression. Inherited changes or SNPs in CTLA-4 expression that presumably alter T-cell self-reactivity have been found to be associated with autoimmune disorders (10,34,35) including autoimmune liver disease (36–39). The A→G mutation which exists at position +49 in exon 1 (rs231775) leads to a non-synonymous amino acid change from threonine to alanine, thus changing the polarity of the amino acid and potentially altering the function of the protein. The +49A allele has been associated with a decreased risk for diseases resulting from a downregulated vigorous immune response (36,40–42). Similarly, in an earlier study, the allele +49G was also associated with improved clearance of an HCV infection resulting from α-interferon-based therapy (43). Lymphocytes from donors carrying +49G appear to express less CTLA-4 on their surfaces, proliferate more under conditions of suboptimal activation and exhibit less CTLA-4-mediated inhibition of the T-cell responses (44).

The SNP rs5742909 is an A→G mutation in the promoter region at position −318 of the CTLA-4 gene. It has been demonstrated that the −318T allele of CTLA-4 may result in increased levels of CTLA-4 mRNA compared with the −318C/−318C homozygote (45) and an increased expression of CTLA-4 following activation (46). Although in the present study, only the association between the mutation and viral persistence was observed, the haplotype containing −318C or −318T is associated with viral persistence and HBV progression, as mentioned in previous studies (24,27). In addition, individuals with the allele +6230A in the 3′ UTR (at the site rs3087243) were also found to be more likely to have HBV progression. Ueda et al (10) reported that the SNP site rs3087243 determines the levels of the soluble isoform of CTLA-4 (sCTLA-4), which has been demonstrated in vitro to inhibit T-cell proliferation. This may partially account for the association of this haplotype containing the +6230A allele with HBV progression.

In the presence of two functional polymorphisms on the same LD block, when the predisposing allele of one is in LD with the protective allele of the other, the genetic effects of individual SNPs are likely to be blunted by an increase in the frequency of haplotypes that carry one predisposing and one protective allele (47). Chistiakov et al (48) suggested that whether the haplotype are likely to be susceptible, protective or neutral depends on a ratio between predisposing and protective alleles constituting a haplotype and an interaction between their functional significance and strength of their functional effects. Therefore, it is possible that the effects of the three SNPs in chronic HBV patients involved in the present study may be due to the linkage to each other, in particular to the linkage to +49 A/G.

In summary, in the present case-control study, the A allele of the rs231775 and rs3087243 SNPs sites in CTLA-4 was confirmed to be significantly associated with HBV progression in the Han Chinese population, and allele T in rs5742909 revealed a strong risk effect on viral persistence. Although HBV disease is not determined solely by genetic factors, the experimental results offer the foundation for further study of genetic variations in CTLA-4 for the prevention and therapy of chronic HBV infection. However, following adjustment for age and gender, the association among the three SNPs and the HBV-related HCC, excluding the (LC+HCC) group, was not observed. This may be due to the difference in criteria and ethnic background. Future investigations with a larger sample size, multi-center study and functional studies in this gene are required to confirm the results of the present study.

Acknowledgements

This study was financially supported by the National Basic Research Program of China (no. 2007CB512903) and the National Natural Science Foundation of China (no. 81101824 and 30872237).

References

1 

Guo XC and Wu YQ: A review: progress of prevention and control on viral hepatitis in China. Biomed Environ Sci. 12:227–232. 1999.PubMed/NCBI

2 

Ganem D and Prince AM: Hepatitis B virus infection - natural history and clinical consequences. N Engl J Med. 350:1118–1129. 2004. View Article : Google Scholar : PubMed/NCBI

3 

Thursz M: Genetic susceptibility in chronic viral hepatitis. Antiviral Res. 52:113–116. 2001. View Article : Google Scholar : PubMed/NCBI

4 

Harnprasopwat R, Ha D, Toyoshima T, Lodish H, Tojo A and Kotani A: Alteration of processing induced by a single nucleotide polymorphism in pri-miR-126. Biochem Biophys Res Commun. 399:117–122. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Li J, Yang D, He Y, et al: Associations of HLA-DP variants with hepatitis B virus infection in southern and northern Han Chinese populations: a multicenter case-control study. PLoS One. 6:e242212011. View Article : Google Scholar : PubMed/NCBI

6 

He XX, Chang Y, Jiang HJ, et al: Persistent effect of IFNAR-1 genetic polymorphism on the long-term pathogenesis of chronic HBV infection. Viral Immunol. 23:251–257. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Liu L, Li J, Yao J, et al: A genome-wide association study with DNA pooling identifies the variant rs11866328 in the GRIN2A gene that affects disease progression of chronic HBV infection. Viral Immunol. 24:397–402. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Liu L, Yao J, Li J, et al: Effects of variant rs346473 in ARHGAP24 gene on disease progression of HBV infection in Han Chinese population. J Huazhong Univ Sci Technolog Med Sci. 31:482–487. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Szmaragd C, Nichols RA and Balloux F: A novel approach to characterise pathogen candidate genetic polymorphisms involved in clinical outcome. Infect Genet Evol. 6:38–45. 2006. View Article : Google Scholar : PubMed/NCBI

10 

Ueda H, Howson JM, Esposito L, et al: Association of the T-cell regulatory gene CTLA4 with susceptibility to autoimmune disease. Nature. 423:506–511. 2003. View Article : Google Scholar : PubMed/NCBI

11 

Carreno BM, Bennett F, Chau TA, et al: CTLA-4 (CD152) can inhibit T cell activation by two different mechanisms depending on its level of cell surface expression. J Immunol. 165:1352–1356. 2000. View Article : Google Scholar : PubMed/NCBI

12 

Kuchroo VK, Das MP, Brown JA, et al: B7-1 and B7-2 costimulatory molecules activate differentially the Th1/Th2 developmental pathways: application to autoimmune disease therapy. Cell. 80:707–718. 1995. View Article : Google Scholar : PubMed/NCBI

13 

Dariavach P, Mattéi MG, Golstein P and Lefranc MP: Human Ig superfamily CTLA-4 gene: chromosomal localization and identity of protein sequence between murine and human CTLA-4 cytoplasmic domains. Eur J Immunol. 18:1901–1905. 1988. View Article : Google Scholar : PubMed/NCBI

14 

Leach DR, Krummel MF and Allison JP: Enhancement of antitumor immunity by CTLA-4 blockade. Science. 271:1734–1736. 1996. View Article : Google Scholar : PubMed/NCBI

15 

Hellings PW, Vandenberghe P, Kasran A, et al: Blockade of CTLA-4 enhances allergic sensitization and eosinophilic airway inflammation in genetically predisposed mice. Eur J Immunol. 32:585–594. 2002. View Article : Google Scholar : PubMed/NCBI

16 

Karandikar NJ, Vanderlugt CL, Walunas TL, Miller SD and Bluestone JA: CTLA-4: a negative regulator of autoimmune disease. J Exp Med. 184:783–788. 1996. View Article : Google Scholar : PubMed/NCBI

17 

Kirman J, McCoy K, Hook S, et al: CTLA-4 blockade enhances the immune response induced by mycobacterial infection but does not lead to increased protection. Infect Immun. 67:3786–3792. 1999.PubMed/NCBI

18 

Espenschied J, Lamont J, Longmate J, et al: CTLA-4 blockade enhances the therapeutic effect of an attenuated poxvirus vaccine targeting p53 in an established murine tumor model. J Immunol. 170:3401–3407. 2003. View Article : Google Scholar : PubMed/NCBI

19 

Scheipers P and Reiser H: Fas-independent death of activated CD4(+) T lymphocytes induced by CTLA-4 crosslinking. Proc Natl Acad Sci U S A. 95:10083–10088. 1998.

20 

Ohta A, Sekimoto M, Sato M, et al: Indispensable role for TNF-alpha and IFN-gamma at the effector phase of liver injury mediated by Th1 cells specific to hepatitis B virus surface antigen. J Immunol. 165:956–961. 2000. View Article : Google Scholar : PubMed/NCBI

21 

Stoop JN, Woltman AM, Biesta PJ, et al: Tumor necrosis factor alpha inhibits the suppressive effect of regulatory T cells on the hepatitis B virus-specific immune response. Hepatology. 46:699–705. 2007. View Article : Google Scholar : PubMed/NCBI

22 

Han Q, Duan S, Zhang G, et al: Associations between cytotoxic T lymphocyte-associated antigen-4 polymorphisms and serum tumor necrosis factor-α and interferon-γ levels in patients with chronic hepatitis B virus infection. Inflamm Res. 60:1071–1078. 2011.

23 

Hu L, Liu J, Chen X, et al: CTLA-4 gene polymorphism +49 A/G contributes to genetic susceptibility to two infection-related cancers-hepatocellular carcinoma and cervical cancer. Hum Immunol. 71:888–891. 2010.

24 

Duan S, Zhang G, Han Q, et al: CTLA-4 exon 1 +49 polymorphism alone and in a haplotype with −318 promoter polymorphism may confer susceptibility to chronic HBV infection in Chinese Han patients. Mol Biol Rep. 38:5125–5132. 2011.

25 

Thio CL, Mosbruger TL, Kaslow RA, et al: Cytotoxic T-lymphocyte antigen 4 gene and recovery from hepatitis B virus infection. J Virol. 78:11258–11262. 2004. View Article : Google Scholar : PubMed/NCBI

26 

Mohammad Alizadeh AH, Hajilooi M, Ranjbar M, Fallahian F and Mousavi SM: Cytotoxic T-lymphocyte antigen 4 gene polymorphisms and susceptibility to chronic hepatitis B. World J Gastroenterol. 12:630–635. 2006.PubMed/NCBI

27 

Schott E, Witt H, Pascu M, et al: Association of CTLA4 single nucleotide polymorphisms with viral but not autoimmune liver disease. Eur J Gastroenterol Hepatol. 19:947–951. 2007. View Article : Google Scholar : PubMed/NCBI

28 

Chen DQ, Zeng Y, Zhou J, et al: Association of candidate susceptible loci with chronic infection with hepatitis B virus in a Chinese population. J Med Virol. 82:371–378. 2010. View Article : Google Scholar : PubMed/NCBI

29 

Gu X, Qi P, Zhou F, et al: +49G > A polymorphism in the cytotoxic T-lymphocyte antigen-4 gene increases susceptibility to hepatitis B-related hepatocellular carcinoma in a male Chinese population. Hum Immunol. 71:83–87. 2010.

30 

Excoffier L and Lischer HE: Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour. 10:564–567. 2010. View Article : Google Scholar : PubMed/NCBI

31 

Shevach EM: CD4+ CD25+ suppressor T cells: more questions than answers. Nat Rev Immunol. 2:389–400. 2002.

32 

Fattovich G, Bortolotti F and Donato F: Natural history of chronic hepatitis B: special emphasis on disease progression and prognostic factors. J Hepatol. 48:335–352. 2008. View Article : Google Scholar : PubMed/NCBI

33 

Yang HI, Lu SN, Liaw YF, et al: Hepatitis B e antigen and the risk of hepatocellular carcinoma. N Engl J Med. 347:168–174. 2002. View Article : Google Scholar : PubMed/NCBI

34 

Aguilar F, Torres B, Sánchez-Román J, Núñez-Roldán A and González-Escribano MF: CTLA4 polymorphism in Spanish patients with systemic lupus erythematosus. Hum Immunol. 64:936–940. 2003. View Article : Google Scholar : PubMed/NCBI

35 

Parks CG, Hudson LL, Cooper GS, et al: CTLA-4 gene polymorphisms and systemic lupus erythematosus in a population-based study of whites and African-Americans in the southeastern United States. Lupus. 13:784–791. 2004. View Article : Google Scholar : PubMed/NCBI

36 

Agarwal K, Czaja AJ, Jones DE and Donaldson PT: Cytotoxic T lymphocyte antigen-4 (CTLA-4) gene polymorphisms and susceptibility to type 1 autoimmune hepatitis. Hepatology. 31:49–53. 2000. View Article : Google Scholar : PubMed/NCBI

37 

Agarwal K, Jones DE, Daly AK, et al: CTLA-4 gene polymorphism confers susceptibility to primary biliary cirrhosis. J Hepatol. 32:538–541. 2000. View Article : Google Scholar : PubMed/NCBI

38 

Djilali-Saiah I, Ouellette P, Caillat-Zucman S, Debray D, Kohn JI and Alvarez F: CTLA-4/CD 28 region polymorphisms in children from families with autoimmune hepatitis. Hum Immunol. 62:1356–1362. 2001. View Article : Google Scholar

39 

Fan LY, Tu XQ, Cheng QB, et al: Cytotoxic T lymphocyte associated antigen-4 gene polymorphisms confer susceptibility to primary biliary cirrhosis and autoimmune hepatitis in Chinese population. World J Gastroenterol. 10:3056–3059. 2004.

40 

Ahmed S, Ihara K, Kanemitsu S, et al: Association of CTLA-4 but not CD28 gene polymorphisms with systemic lupus erythematosus in the Japanese population. Rheumatology (Oxford). 40:662–667. 2001. View Article : Google Scholar : PubMed/NCBI

41 

Ihara K, Ahmed S, Nakao F, et al: Association studies of CTLA-4, CD28, and ICOS gene polymorphisms with type 1 diabetes in the Japanese population. Immunogenetics. 53:447–454. 2001. View Article : Google Scholar : PubMed/NCBI

42 

Kouki T, Sawai Y, Gardine CA, Fisfalen ME, Alegre ML and DeGroot LJ: CTLA-4 gene polymorphism at position 49 in exon 1 reduces the inhibitory function of CTLA-4 and contributes to the pathogenesis of Graves’ disease. J Immunol. 165:6606–6611. 2000.PubMed/NCBI

43 

Yee LJ, Perez KA, Tang J, van Leeuwen DJ and Kaslow RA: Association of CTLA4 polymorphisms with sustained response to interferon and ribavirin therapy for chronic hepatitis C virus infection. J Infect Dis. 187:1264–1271. 2003. View Article : Google Scholar : PubMed/NCBI

44 

Mäurer M, Loserth S, Kolb-Mäurer A, et al: A polymorphism in the human cytotoxic T-lymphocyte antigen 4 ( CTLA4) gene (exon 1 +49) alters T-cell activation. Immunogenetics. 54:1–8. 2002.

45 

Wang XB, Zhao X, Giscombe R and Lefvert AK: A CTLA-4 gene polymorphism at position −318 in the promoter region affects the expression of protein. Genes Immun. 3:233–234. 2002.

46 

Ligers A, Teleshova N, Masterman T, Huang WX and Hillert J: CTLA-4 gene expression is influenced by promoter and exon 1 polymorphisms. Genes Immun. 2:145–152. 2001. View Article : Google Scholar : PubMed/NCBI

47 

Anjos SM, Tessier MC and Polychronakos C: Association of the cytotoxic T lymphocyte-associated antigen 4 gene with type 1 diabetes: evidence for independent effects of two polymorphisms on the same haplotype block. J Clin Endocrinol Metab. 89:6257–6265. 2004. View Article : Google Scholar : PubMed/NCBI

48 

Chistiakov DA, Savost’anov KV, Turakulov RI, Efremov IA and Demurov LM: Genetic analysis and functional evaluation of the C/T(−318) and A/G(−1661) polymorphisms of the CTLA-4 gene in patients affected with Graves’ disease. Clin Immunol. 118:233–242. 2006.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chen M, Chang Y, Tang F, Xie Q, Li J, Yang H, He X and Lin J: Influence of cytotoxic T lymphocyte-associated antigen 4 polymorphisms on the outcomes of hepatitis B virus infection. Mol Med Rep 9: 645-652, 2014.
APA
Chen, M., Chang, Y., Tang, F., Xie, Q., Li, J., Yang, H. ... Lin, J. (2014). Influence of cytotoxic T lymphocyte-associated antigen 4 polymorphisms on the outcomes of hepatitis B virus infection. Molecular Medicine Reports, 9, 645-652. https://doi.org/10.3892/mmr.2013.1825
MLA
Chen, M., Chang, Y., Tang, F., Xie, Q., Li, J., Yang, H., He, X., Lin, J."Influence of cytotoxic T lymphocyte-associated antigen 4 polymorphisms on the outcomes of hepatitis B virus infection". Molecular Medicine Reports 9.2 (2014): 645-652.
Chicago
Chen, M., Chang, Y., Tang, F., Xie, Q., Li, J., Yang, H., He, X., Lin, J."Influence of cytotoxic T lymphocyte-associated antigen 4 polymorphisms on the outcomes of hepatitis B virus infection". Molecular Medicine Reports 9, no. 2 (2014): 645-652. https://doi.org/10.3892/mmr.2013.1825
Copy and paste a formatted citation
x
Spandidos Publications style
Chen M, Chang Y, Tang F, Xie Q, Li J, Yang H, He X and Lin J: Influence of cytotoxic T lymphocyte-associated antigen 4 polymorphisms on the outcomes of hepatitis B virus infection. Mol Med Rep 9: 645-652, 2014.
APA
Chen, M., Chang, Y., Tang, F., Xie, Q., Li, J., Yang, H. ... Lin, J. (2014). Influence of cytotoxic T lymphocyte-associated antigen 4 polymorphisms on the outcomes of hepatitis B virus infection. Molecular Medicine Reports, 9, 645-652. https://doi.org/10.3892/mmr.2013.1825
MLA
Chen, M., Chang, Y., Tang, F., Xie, Q., Li, J., Yang, H., He, X., Lin, J."Influence of cytotoxic T lymphocyte-associated antigen 4 polymorphisms on the outcomes of hepatitis B virus infection". Molecular Medicine Reports 9.2 (2014): 645-652.
Chicago
Chen, M., Chang, Y., Tang, F., Xie, Q., Li, J., Yang, H., He, X., Lin, J."Influence of cytotoxic T lymphocyte-associated antigen 4 polymorphisms on the outcomes of hepatitis B virus infection". Molecular Medicine Reports 9, no. 2 (2014): 645-652. https://doi.org/10.3892/mmr.2013.1825
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team