Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
May-2014 Volume 9 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2014 Volume 9 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Phosphorylated Signal Transducer and Activator of Transcription 1 is a potential predictor of interferon response in patients with advanced renal cell carcinoma

  • Authors:
    • Wei Li
    • Qiang Wei
    • Jianbo Liang
  • View Affiliations / Copyright

    Affiliations: Department of Urology, The People's Hospital of Guangxi Zhuang Autonomous Region, Nanning, Guangxi 530021, P.R. China, Department of Pathology, The People's Hospital of Guangxi Zhuang Autonomous Region, Nanning, Guangxi 530021, P.R. China
  • Pages: 1929-1934
    |
    Published online on: March 13, 2014
       https://doi.org/10.3892/mmr.2014.2046
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The present study aimed to evaluate the expression status of Janus kinase (JAK)‑Signal Transducer and Activator of Transcription (STAT) in renal cell carcinoma and benign renal tissue, and identify a potential biomarker for interferon (IFN) response prediction. A total of 32 specimens of human renal cell carcinoma and 10 specimens of benign renal tissue were harvested from surgically removed kidneys. The expression levels of JAK‑STAT were determined by immunohistochemical staining and quantitative polymerase chain reaction. Furthermore, the expression levels of JAK‑STAT in renal cell carcinoma tissues that were stimulated with IFN‑α were quantified by western blot analysis. The positive expression rates of JAK1, STAT1 and phosphorylated (P)‑STAT1 in the renal cell carcinomas were significantly lower than that in the benign renal tissues (25.0, 31.2, and 12.5% vs. 70.0, 50.0, and 70.0%, respectively; P<0.05). The relative expression levels of JAK1 (0.696±0.102) and STAT1 mRNA (0.341±0.068) in the tumor tissue were lower than those in the benign tissue (0.957±0.103 and 0.547±0.082, respectively; P<0.05). IFN stimulation enhanced the expression levels of P‑STAT1 in the renal cell carcinoma tissues, and enhancement of the P‑STAT1 expression levels was associated with tumor relapse and metastasis. In conclusion, P‑STAT1 is a potential predictor of IFN response in patients with advanced renal cell carcinoma.

Introduction

Renal cell carcinoma is the most common type of malignant kidney tumor. It was estimated that in 2012 ~64,770 new cases of kidney cancer would be diagnosed in the United States, resulting in 13,570 mortalities (1). In 2011, ~90% of cases of kidney cancer were renal cell carcinoma (2). According to a review in 2008, 30% of patients show signs of advanced renal cell carcinoma when diagnosed, and 20–30% of patients treated by nephrectomy relapse and develop metastases during the follow-up period (3). As renal cell carcinoma is not sensitive to chemotherapy and radiotherapy, immunotherapy with interferon (IFN)-α was frequently used in the past 20 years (4). However, only a 15–30% objective response rate was reported was reported in a previous study and serious adverse effects have been observed in patients who have undergone immunotherapy (5). Thus, the ability to identify patients who are most likely to benefit from immunotherapy is necessary.

IFN-α exerts its effects on cells by interacting with the cell receptors and thus activating the Janus kinase (JAK) family. Activated JAK1 and tyrosine kinase 2 phosphorylate Signal Transducer and Activator of Transcription (STAT) and the activated STAT proteins interact with regulatory elements to induce the transcription of target genes (6). A previous study demonstrated that JAK-STAT activation is associated with IFN-α resistance in renal cell lines (7). Certain molecules, including STAT3 and p53, have been identified as predictive and prognostic markers of renal cell carcinoma (8,9). However, the majority of these studies were conducted in vitro and these findings do not provide sufficient information to permit clinical treatment. To the best of our knowledge, studies concerning the expression of JAK-STAT in human renal cancer tissue are limited. The purpose of the present study was to assess the expression levels of JAK-STAT in human renal cancer tissues and identify a biomarker that is associated with the effects of IFN-α treatment.

Patients and methods

Patients and tissues

A total of 32 Chinese patients (mean age, 61.2 years) who had been diagnosed with locally advanced renal cell carcinoma by post surgery pathological examination at The People’s Hospital of Guangxi Zhuang Autonomous Region (Nanning, China) between 2010 and 2011 were included in this study. The TNM staging of cancer was performed according to the American Joint Committee on Cancer Cancer Staging Manual (10). The demographic and clinicopathological characteristics of the patients are listed in Table I. A routine physical examination was conducted and the immune function of the patients was detected prior to the surgery. No abnormalities were identified in the patients. All patients received a radical nephrectomy and post surgery adjuvant immunotherapy with IFN-α2b (Schering-Plough, Kenilworth, NJ, USA). The treatment protocol was performed according to the instructions in the guidelines of the Chinese Urological Association (11). Considering the toxic side-effects of IFN, the patients were advised to receive a low dose of IFN-α2b (3 MIU subcutaneously, three times weekly) treatment for 12 weeks. The patients were followed-up for 24 months, and the local relapse and metastasis rates were recorded.

Table I

Demographic and clinicopathological characteristics of the patients.

Table I

Demographic and clinicopathological characteristics of the patients.

CharacteristicNumber
Age, years
 <505
 50–7020
 >707
Gender
 Male22
 Female10
TNM stage
 T2N1M016
 T3aN0M011
 T3aN1M03
 T3bN0M02

[i] TNM, tumor node metastasis.

The tumor samples from the 32 patients were collected as soon as they were removed from the body. Each tumor sample was divided into two sections. One section was ground and stimulated in RPMI-1640 medium (HyClone Laboratories, Inc., Logan, UT, USA) containing IFN-α2b (final concentration, 3 MIU/ml) for 4 h, and the other section was incubated in RPMI-1640 medium without IFN, which served as a control. The benign renal tissues were collected from 10 patients who underwent a nephrectomy as a result of nonmalignant disease. All samples were stored at −80°C. The present study was approved by the Ethics Committee of The People’s Hospital of Guangxi Zhuang Autonomous Region. Written consent was obtained from all patients.

Immunohistochemistry

The expression levels of JAK1, P-JAK1, STAT1, P-STAT1, STAT2 and P-STAT2 were detected by immunohistochemical staining of the renal cell carcinomas and benign renal tissues. The antibodies of P-JAK1, STAT2 and P-STAT2 were purchased from Abcam (Cambridge, UK). The antibodies of JAK1, STAT1 and P-STAT1 were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). The immunohistochemical staining and evaluation were performed as previously described (12). All sections were blindly analyzed by experienced pathologists. Briefly, the immunohistochemical analysis was performed after recoding the sections to create a blind set. The overall intensity and percentage were evaluated under a light microscope (Olympus, Tokyo, Japan). Briefly, the immunohistochemical results were categorized into four grades based on the percentage of positive cells and/or the staining intensity, which was identified by comparing the section with the positive controls in each experiment. The grades were as follows: (−), positive cells <5% of the cancer tissue and/or weakly stained; (+), <25% and/or weakly stained; (++), <50% and/or moderately stained; and (+++), >75% and/or strongly stained.

Semiquantitative polymerase chain reaction (qPCR) assay

Total RNA was isolated from the tumor and benign tissues using TRIzol® reagent (Invitrogen, Carlsbad, CA, USA). The RNA concentration was determined using a spectrophotometer (Bio-Rad Laboratories, Hercules, CA, USA). Complementary DNA was synthesized from 3 μg total RNA with a RevertAid First Strand cDNA Synthesis kit (Fermentas, Hanover, MD, USA) according to the manufacturer’s instructions. The qPCR assay was performed with 20 μl reaction mixture, and the PCR was conducted with 35 cycles of 94°C for 30 sec and 72°C for 1 min. β-actin served as an internal control. The PCR products underwent electrophoresis by 2% agarose gel analysis. The expression levels of the target genes were evaluated by calculating the average ratios of gray scale using a computerized gel imaging system (Bio-Rad Laboratories). The primers that were used for the amplification are listed in Table II.

Table II

Sequences of the primers used.

Table II

Sequences of the primers used.

GeneSequence (5′→3′)Length (bp)Tm (°C)
JAK1Sense: TTCTACATGGGGGGATAG
Antisense: TAAGTATGGAAACCCTCTAA
27854.4
STAT1Sense: GGTTGAACCCTACACGAAG
Antisense: CTACAGAGCCCACTATCCG
33557.4
STAT2Sense: ATACTAGGGACGGGAAGTCG
Antisense: CTGGGAAAAGGGCTGAATG
36859.8
β-actinSense: CGTGGACATCCGCAAAGAC
Antisense: AAGAAAGGGTGTAACGCAACT
306

[i] JAK, Janus kinase; STAT, Signal Transducer and Activator of Transcription.

Western blot analysis

The tumor samples, which had been stimulated with IFN, were lysed and homogenized (SanShon Machinery, Zhejiang, China) in radioimmunoprecipitation assay buffer and the control samples were treated in the same way. The protein concentration in the samples was subsequently determined. Equal amounts of protein were separated on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels and transferred to a polyvinylidene difluoride membrane (Millipore, Billerica, MA, USA). The membrane was blocked with non-fat milk for 2 h and incubated with the primary antibodies overnight. Following washing with Tris-buffered saline and Tween 20 (TBST) for 30 min, the membrane was incubated for 1 h, washed with TBST and the proteins were detected with an enhanced chemiluminescence kit (Bio-Rad Laboratories). The protein expression levels were evaluated by calculating the average ratios of gray scale using a computerized gel imaging system; GAPDH served as the control.

Statistical analysis

The positive expression rates between the tumor and benign tissues were assessed with χ2 test. The qPCR and western blot data were analyzed using Student’s t-test. P<0.05 was considered to indicate a statistically significant difference. The data were analyzed with SPSS software version 19.0 (IBM, Armonk, NY, USA).

Results

Immunohistochemical staining in the renal cell carcinomas and benign renal tissues

Positive immunohistochemical staining was observed in the cytoplasm or cytomembranes of the renal tubules. The positive expression rates of JAK1, STAT1 and P-STAT1 in the renal cell carcinomas were significantly lower than those observed in the benign renal tissues (P<0.05). The expression rates of STAT2 in the renal cell carcinomas were elevated compared with those in the benign renal tissues (P<0.05). No differences in the expression rates of P-JAK1 and P-STAT2 between the renal cell carcinoma tissues and benign renal tissues were identified (Figs. 1–3; Table III).

Figure 1

(A) Negative expression of Janus kinase 1 (JAK1) in renal cancer tissue. (B) Positive expression of JAK1 in benign renal tissue. Magnification, ×200; staining, 3,3′-diaminobenzidine.

Figure 3

(A) Negative expression of phosphorylated Signal Transducer and Activator of Transcription 1 (P-STAT1) in renal cancer tissue. Magnification, ×400. (B) Positive expression of P-STAT1 in benign renal tissue. Magnification, ×200; staining, 3,3′-diaminobenzidine.

Table III

Expression rates of JAK-STAT signaling pathway components in renal cell carcinoma and benign renal tissue.

Table III

Expression rates of JAK-STAT signaling pathway components in renal cell carcinoma and benign renal tissue.

Signaling pathway componentRenal cell carcinoma, % (n)Benign renal tissue, % (n)


−+ to +++−+ to +++
JAK175.0 (24/32)25.0 (8/32)30.0 (3/10) 70.0 (7/10)
P-JAK1100.0 (32/32)0.0 (0/32)100.0 (10/10)0.0 (0/10)
STAT168.8 (22/32)31.2 (10/32)50.0 (5/10)50.0 (5/10)
P-STAT187.5 (28/32)12.5 (4/32)30.0 (3/10)70.0 (7/10)
STAT20.0 (0/32)100.0 (32/32)20.0 (2/10)80.0 (8/10)
P-STAT20.0 (0/32)100.0 (32/32)0.0 (0/10)100.0 (10/10)

[i] JAK, Janus kinase; P, phosphorylated; STAT, Signal Transducer and Activator of Transcription.

qPCR detection of the JAK-STAT mRNA expression levels

The JAK1, STAT1 and STAT2 mRNA levels were detected in the renal cell carcinomas and benign renal tissues. The relative expression levels of JAK1 (0.696±0.102) and STAT1 (0.341±0.068) in the tumor tissues were lower than those in the benign tissues (0.957±0.103 and 0.547±0.082, respectively; P<0.05). No significant differences were identified in the relative mRNA expression levels of STAT2 (0.702±0.101 vs. 0.676±0.105) between the two types of tissue (Fig. 4).

Figure 4

Relative ratio of the mRNA levels of JAK-STAT (*P<0.05). JAK, Janus kinase; STAT, Signal Transducer and Activator of Transcription; RCC, renal cell carcinomas; BRT, benign renal tissues.

Western blot analysis determined the changes in the levels of JAK-STAT expression following stimulation with IFN

To determine the active status of JAK-STAT in the tumor tissues following stimulation with IFN-α2b, the expression levels of JAK-STAT in the IFN stimulated and control tumor tissues were identified using western blot analysis. The expression levels of JAK1, P-JAK1, STAT1 and P-STAT1 were examined in the two types of tissues. The results showed that IFN stimulation significantly increased the expression levels of P-STAT1 (Figs. 5–7), however, not those of STAT1, JAK1 and P-JAK1 (P<0.05; Table IV). Enhanced expression levels of P-STAT1 were detected in 75% (24/32) of the samples, however, the levels varied markedly between the samples. Enhanced expression levels of P-STAT1 were not detected in 25% of the samples. The percentage of enhanced expression levels of P-STAT1 increased significantly when compared with those of the control (P<0.05).

Figure 5

High enhanced expression levels of phosphorylated Signal Transducer and Activator of Transcription 1 (91 kDa). Right band: Stimulated with interferon-α2b.

Figure 7

GAPDH (36 kDa).

Table IV

Relative expression levels of JAK-STAT signaling pathway components prior to and following stimulation with interferon (n=32).

Table IV

Relative expression levels of JAK-STAT signaling pathway components prior to and following stimulation with interferon (n=32).

Relative expression level, mean ± standard deviation

Pathway componentsControl tumor tissueStimulated tumor tissue
JAK10.253±0.140.298±0.19
P-JAK10.316±0.230.307±0.14
STAT10.424±0.270.384±0.20
P-STAT10.190±0.120.460±0.24a

a P<0.05, compared with control tumor tissue.

{ label (or @symbol) needed for fn[@id='tfn5-mmr-09-05-1929'] } JAK, Janus kinase; P, phosphorylated; STAT, Signal Transducer and Activator of Transcription.

Enhanced P-STAT1 expression levels were associated with relapse and metastasis of renal cell carcinoma

The patients were followed up for 24 months after the immunotherapy with IFN. Clinical evaluation was performed by regular interviews, and relapse and metastasis of the tumors were diagnosed using enhanced computed tomography scanning and tissue biopsy analysis. The patients were divided into two groups (high and low expression) based on whether the enhancement of the P-STAT1 expression levels was above or below the mean value. The rates of relapse and metastasis were compared between the high and low expression level groups. All patients tolerated the immunotherapy well and completed their treatment courses. By the end of the follow-up period, nine patients suffered local relapse and lung metastasis was identified in one patient. The high expression levels group exhibited reduced relapse and metastatic rates compared with those of the low expression group (P<0.05; Table V).

Table V

Local relapse and metastasis rates of the renal cell carcinomas in the two groups; high and low expression of phosphorylated Signal Transducer and Activator of Transcription.

Table V

Local relapse and metastasis rates of the renal cell carcinomas in the two groups; high and low expression of phosphorylated Signal Transducer and Activator of Transcription.

GroupLocal relapse rate, % (n)Metastasis rate, % (n)
High expression16.7 (2/12)0.0 (0/10)
Low expression35.0 (7/20)5.0 (1/20)

Discussion

Although IFN-α is a treatment option for advanced and metastatic renal cell carcinoma, a substantial proportion of patients fail to respond to IFN treatment (13). The mechanism of resistance to IFN treatment of renal cell carcinoma remains unclear. The cytokine-activated JAK-STAT pathway has an important role in the control of immune responses. The present study focused on the expression status of the components of the JAK-STAT pathway in human renal cell carcinoma and attempted to identify a biomarker, which predicts the IFN response in patients undergoing immunotherapy.

The expression levels of JAK-STAT in renal cancer carcinoma tissues were examined and the results indicated that the positive expression rates of JAK1, STAT1 and P-STAT1 in the renal cell carcinomas were significantly lower compared with those in the benign renal tissues. Furthermore, the qPCR assay showed that the relative mRNA levels of JAK1 and STAT1 in the malignant tissues were lower than those in the benign tissues. A previous study on IFN-resistant human melanoma cells demonstrated that a defect in the levels of STAT1 was responsible for the reduced response to IFN treatment, and transfection of the IFN-resistant cell line to express increased levels of STAT1 partially restored the IFN response (14). In addition, the results from an in vitro study indicated that an IFN-resistant renal carcinoma cell line was associated with defective induction of STAT1 (15). The results of the present study demonstrated that defective expression of the JAK-STAT1 pathway may be a common phenomenon in IFN-resistant malignant tumors. Furthermore, the results of defective expression levels of JAK1 and STAT1 in human renal carcinoma tissues, which were observed in the present study, were consistent with the findings from a previous cell line study (7).

The change in the expression levels of JAK, P-JAK1, STAT1 and P-STAT1 following IFN stimulation was investigated in the present study using immunohistochemical staining and qPCR. IFNs are able to bind to a specific cell surface IFN receptor, and IFN receptor activation leads to the phosphorylation of STAT1 and STAT2, which is critical for signal transduction (16). The results of the present study showed that IFN stimulation increased the expression levels of P-STAT1. Enhanced expression levels were detected in 75% (24/32) of the tumor samples. These results indicated that the majority of tumors respond to IFN stimulation, however, the response in the present study varied markedly between the tumor samples, which may indicate different responses to IFN therapy among patients. As only the enhanced expression levels of P-STAT1 were detected by western blot analysis, the association between the enhanced expression levels of P-STAT1 and the response to IFN therapy in patients was subsequently investigated. All patients who had undergone IFN therapy for 24 months were followed up and the results indicated that the patients whose tumors expressed P-STAT1 in high levels following IFN stimulation were less likely to suffer a relapse or metastasis. In addition, the post surgery recurrence rate of locally advanced renal cell carcinoma was 64% according to the data of a previous study (17), however, the rate of relapse in the high expression levels group in the present study was 16.7%, which indicated that the lower relapse rate in the present study was due to the IFN therapy.

In conclusion, numerous attempts have been made to identify a predictive biomarker for IFN resistance in different fields (8,18,19). The results of the present study indicated that P-STAT1 may be a novel predictor of the IFN response in patients with advanced renal cell carcinoma. This study presents the preliminary results, however, a greater population of patients and an increased follow-up period are required for further investigation.

Acknowledgements

The present study was funded by the Natural Science Foundation of Guangxi, China (grant no. 2010GXNSFB013080).

References

1 

Siegel R, Naishadham D and Jemal A: Cancer statistics, 2012. CA Cancer J Clin. 62:10–29. 2012. View Article : Google Scholar

2 

Ljungberg B, Campbell SC, Choi HY, Jacqmin D, Lee JE, Weikert S and Kiemeney LA: The epidemiology of renal cell carcinoma. Eur Urol. 60:615–621. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Athar U and Gentile TC: Treatment options for metastatic renal cell carcinoma: a review. Can J Urol. 15:3954–3966. 2008.PubMed/NCBI

4 

Jurado JM, Zarcos I, Delgado M, Blancas I, Legerén M and García-Puche JL: Temsirolimus in overtreated metastatic renal cancer with subsequent use of sunitinib: A case report. Oncol Lett. 5:1382–1384. 2013.PubMed/NCBI

5 

Tanriverdi O: Review on targeted treatment of patients with advanced-stage renal cell carcinoma: a medical oncologist’s perspective. Asian Pac J Cancer Prev. 14:609–617. 2013.PubMed/NCBI

6 

Darnell JE Jr, Kerr IM and Stark GR: Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science. 264:1415–1421. 1994. View Article : Google Scholar : PubMed/NCBI

7 

Shang D, Liu Y, Ito N, Kamoto T and Ogawa O: Defective Jak-Stat activation in renal cell carcinoma is associated with interferon-alpha resistance. Cancer Sci. 98:1259–1264. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Eto M, Kamba T, Miyake H, Fujisawa M, Kamai T, Uemura H, Tsukamoto T, et al; Japan Immunotherapy SNPs-Study Group for Kidney Cancer. STAT3 polymorphism can predict the response to interferon-α therapy in patients with metastatic renal cell carcinoma. Eur Urol. 63:745–752. 2013.

9 

Masuda A, Kamai T, Abe H, Arai K and Yoshida K: Is Stat3 and/or p53 mRNA expression a prognostic marker for renal cell carcinoma? Biomed Res. 30:171–176. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Edge S, Byrd DR, Compton CC, Fritz AG, Greene FL and Trotti A: AJCC Cancer Staging Manual. 7th ed. Springer Verlag; New York, NY: pp. 547–560. 2009

11 

Na Yanqun, Ye Zhangqun and Sun Guang: The CUA Guideline for Urological Disease. People’s Health Publishing House; Beijing: pp. 4–16. 2011, (In Chinese).

12 

Chen L, Zhu YY, Zhang XJ, Wang GL, Li XY, He S, Zhang JB and Zhu JW: TSPAN1 protein expression: a significant prognostic indicator for patients with colorectal adenocarcinoma. World J Gastroenterol. 15:2270–2276. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Zeng Z, Que T, Zhang J and Hu Y: A study exploring critical pathways in clear cell renal cell carcinoma. Exp Ther Med. 7:121–130. 2014.PubMed/NCBI

14 

Wong LH, Krauer KG, Hatzinisiriou I, Estcourt MJ, Hersey P, Tam ND, Edmondson S, et al: Interferon-resistant human melanoma cells are deficient in ISGF3 components, STAT1, STAT2, and p48-ISGF3gamma. J Biol Chem. 272:28779–28785. 1997. View Article : Google Scholar : PubMed/NCBI

15 

Brinckmann A, Axer S, Jakschies D, Dallmann I, Grosse J, Patzelt T, Bernier T, et al: Interferon-alpha resistance in renal carcinoma cells is associated with defective induction of signal transducer and activator of transcription 1 which can be restored by a supernatant of phorbol 12-myristate 13-acetate stimulated peripheral blood mononuclear cells. Br J Cancer. 86:449–455. 2002.

16 

Caraglia M, Marra M, Pelaia G, Maselli R, Caputi M, Marsico SA and Abbruzzese A: Alpha-interferon and its effects on signal transduction pathways. J Cell Physiol. 202:323–335. 2005. View Article : Google Scholar : PubMed/NCBI

17 

Lam JS, Shvarts O, Leppert JT, Pantuck AJ, Figlin RA and Belldegrun AS: Postoperative surveillance protocol for patients with localized and locally advanced renal cell carcinoma based on a validated prognostic nomogram and risk group stratification system. J Urol. 174:466–472. 2005. View Article : Google Scholar

18 

Noguchi Y, Kurokawa MS, Okuse C, Matsumoto N, Nagai K, Sato T, Arito M, et al: Serum peptides, represented by complement 3f des-arginine, are useful for prediction of the response to pegylated interferon-α plus ribavirin in patients with chronic hepatitis C. Hepatol Res. 43:743–756. 2013.PubMed/NCBI

19 

Azuma T, Matayoshi Y, Nagase Y and Oshi M: Neutrophil number after interferon-alfa treatment is an independent predictive marker of overall survival in metastatic renal cell carcinoma. Clin Genitourin Cancer. 10:180–184. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li W, Wei Q and Liang J: Phosphorylated Signal Transducer and Activator of Transcription 1 is a potential predictor of interferon response in patients with advanced renal cell carcinoma. Mol Med Rep 9: 1929-1934, 2014.
APA
Li, W., Wei, Q., & Liang, J. (2014). Phosphorylated Signal Transducer and Activator of Transcription 1 is a potential predictor of interferon response in patients with advanced renal cell carcinoma. Molecular Medicine Reports, 9, 1929-1934. https://doi.org/10.3892/mmr.2014.2046
MLA
Li, W., Wei, Q., Liang, J."Phosphorylated Signal Transducer and Activator of Transcription 1 is a potential predictor of interferon response in patients with advanced renal cell carcinoma". Molecular Medicine Reports 9.5 (2014): 1929-1934.
Chicago
Li, W., Wei, Q., Liang, J."Phosphorylated Signal Transducer and Activator of Transcription 1 is a potential predictor of interferon response in patients with advanced renal cell carcinoma". Molecular Medicine Reports 9, no. 5 (2014): 1929-1934. https://doi.org/10.3892/mmr.2014.2046
Copy and paste a formatted citation
x
Spandidos Publications style
Li W, Wei Q and Liang J: Phosphorylated Signal Transducer and Activator of Transcription 1 is a potential predictor of interferon response in patients with advanced renal cell carcinoma. Mol Med Rep 9: 1929-1934, 2014.
APA
Li, W., Wei, Q., & Liang, J. (2014). Phosphorylated Signal Transducer and Activator of Transcription 1 is a potential predictor of interferon response in patients with advanced renal cell carcinoma. Molecular Medicine Reports, 9, 1929-1934. https://doi.org/10.3892/mmr.2014.2046
MLA
Li, W., Wei, Q., Liang, J."Phosphorylated Signal Transducer and Activator of Transcription 1 is a potential predictor of interferon response in patients with advanced renal cell carcinoma". Molecular Medicine Reports 9.5 (2014): 1929-1934.
Chicago
Li, W., Wei, Q., Liang, J."Phosphorylated Signal Transducer and Activator of Transcription 1 is a potential predictor of interferon response in patients with advanced renal cell carcinoma". Molecular Medicine Reports 9, no. 5 (2014): 1929-1934. https://doi.org/10.3892/mmr.2014.2046
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team