Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
September-2014 Volume 10 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2014 Volume 10 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Congenital cataracts due to a novel 2‑bp deletion in CRYBA1/A3

  • Authors:
    • Jing Zhang
    • Yanhua Zhang
    • Fang Fang
    • Weihong Mu
    • Ning  Zhang
    • Tongshun Xu
    • Qinying Cao
  • View Affiliations / Copyright

    Affiliations: Prenatal Diagnosis Center, Shijiazhuang Obstetrics and Gynecology Hospital, Shijiazhuang, Hebei, P.R. China, Department of Cardiology, The Second Hospital of Hebei Medical University, Shijiazhuang, Hebei, P.R. China, Department of Surgery, Shijiazhuang Obstetrics and Gynecology Hospital, Shijiazhuang, Hebei, P.R. China
  • Pages: 1614-1618
    |
    Published online on: June 13, 2014
       https://doi.org/10.3892/mmr.2014.2324
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Congenital cataracts, which are a clinically and genetically heterogeneous group of eye disorders, lead to visual impairment and are a significant cause of blindness in childhood. A major proportion of the causative mutations for congenital cataracts are found in crystallin genes. In the present study, a novel deletion mutation (c.590‑591delAG) in exon 6 of CRYBA1/A3 was identified in a large family with autosomal dominant congenital cataracts. An increase in local hydrophobicity was predicted around the mutation site; however, further studies are required to determine the exact effect of the mutation on βA1/A3‑crystallin structure and function. To the best of our knowledge, this is the first report of an association between a frameshift mutation in exon 6 of CRYBA1/A3 and congenital cataracts.

Introduction

Cataracts are opacities of the crystalline lens that can be categorized into early onset (congenital or infantile) and age-related conditions. Congenital cataracts exhibit a prevalence of ~1–6 cases per 10,000 live births and are a significant cause of blindness in childhood (1). Among the cases of congenital cataracts, approximately one-third are hereditary, with most occurring in a nonsyndromic autosomal dominant fashion (2). Congenital cataracts exhibit high clinical and genetic heterogeneity. A total of 40 genetic loci have been associated with congenital cataracts, with ≥26 susceptibility genes cloned and sequenced (3). Among the disease-causing mutations identified, ~50% are found in crystallins, 25% in connexins and the remainder within genes such as heat shock transcription factor-4, aquaporin-0 and beaded filament structural protein-2 (3). Crystallins are abundant, soluble proteins located in the eye lens. The major human crystallins comprise 90% of protein in the mature lens and contain two different superfamilies: the small heat-shock proteins (α-crystallins) and the βγ-crystallins.

In this study a functional candidate approach was used to investigate the known crystallin genes, including CRYAA, CRYAB, CRYBA1/A3, CRYBB1, CRYBB2, CRYGC, CRYGD and CRYGS, in which a major proportion of the mutations identified in a large family with congenital cataracts were found.

Subjects and methods

Subjects

A four-generation Chinese family with autosomal dominant congenital cataracts was identified from the Shijiazhuang Obstetrics and Gynecology Hospital (Shijiazhuang, China) (Fig. 1). The study was approved by the Ethics Committee of the Shijiazhuang Obstetrics and Gynecology Hospital, and the study protocol followed the principles of the Declaration of Helsinki. Informed consent was obtained from all family participants. One hundred unrelated subjects without eye disease were recruited from the Shijiazhuang Obstetrics and Gynecology Hospital as unaffected controls. A history of cataract extraction or ophthalmologic examination was used to determine affected family members. In total, eight family members (III:1, III:3, III:6, III:7, III:8, IV:1, IV:2 and IV:3) participated in the study. All participating family members and controls underwent ophthalmic examination, including visual acuity, slit-lamp and fundus examination. Phenotypes were documented by slit-lamp photography and 5 ml venous blood was collected in BD Vacutainer™ tubes (BD Biosciences, San Jose, CA, USA) containing EDTA for further analysis. Genomic DNA was extracted by QIAamp DNA Blood Mini kits (Qiagen Sciences, Inc., Germantown, MD, USA).

Figure 1

Chinese congenital cataract pedigree. The arrow indicates the proband. Black shading represents family members with bilateral congenital cataracts.

Mutation detection

All coding exons and intron-exon junctions of candidate genes known to be associated with congenital cataracts were amplified by polymerase chain reaction (PCR) using the primers listed in Table I. Each reaction mix (25 μl) contained 20 ng genomic DNA, 1X PCR buffer, 1.5 mM MgCl2, 0.2 mM deoxynucleotide triphosphates, 0.5 μM each of forward and reverse primer and 2.5 units Taq DNA polymerase (Tiangen Biotech, Beijing, China). The PCR conditions for DNA amplification were: 95°C for 5 min, followed by 35 cycles at 95°C for 30 sec, 57–63°C for 30 sec (annealing temperature dependent on the primer), 72°C for 30 sec, with a final extension at 72°C for 10 min. The PCR products were sequenced using an ABI 3730 Automated Sequencer (Applied Biosystems, Foster City, CA, USA). Sequencing results were analyzed using Chromas 2.33 (http://www.technelysium.com.au/chromas.html) and compared with the National Center for Biotechnology Information (NCBI) reference sequences (http://www.ncbi.nlm.nih.gov/).

Table I

Primers used for the polymerase chain reaction.

Table I

Primers used for the polymerase chain reaction.

NameForward (5′-3′)Reverse (5′-3′)
CRYAA-1 AGCAGCCTTCTTCATGAGC CAAGACCAGAGTCCATCG
CRYAA-2 GGCAGGTGACCGAAGCATC GAAGGCATGGTGCAGGTG
CRYAA-3 GCAGCTTCTCTGGCATGG GGGAAGCAAAGGAAGACAGA
CRYAB-1 AACCCCTGACATCACCATTC AAGGACTCTCCCGTCCTAGC
CRYAB-2 CCATCCCATTCCCTTACCTT GCCTCCAAAGCTGATAGCAC
CRYAB-3 TCTCTCTGCCTCTTTCCTCA CCTTGGAGCCCTCTAAATCA
CRYBA1-1 GGCAGAGGGAGAGCAGAGTG CACTAGGCAGGAGAACTGGG
CRYBA1-2 AGTGAGCAGCAGAGCCAGAA GGTCAGTCACTGCCTTATGG
CRYBA1-3 AAGCACAGAGTCAGACTGAAGT CCCCTGTCTGAAGGGACCTG
CRYBA1-4 GTACAGCTCTACTGGGATTG ACTGATGATAAATAGCATGAACG
CRYBA1-5 GAATGATAGCCATAGCACTAG TACCGATACGTATGAAATCTGA
CRYBA1-6 CATCTCATACCATTGTGTTGAG GCAAGGTCTCATGCTTGAGG
CRYBB1-1 CCCTGGCTGGGGTTGTTGA TGCCTATCTGCCTGTCTGTTTCTC
CRYBB1-2 TAGCGGGGTAATGGAGGGTG AGGATAAGAGTCTGGGGAGGTGG
CRYBB1-3 CCTGCACTGCTGGCTTTTATTTA TCTCCAGAGCCCAGAACCATG
CRYBB1-4 CCAACTCCAAGGAAACAGGCATA CCTCCCTACCCACCATCATCTC
CRYBB1-5 TAGACAGCAGTGGTCCCTGGAGA AGCACTGGGAGACTGTGGAAGG
CRYBB1-6 CCTAGAAAAGGAAACCGAGGCC AGCGAGGAAGTCACATCCCAGTA
CRYBB2-1 GTTTGGGGCCAGAGGGGAGTGGT TGGGCTGGGGAGGGACTTTCAGTA
CRYBB2-2 CCTTCAGCATCCTTTGGGTTCTCT GCAGTTCTAAAAGCTTCATCAGTC
CRYBB2-3 GTAGCCAGGATTCTGCCATAGGAA GTGCCCTCTGGAGCATTTCATAGT
CRYBB2-4 GGCCCCCTCACCCATACTCA CTTCCCTCCTGCCTCAACCTAATC
CRYBB2-5 CTTACCCTTGGGAAGTGGCAATGG TCAAAGACCCACAGCAGACAAGTT
CRYGC-1 TGCATAAAATCCCCTTACCG CCTCCCTGTAACCCACATTG
CRYGC-2 TGGTTGGACAAATTCTGGAAG CCCACCCCATTCACTTCTTA
CRYGD-1 CAGCAGCCCTCCTGCTAT GGGTCCTGACTTGAGGATGT
CRYGD-2 GCTTTTCTTCTCTTTTTATTTCTGG AAGAAAGACACAAGCAAATCAGT
CRYGS-2 GAAACCATCAATAGCGTCTAAATG TGAAAAGCGGGTAGGCTAAA
CRYGS-3 AATTAAGCCACCCAGCTCCT GGGAGTACACAGTCCCCAGA
CRYGS-4 GACCTGCTGGTGATTTCCAT CACTGTGGCGAGCACTGTAT
Bioinformatics analysis

The amino acid sequences of CRYBA1/A3 protein from four species (human, mouse, rat and cow) were obtained from the NCBI GenBank (https://www.ncbi.nih.gov/genbank/). Conservation analysis was performed using CLC Main Workbench Software (CLC bio, Aarhus, Denmark). Hydrophobicity changes were predicted using ProtScale (http://web.expasy.org/protscale/).

Results

Clinical evaluation

Using medical records and ophthalmic examinations, five family members (III:1, III:7, IV:1, IV:2 and IV:3) were diagnosed with bilateral congenital cataracts. Slit-lamp examination of the left eye of the proband (IV:3) showed nuclear lens opacities (Fig. 2). No other ocular or systemic abnormalities were identified.

Figure 2

Slit-lamp photograph of the left eye of the proband.

Mutation analysis

By direct sequencing of the coding regions of candidate genes, a novel heterozygous 2-bp deletion mutation (c.590-591delAG) in exon 6 of CRYBA1/A3 was identified (Fig. 3). This deletion led to a frameshift starting at amino acid residue 197, with a substitution of glutamic acid to valine, followed by an altered amino acid sequence (wild type, -EWGSHAQTSQIQSIRRIQQ; mutant, -VGLSCPDFADPIDSPNPTV). This altered sequence was identified in all affected family members, but was not detected in any unaffected family members or the 100 unrelated control subjects.

Figure 3

Partial sequence of CRYBA1/A3 at exon 6. (A) Sequence of an unaffected individual. (B) Sequence of an affected individual. The deletion mutation c.590-591delAG was identified in all the affected participants, but was not found in unaffected family members or the 100 unrelated control subjects.

Bioinformatic analysis

Conservation analysis revealed that the sequence from amino acid residue 197 to the COOH-terminal end is highly conserved among species (Fig. 4). Furthermore, an increase in local hydrophobicity around the mutation site was predicted by ProtScale (Fig. 5).

Figure 4

Multiple-sequence alignment of the amino acid sequence in CRYBA1/A3 protein from different species. The alignment data indicate that the 197th amino acid position is highly conserved (indicated by a dash) among the four species.

Figure 5

Altered hydrophobicity in CRYBA1/A3 protein. (A) The hydrophobicity of WT CRYBA1/A3 was predicted using the ProtScale program on the Expasy proteomics server. (B) Hydrophobicity of mutant-type CRYBA1/A3. Compared with the WT, the mutant type exhibits markedly enhanced hydrophobicity, which is indicated by the rectangle. WT, wild type.

Discussion

Lens crystallin is fundamental for the establishment and maintenance of lens transparency (4). Previous studies in affected patients and transgenic animals indicate that mutations in crystallin genes cause cataracts (14–15). The human lens contains α-, β- and γ-crystallins, of which, β-crystallins comprise the greatest proportion (5). CRYBA3/A1 is located at 17q11.2 and is a member of the β-crystallin family. The gene utilizes an alternate translation initiation site to encode two proteins (βA3- and βA1-crystallin) from a single mRNA, and consists of six exons. β-crystallin comprises seven protein domains: Four homologous Greek key motifs, a connecting peptide and NH2- and COOH-terminal extensions. The first two exons of CRYBA3/A1 encode the N-terminal arm and the Greek key motifs are encoded by exons 3–6 (6). βA3- and βA1-crystallin are identical, with the exception of 17 additional amino acid residues found on the NH2-terminal arm of βA3-crystallin (7).

To date, several CRYBA3/A1 gene mutations have been associated with autosomal dominant congenital cataracts (Table II). All known CRYBA3/A1 gene mutations can be divided into two clusters, one located in the exon 3 splice site (8–9), and the other in an exon 4 in-frame deletion (10). In the present study, a novel 2-bp deletion mutation (590-591delAG) in exon 6 of CRYBA1/A3 was identified. This mutation caused a frameshift and resulted in an alternative βA1/βA3-crystallin COOH-terminal. Typically, β- or γ-crystallin mutations cause major abnormalities in protein structure, stability, solubility or the ability to oligomerize, and are predicted to precipitate from solution to cause lens opacity formation (11–12). The COOH-terminal of βA1/βA3-crystallin is highly conserved, and it has been reported that the C-terminal domain plays a role in structural stability (11). The ProtScale protein analysis in the present study showed a notable increase in local hydrophobicity around the deletion site in CRYBA3/A1. As demonstrated in other lens proteins, hydrophobicity is associated with crystallin activities, and an increased hydrophobic interaction can reduce protein solubility or lead to abnormal protein folding (12–13). In the present study, it was speculated that the mutant COOH-terminal produces an abnormal protein structure with altered stability and/or solubility.

Table II

Summary of mutations in CRYBA1/A3 responsible for congenital cataracts.

Table II

Summary of mutations in CRYBA1/A3 responsible for congenital cataracts.

LocusNucleotideAmino acid
IVS3 (14)IVS3+1 G.>CSplice site mutation
IVS3 (5)IVS3+1 G.>ASplice site mutation
IVS3 (8)IVS3+1 G.>TSplice site mutation
IVS3 (9)IVS3+2 T.>GSplice site mutation
Exon 4 (10,13)276-281delGGAGGAp.90Glydel p.91Glydel
Exon 4279-281delGGAGGAp.91Glydel

[i] IVS3, sequence of the 3rd intron.

In conclusion, this is the first study, to the best of our knowledge, to associate a frameshift mutation in exon 6 of CRYBA1/A3 with the development of congenital cataracts, and highlights the physiological importance of βA1/A3-crystallin. The possible effect of the mutation on βA1/A3-crystallin structure and function requires further investigation.

Acknowledgements

The authors would like to thank the family members for their participation in this study. The study was supported by a grant from the Plan Issue of Hebei Province Health Department, (project no.20110186).

References

1 

Francis PJ, Berry V, Bhattacharya SS and Moore AT: The genetics of childhood cataract. J Med Genet. 37:481–488. 2000. View Article : Google Scholar : PubMed/NCBI

2 

Reddy MA, Francis PJ, Berry V, Bhattacharya SS and Moore AT: Molecular genetic basis of inherited cataract and associated phenotypes. Surv Ophthalmol. 49:300–315. 2004. View Article : Google Scholar : PubMed/NCBI

3 

Hejtmancik JF: Congenital cataracts and their molecular genetics. Semin Cell Dev Biol. 19:134–149. 2008. View Article : Google Scholar

4 

Jester JV: Corneal crystallins and the development of cellular transparency. Semin Cell Dev Biol. 19:82–93. 2008. View Article : Google Scholar : PubMed/NCBI

5 

Zhu Y, Shentu X, Wang W, Li J, Jin C and Yao K: A Chinese family with progressive childhood cataracts and IVS3+1G>A CRYBA3/A1 mutations. Mol Vis. 16:2347–2353. 2010.PubMed/NCBI

6 

Wistow G, Turnell B, Summers L, Slingsby C, Moss D, Miller L, Lindley P and Blundell T: X-ray analysis of the eye lens protein gamma-II crystallin at 1.9 A resolution. J Mol Biol. 170:175–202. 1983. View Article : Google Scholar : PubMed/NCBI

7 

Werten PJ, Carver JA, Jaenicke R and de Jong WW: The elusive role of the N-terminal extension of beta A3- and beta A1-crystallin. Protein Eng. 9:1021–1028. 1996. View Article : Google Scholar : PubMed/NCBI

8 

Yang Z, Li Q, Ma Z, Guo Y, Zhu S and Ma X: A G→T splice site mutation of CRYBA1/A3 associated with autosomal dominant suture cataracts in a Chinese family. Mol Vis. 17:2065–2071. 2011.

9 

Yang Z, Su D, Li Q, Yang F, Ma Z, Zhu S and Ma X: A novel T→G splice site mutation of CRYBA1/A3 associated with autosomal dominant nuclear cataracts in a Chinese family. Mol Vis. 18:1283–1288. 2012.

10 

Lu S, Zhao C, Jiao H, Kere J, Tang X, Zhao F, Zhang X, Zhao K and Larsson C: Two Chinese families with pulverulent congenital cataracts and deltaG91 CRYBA1 mutations. Mol Vis. 13:1154–1160. 2007.PubMed/NCBI

11 

Gupta R, Srivastava K and Srivastava OP: Truncation of motifs III and IV in human lens betaA3-crystallin destabilizes the structure. Biochemistry. 45:9964–9978. 2006. View Article : Google Scholar : PubMed/NCBI

12 

Srivastava K, Gupta R, Chaves JM and Srivastava OP: Truncated human betaB1-crystallin shows altered structural properties and interaction with human betaA3-crystallin. Biochemistry. 48:7179–7189. 2009. View Article : Google Scholar

13 

Reddy MA, Bateman OA, Chakarova C, Ferris J, Berry V, Lomas E, Sarra R, Smith MA, Moore AT, Bhattacharya SS and Slingsby C: Characterization of the G91del CRYBA1/3-crystallin protein: a cause of human inherited cataract. Hum Mol Genet. 13:945–953. 2004. View Article : Google Scholar : PubMed/NCBI

14 

Bateman JB, Geyer DD, Flodman P, Johannes M, Sikela J, Walter N, Moreira AT, Clancy K and Spence MA: A new betaA1-crystallin splice junction mutation in autosomal dominant cataract. Invest Ophthalmol Vis Sci. 41:3278–3285. 2000.PubMed/NCBI

15 

Andley UP, Hamilton PD, Ravi N and Weihl CC: A knock-in mouse model for the R120G mutation of αB-crystallin recapitulates human hereditary myopathy and cataracts. PLoS One. 6:e176712011.

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang J, Zhang Y, Fang F, Mu W, Zhang N, Xu T and Cao Q: Congenital cataracts due to a novel 2‑bp deletion in CRYBA1/A3. Mol Med Rep 10: 1614-1618, 2014.
APA
Zhang, J., Zhang, Y., Fang, F., Mu, W., Zhang, N., Xu, T., & Cao, Q. (2014). Congenital cataracts due to a novel 2‑bp deletion in CRYBA1/A3. Molecular Medicine Reports, 10, 1614-1618. https://doi.org/10.3892/mmr.2014.2324
MLA
Zhang, J., Zhang, Y., Fang, F., Mu, W., Zhang, N., Xu, T., Cao, Q."Congenital cataracts due to a novel 2‑bp deletion in CRYBA1/A3". Molecular Medicine Reports 10.3 (2014): 1614-1618.
Chicago
Zhang, J., Zhang, Y., Fang, F., Mu, W., Zhang, N., Xu, T., Cao, Q."Congenital cataracts due to a novel 2‑bp deletion in CRYBA1/A3". Molecular Medicine Reports 10, no. 3 (2014): 1614-1618. https://doi.org/10.3892/mmr.2014.2324
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang J, Zhang Y, Fang F, Mu W, Zhang N, Xu T and Cao Q: Congenital cataracts due to a novel 2‑bp deletion in CRYBA1/A3. Mol Med Rep 10: 1614-1618, 2014.
APA
Zhang, J., Zhang, Y., Fang, F., Mu, W., Zhang, N., Xu, T., & Cao, Q. (2014). Congenital cataracts due to a novel 2‑bp deletion in CRYBA1/A3. Molecular Medicine Reports, 10, 1614-1618. https://doi.org/10.3892/mmr.2014.2324
MLA
Zhang, J., Zhang, Y., Fang, F., Mu, W., Zhang, N., Xu, T., Cao, Q."Congenital cataracts due to a novel 2‑bp deletion in CRYBA1/A3". Molecular Medicine Reports 10.3 (2014): 1614-1618.
Chicago
Zhang, J., Zhang, Y., Fang, F., Mu, W., Zhang, N., Xu, T., Cao, Q."Congenital cataracts due to a novel 2‑bp deletion in CRYBA1/A3". Molecular Medicine Reports 10, no. 3 (2014): 1614-1618. https://doi.org/10.3892/mmr.2014.2324
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team