Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
October 2014 Volume 10 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October 2014 Volume 10 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Inhibitory effects of Rubi Fructus extracts on hepatic steatosis development in high-fat diet-induced obese mice

  • Authors:
    • Mi Kyung Nam
    • Hye Ran Choi
    • Jin Sook Cho
    • Soo Min Cho
    • Ki Chan Ha
    • Tae-Hyeon Kim
    • Hee-Young Ryu
    • Young-Ik Lee
  • View Affiliations / Copyright

    Affiliations: Industrial Bioresource Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 305-606, Republic of Korea, Lee's Biotech Co., Daejeon 305-806, Republic of Korea, Healthcare Claims and Management Incorp., Jeonju, Chonbuk 949-14, Republic of Korea, Department of Gastroenterology, Wonkwang University School of Medicine, Iksan, Chonbuk 500-711, Republic of Korea
  • Pages: 1821-1827
    |
    Published online on: July 21, 2014
       https://doi.org/10.3892/mmr.2014.2398
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The present study was performed to investigate the potential effects of the unripened dried fruit of Rubus coreanus Miq., Rubi Fructus (RF), on hepatic steatosis and lipid metabolism in mice fed with a high‑fat diet (HFD) known to induce obesity and hyperlipidaemia. Rubi Fructus extract (RFex) fed mice demonstrated a reduced body weight and adipose tissue weight. RFex fed mice also demonstrated decreased aminotransferase levels, lipid contents [triglyceride (TG), total cholesterol (TC) and low‑density lipoprotein‑cholesterol (LDL‑C)], leptin content and increased high‑density lipoprotein‑cholesterol (HDL‑C) contents in the plasma. These effects were accompanied by a decreased expression of lipogenic genes, including sterol regulatory element binding protein‑1c, liver X receptor, fatty acid synthase (FAS), acetyl‑CoA carboxylase, cluster of differentiation 36, lipoprotein lipase and decreased lipogenic enzyme FAS and 3‑hydroxy‑3 methylglutamyl coenzyme reductase enzyme activities, while elevating carnitine palmitoyltrasferase‑1 activity. Based on these results, the present study hypothesized that the inhibitory effect on hepatic steatosis of RFex is the result of the suppression of lipid synthesis in mice fed with HFD, suggesting that RFex may be beneficial in preventing hepatic steatosis and liver lipotoxicity.

Introduction

Nonalcoholic fatty liver disease (NAFLD) is the most common cause of chronic liver disease, which includes a spectrum of liver diseases from hepatic steatosis to nonalcoholic steatohepatitis (1–3), where the latter is known to increase the risk of liver cirrhosis and hepatocellular carcinoma (4). NAFLD is associated with metabolic syndrome, consisting of obesity, diabetes, hyperlipidemia and insulin resistance (5). As a form of NAFLD, hepatic steatosis results from the accumulation of fat in the liver, primarily through excessive transport of free fatty acids from visceral adipose tissue into the liver and from an imbalance in de novo lipid synthesis and catabolism in hepatocytes (6–8). The prolonged energy imbalance increases the amount of triglyceride (TG) content in adipose tissue and these TGs are stored as lipid droplets in the liver. Thus, hepatic steatosis is generally characterized by excess hepatic lipid accumulation as esterified TG in the liver. Cellular toxicity mediated by this excess hepatic lipid accumulation known as lipotoxicity, has been implicated in the pathophysiology of insulin resistance, type 2 diabetes and metabolic syndrome (9).

Several agents are known to improve NAFLD histologically or biochemically in animals and humans (10), although, numerous side effects have been reported (11).

Rubus coreanus is one of the 100 genera in the family Rosaceae, subfamily Rosoideae, and there are currently 250 species of Rubus established around the world. The dried unripe fruit of Rubus coreanus Miq. Rubi Fructus (RF) has been used as a traditional oriental medicine in Asia, including Korea and China (12–14). RF has been used for the management of impotence and spermatorrhea, and as a stomachic and tonic in Korea (15–17), and it has been identified that RF exhibits a hepatoprotective effect in animal models (18,19). Ellagic acid from RF protects hepatocytes from damage by inhibiting mitohondrial production of reactive oxygen species (20), while the same flavonoid inhibits host immune tolerance induced by the hepatitis B virus-e antigen (21). Ellagic acid has also been reported to affect cellular lipid metabolism during benzoyl peroxide-induced toxicity and effectively reduced the elevations of plasma cholesterol in hyperlipidemic rabbits (22).

The present study examined the effects of the Rubi Fructus extract (RFex) containing ellagic acid on the development and progression of hepatic steatosis and liver lipotoxicity in mice fed with a high-fat diet (HFD) by assessing hepatic lipid accumulation, the mRNA expression of lipogenic genes and enzyme activities.

Materials and methods

Plant materials and the preparation of extracts

The unripened fruit of RF was collected during June from Buan (Chunra, Korea). The plant samples were kept in the herbarium of the Korea Research Institute of Bioscience and Biotechnology (KRIBB). The RFex containing ellagic acid was prepared by Lee’s Biotech Co., Ltd. (Yuseonggu, Daejeon, Korea).

Animal treatment

The male C57BL/6 mice were obtained from Koatech Technology Corporation (Seoul, Korea). The animals were allowed free access to rodent food (Purina Co., Seoul, Korea) and tap water and maintained in a controlled environment at 22°C and 50±10% relative humidity with a 12-h dark/light cycle, and acclimatized for at least one week prior to use. The mice were randomly divided into three groups: the normal diet (ND), high-fat diet (HFD) and HFD + RFex (100 mg/kg) fed group. The HFD was based on the diet from Open Source Diet (Central Animal Lab Inc., Seoul, Korea) containing 60% kcal fat, while the ND contained 10% kcal fat. The diets were administered for 10 weeks and the weight gain was measured once a week. Food intake was measured for three consecutive days per week by subtraction of food jar pre-and post-weights for 10 weeks. At necropsy, the sides of the epididymal, retroperitoneal and perirenal adipose tissues were removed and weighed, and the relative adipose tissue weight to body weight ratio was calculated.

All animal experiments were approved by the Institutional Animal Care and Use Committee and Ethics Committee, which were performed in accordance with the institutional guidelines at the KRIBB (Daejeon, Korea).

Plasma, hepatic lipid concentrations and liver histology

Following 10 weeks of RFex administration, blood samples were collected by a heart puncture method to determine the levels of plasma enzymes [alanine aminotransferase (ALT) and aspartate aminotransferase (AST)], plasma TG and total cholesterol (TC). The plasma was prepared by the centrifugation of blood (10,000 × g for 5 min at 4°C) and stored at −70°C until analysis. Plasma ALT and AST levels were measured using an automatic biochemical analyzer in the Animal Experiment Laboratory at the KRIBB. Plasma TG and TC levels were measured directly with a BCS analysis kit (Bioclinical System Co., Anyang, Korea). Plasma leptin was determined by the sandwich ELISA method using a commercially available rat leptin kit according to the manufacturer’s instructions (Bioclinical System Co., Anyang, Korea). Immediately following sacrification of the mice, half of the liver was removed, quickly frozen in liquid nitrogen and stored at −70°C. Hepatic lipids were extracted using the modified procedure of the Folch method (23). Briefly, frozen liver tissue was homogenized in 0.9% NaCl solution and chloroform - methanol, 1:2 v/v was added to the homogenate. Then the mixture was vortexed and centrifuged (2,000 × g for 20 min), and the upper phase was aspirated and filtered. The collected chloroform phase was used for analysis. Hepatic TG and TC concentrations were analyzed using an enzymatic analysis kit (BCS analysis kit; Asan Pharmaceutical Co. Ltd., Seoul, Korea).

The remaining half of the liver was removed and immediately fixed in a buffer solution of 10% formalin for pathological analysis. Fixed tissues were processed routinely for paraffin embedding and 5 μm sections were prepared and stained with haematoxylin and eosin. Stained areas were viewed using an optical microscope.

Quantitative polymerase chain reaction (qPCR) analysis for hepatic lipogenic gene expression

Total RNA from the liver was isolated and the samples were reverse-transcribed using the TOPscript™ cDNA synthesis kit (Enzynomics, Seoul, Korea). The resulting cDNA was amplified using a PCR system (Astec, Fukuoka, Japan) and the Premix Taq (Bioneer, Daejeon, Korea) according to the manufacturer’s instructions. The sequences of oligonucleotides used as primers were designed using Primer Express 3.0 (Applied Biosystems, Carlsbad, CA, USA). The sequences are listed in Table I. All primer sets produced amplicons of the expected size and their identity was also verified by sequencing. The cycling conditions were 95°C for 10 min, followed by 50 cycles of 95°C for 10 sec and 60°C for 1 min. The results were normalized against GAPDH and are presented as fold changes versus the reference gene.

Table I

Nucleotide sequences of primers for qPCR of mRNA.

Table I

Nucleotide sequences of primers for qPCR of mRNA.

Gene descriptionPrimer sequences (5′–3′)Annealing temperature (°C)PCR product (bp)
SREBP-1cF: GCCTGCTTGGCTCTTCTCTT
R: AGGTCAGCTTGTTTGCGATG
55102
ACC1F: TGATGCAGAGGTACC
R: CGTAGTGGCCGTCT
55100
LPLF: TGCCGCTGTTTTGTTTTACC
R: TCACAGTTTCTGCTCCCAGC
55172
LXRF: ACAGCCAGACGCTACAACCA
R: TGGCGATAAGCAAGGCATAC
55193
CD36F: TGACGTGGCAAAGAACAGC
R: GAAGGCTCAAAGATGGCTCC
55160
FASF: CTGGCATTCGTGATGGAGTC
R: TGTTTCCCCTGAGCCATGTA
55101
GAPDHF: GGAGCCAAAAGGGTCATCAT
R: GTGATGGCATGGACTGTGGT
60321

[i] SREBP-1c, sterol regulatory element binding protein-1c; LPL, lipoprotein lipase; LXR, liver X receptor; CD36, cluster of differentiation 36; FAS, fatty acid synthase; ACC1, acetyl-CoA carboxylase 1; qPCR, quantitative polymerase chain reaction.

Measurement of hepatic lipid-regulating enzyme activity

Hepatic enzymes were prepared according to the method of Hulcher and Oleson (24) with a slight modification. A homogenate was prepared in a buffer containing 0.1 mol/l of triethanolamine, 0.02 mol/l of EDTA and 2 mmol/l of dithiothreitol (pH 7.0). The homogenate was centrifuged (600 × g for 10 min) to remove any cell debris and the supernatant was again centrifuged (10,000 × g, followed by 12,000 × g for 20 min at 4°C) to remove the mitochondrial pellet. The supernatant was then ultracentrifuged twice (100,000 × g for 60 min at 4°C) to remove the cytosolic supernatant. The mitochondrial and microsomal pellets were then redissolved in 800 μl of homogenization buffer and the protein content determined using the Bradford method using bovine serum albumin as the standard. Fatty acid synthase (FAS) activity was measured in the cytosolic fraction according to the method by Nepokroeff et al (7) by monitoring the malonyl-coenzyme A-dependent oxidation of nicotinamide adenine dinucleotide phosphate (NADPH) at 340 nm, where the activity was represented by the oxidized NADPH nmol/min/mg protein. Carnitine palmitoyltrasferase-1 (CPT) activity was determined in the mitochondrial fraction according to the method by Markwell et al (25) and the results are expressed as nmol/min/mg protein. The activity of 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase was measured in microsomes based on a modification of the method of Hulcher and Oleson (24). The results are expressed as released CoA-SH nmol/min/mg protein.

Statistical analysis

All values from in vivo (n=6) and in vitro (n=3) experiments are expressed as the mean ± standard deviation. One-way analysis of variance and Duncan’s test were used for multiple comparisons (SPSS, version 10.0; SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Effects of RFex on body weight, total liver, adipose tissue weight and hepatic enzyme activities in HFD fed mice

The body weight increased with time in HFD groups, however, it decreased significantly in the HFD + RFex group (P<0.01; Fig. 1A). The adipose tissue ratio also decreased significantly in HFD + RFex fed mice (Fig. 1B). A significant decrease in epididymal (P<0.01), retroperitoneal and perirenal weight to body weight was identified in the RFex fed group.

Figure 1

(A) Changes in body weight and (B) relative fat mass in C57BL/6 mice treated with a ND, HFD and HFD + RFex. For relative fat mass, relative adipose tissue weight to body weight was calculated. Values are expressed as the mean ± standard deviation (n=6 for each group). +P<0.01 compared with the control (ND) .**P<0.01 compared with HFD treatment. ND, normal diet; HFD, high-fat diet; RFex, Rubi Fructus extract.

The total liver weight decreased significantly in RFex fed HFD mice compared with the HFD mice (P<0.01; Fig. 2A). The HFD fed group had elevated ALT and AST levels compared with the ND group (P<0.05; Fig. 2B), while RFex treatment significantly attenuated HFD-induced ALT and AST levels (P<0.01 and P<0.05, respectively). RFex reversed the increase in ALT and AST, suggesting that it has the potential to prevent liver injury.

Figure 2

(A) Changes in liver weight and (B) serum ALT and AST activity in C57BL/6 mice treated with an ND, HFD and HFD + RFex. Each value represents the mean ± standard deviation of six mice. +P<0.05 compared with the control (ND). *P<0.05, **P<0.01 compared with the HFD treatment. ALT, alanine aminotransferase; AST, aspartate aminotransferase; ND, normal diet; HFD, high-fat diet; RFex, Rubi Fructus extract.

Effects of RFex on lipid profiles, free fatty acid levels and fatty droplet accumulations in the livers of HFD fed mice

To analyze the possible role of RFex in lipid metabolism, which is the key factor relative to fatty liver formation, plasma lipid profiles in experimental mice were investigated and are presented in (Table II).

Table II

Plasma lipid profiles from mice exposed to different experimental diets.

Table II

Plasma lipid profiles from mice exposed to different experimental diets.

GroupTotal cholesterol (mg/dl)Triglycerides (mg/dl)HDL-cholesterol (mg/dl)LDL-cholesterol (mg/dl)
ND112.4±3.369.4±3.497.4±4.078.6±5.8
HFD 128.6±3.2a 110.8±19.4b101.0±2.1 96.6±7.1a
HFD + RFex 109.5±2.1c 82.8±5.6c97.7±3.074.3±4.5

[i] Values in a column of lipid profiles demonstrated (aP<0.05, bP<0.01 and cP<0.05) different compounds to ND and HFD, respectively. ND, normal diet; HFD, high-fat diet; RFex, Rubi Fructus extract; HDL, high-density lipoprotein; LDL, low-density lipoprotein.

The mice exposed to HFD exhibited increased TC (by 14%), TG (by 59%) and low-density lipoprotein-cholesterol (LDL-C; by 22.9%) levels and decreased high-density lipoprotein-cholesterol (HDL-C; by 11%) levels in the respective animal groups compared with the ND fed mice.

However, RFex feeding attenuated the serum lipid profile, which manifested in a reduced TC, TG and LDL-C concentration and a increased HDL-C levels as compared with the HFD group (P<0.05). As shown in Fig. 3A, the increase of liver TG and TC in the HFD group (P<0.01 and P<0.05) was significantly suppressed by RFex (P<0.05).

Figure 3

(A) Hepatic TG and TC levels and (B) representative photomicrograph of fatty acid in C57BL/6 mice with an ND, HFD or HFD + RFex. Values are expressed as the mean ± standard deviation (n=6 per group). +P<0.01, ++P<0.05 compared with the control (ND). **P<0.01 compared with the HFD treatment. Arrows indicate the microvesicular-type fat in the cytoplasm of the hepatocytes. TG, triglyceride; TC, total cholesterol ND, normal diet; HFD, high-fat diet; RFex, Rubi Fructus extract.

Representative photomicrographs of liver histology are shown in Fig. 3B. HFD fed control mice demonstrated a high accumulation of microvesicular-type fat in the cytoplasm of the hepatocytes and demonstrated focal hepatitis characterized by scattered inflammatory cells and/or inflammatory foci. Treatment with RFex significantly improved the microvesicular hepatic steatosis (Fig. 3B; HFD + RFex) and liver histology results were almost the same as those of the ND (Fig. 3B; ND). These data clearly suggest that RFex is able to prevent hepatosteatosis via downregulating the accumulation of lipids in liver cells.

Effects of RFex on plasma leptin levels in mice

Leptin levels in the plasma were examined to assess the role of RFex in the prevention of obesity when the mice were fed a HFD (Fig. 4). There was a significant elevation in the levels of plasma leptin in the HFD (by 44%) group compared with that of the ND group (P<0.05). In addition, the results implied that obesity in mice is accompanied with leptin resistance. However, the leptin concentration was significantly reduced in the RFex groups following 10 weeks of exposure to a HFD.

Figure 4

Plasma leptin levels in C57BL/6 mice treated with an ND, HFD and HFD + RFex. Each value represents the mean ± standard deviation of six mice. ++P<0.01 compared with the control (ND) and *P<0.05 compared with HFD treatment. ND, normal diet; HFD, high-fat diet; RFex, Rubi Fructus extract.

Effects of RFex on hepatic lipid regulatory gene expression in mice

To investigate the underlying mechanism responsible for the inhibitory effect of RFex on HFD-induced hepatic steatosis, hepatic expression levels of lipogenesis-regulating genes were determined, including liver X receptor (LXR), sterol regulatory element binding protein-1c (SREBP-1c), acetyl-CoA carboxylase 1 (ACC1), cluster of differentiation 36 (CD36), lipoprotein lipase (LPL) and FAS. GAPDH was used as a control (Fig. 5). Compared with the HFD group, mice treated with RFex demonstrated significantly reduced mRNA expression of the tested genes (P<0.05, P<0.01 compared with the HFD-fed mice; Fig. 5A). The relative levels of specific mRNA levels are shown (Fig. 5B).

Figure 5

. Hepatic expression of lipogenic genes in C57BL/6 mice. (A) Quantitative polymerase chain reaction was used to assess mRNA expression of lipogenic genes using primers as indicated in Table I. (B) Relative levels of specific mRNA levels are presented. Values are expressed as the mean ± standard deviation (n=6 each group). +P<0.01 and ++P<0.05 compared with the control (ND). *P<0.05 and **P<0.01 compared with HFD treatment. LXR, liver X receptor; SREBP-1c, sterol regulatory element binding protein-lc; ACC, acetyl Co-A carboxylase; CD36, cluster of differentiation 36; LPL, lipoprotein lipase; FAS, fatty acyl synthase; ND, normal diet; HFD, high-fat diet.

Effects of RFex on hepatic lipid-regulating enzyme activities in mice

As representative enzymes, mediating lipid biogenesis and lipid degradation, the activities of FAS, HMG-CoA reductase and CPT were assessed to investigate whether RFex is able to affect the enzyme activities of lipid metabolism in the liver (Fig. 6). Hepatic FAS and HMG-CoA reductase activity was significantly decreased (P<0.05 each), whereas CPT activity was increased in the RFex-fed group compared with the HFD-fed group (P<0.01).

Figure 6

Activity of hepatic lipid regulating enzymes FAS, CPT and HMG-CoAR in C57BL/6 mice treated with ND, HFD and HFD + RFex. Values are expressed as the mean ± standard deviation (n=6 per group). +P<0.01 compared with the control (ND). *P<0.05 and **P<0.01 compared with HFD treatment. FAS, fatty acid synthase; CPT, carnitine palmito-transferase; HMG-CoAR, 3-hydroxy-3 methylglutamyl-coenzyme reductase; ND, normal diet; HFD, high-fat diet; RFex, Rubi Fructus extract.

Discussion

Hepatic steatosis is emerging as the most important cause of chronic liver disease associated with the increasing incidence of obesity (9).

It is able to progress to nonalcoholic steatohepatitis in 10–20% of patients (26) and even to advanced cirrhosis and hepatocellular carcinoma (27). The present study demonstrated that the administration of RFex protected against the development and progression of hepatic steatosis induced by a HFD in C57BL/6 mice. Furthermore, the reduction in levels of hepatic lipids (TG and TC) and plasma lipids (TG, TC and LDL-C) and the elevation of plasma lipid (HDL-C) and leptin levels were observed in RFex-treated C57BL/6 mice. The inhibitory effect of RFex on hepatic steatosis appeared to be associated with the suppression of lipogenesis enzyme activity and the acceleration of fatty acid oxidation in HFD-fed mice. However, the other possible mechanisms underlying the effect of RFex on hepatic steatosis, including intestinal lipid absorption, pancreatic lipase activity and the modulation of fecal sterol excretion by RFex treatment requires to be further investigated. A significant reduction in body weight was observed in the HFD + RFex groups compared with the HFD-fed group (Fig. 1A), although the amount of food consumption was similar between the groups (data not shown). These results suggested that suppressed lipid production and increased energy expenditure were involved in preventing hepatic steatosis in RFex-fed mice.

To further investigate the reduced hepatic lipid production in RFex-fed mice, the mRNA expression levels of lipogenic and lipid-regulating enzymes, including SREBP-1c, FAS, LXR, ACC1, LPL and CD36, were examined using qPCR. LXR is a member of a nuclear receptor superfamily that regulates the expression of key proteins involved in lipid metabolism and inflammation, serving as a type of nuclear cholesterol sensor (28).

LXR also increases the expression of SREBP-1c, which leads to increased hepatic TG synthesis. The present study demonstrated that LXR expression was decreased in RFex-fed mice. SREBP-1c is a key transcription factor regulating the expression of enzymes involved in lipogenesis and fatty acid desaturation as well as in response to fat and insulin (29). Its expression was significantly higher in NAFLD, which was almost 5-fold greater than that in the controls. SREBP-1c is positively regulated by insulin signaling pathways, including insulin receptor substrates 1 and 2. It is known that SREBP-1c is negatively regulated by AMP-activated protein kinase (30). In NAFLD, insulin signaling via insulin receptor substrate 1 causes the upregulation of SREBP1-c, leading to an increased synthesis of fatty acids by the hepatocytes (30).

In the present study, a significant suppression of SREBP-1c and LXR mRNA by RFex was confirmed, which in turn may be expected to lead to the downregulation of lipogenic genes, including FAS and ACC. The present study also confirmed the downregulation of FAS and ACC, which are involved in fatty acid biosynthesis, in the RFex-fed group.

The expression levels of LPL and CD36 genes were also assessed. LPL hydrolyzes TG in lipoproteins (chylomicrons and very low density lipoproteins) and is also involved in promoting the cellular uptake of chylomicron remnants, including cholesterol-rich lipoproteins and very low-density lipoprotein. CD36, identified on numerous types of cell surfaces, acts as a fatty acid translocase. The present study demonstrated that LPL and CD36 mRNA expression levels were decreased in RFex-fed groups.

Three enzyme activities, HMG-CoA reductase, FAS and CPT, which are involved in hepatic lipogenesis and lipolytic reactions, were measured. HMG-CoA reductase, an enzyme important in cholesterol synthesis, catalyzes the reduction of HMG-CoA to CoA and mevalonate. The experimental results demonstrated a significant decrease in HMG-CoA reductase and FAS activities in RFex-fed mice. By contrast, the hepatic activity of CPT, an enzyme involved in fatty acid β-oxidation was increased in RFex-fed mice.

Bioassay-guided fractionation of the methanol extract of Geum japonicum Thunb using a FAS inhibition assay led to the isolation of ellagic acid with six other known compounds (31). Several studies also demonstrated that ellagic acid is involved in lipid metabolism (32). Yu et al (33) have reported that ellagic acid supplementation effectively reduced the elevation of plasma cholesterol in hyperlipidemic rabbits. The exact mechanism by which ellagic acid lowers other lipid levels is not known. However, it is likely that ellagic acid may have decreased the activity of HMG CoA reductase or enhanced the rate of lipid degradative processes and increased the hepatic bile acids and fecal neutral sterol, and thus decreased the levels of other lipids.

In conclusion, the present study demonstrated that RFex inhibits hepatic steatosis and has plasma lipid-lowering effects in HFD-fed C57BL/6 mice. These effects are mediated by the downregulation of hepatic genes involved in lipogenesis and the modulation of lipid metabolism-associated enzyme activities.

These results suggested that RFex is useful as a potential dietary food supplement for intervention in hepatic steatosis and hyperlipidemia.

Acknowledgements

This study was financially supported by the Ministry of Trade Industry and Energy (MOTIE) and the Korea institute for advancement of Technology (KIAT) through the Promoting Regional Specialized Industry Project.

References

1 

Marchesini G, Bugianesi E, Forlani G, Cerrelli F, Lenzi M, Manini R, Natale S, Vanni E, Villanova N, Melchionda N and Rizzetto M: Nonalcoholic fatty liver, steatohepatitis, and the metabolic syndrome. Hepatology. 37:917–923. 2003. View Article : Google Scholar : PubMed/NCBI

2 

Schreuder TC, Verwer BJ, van Nieuwkerk CM and Mulder CJ: Nonalcoholic fatty liver disease: an overview of current insights in pathogenesis, diagnosis and treatment. World J Gastroenterol. 14:2474–2486. 2008. View Article : Google Scholar : PubMed/NCBI

3 

Kotronen A and Yki-Järvinen H: Fatty liver: a novel component of the metabolic syndrome. Arterioscler Thromb Vasc Biol. 28:27–38. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Edmison J and McCullough AJ: Pathogenesis of non-alcoholic steatohepatitis: human data. Clin Liver Dis. 11:75–104. 2007. View Article : Google Scholar : PubMed/NCBI

5 

Marchesini G, Brizi M, Bianchi G, Tomassetti S, Bugianesi E, Lenzi M, McCullough AJ, Natale S, Forlani G and Melchionda N: Nonalcoholic fatty liver disease: a feature of the metabolic syndrome. Diabetes. 50:1844–1850. 2001. View Article : Google Scholar : PubMed/NCBI

6 

Varela-Rey M, Embade N, Ariz U, Lu SC, Mato JM and Martinez-Chantar ML: Non-alcoholic steatohepatitis and animal models: understanding the human disease. Int J Biochem Cell Biol. 41:969–976. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Nepokroeff CM, Lakshmanan MR and Porter JW: Fatty-acid synthase from rat liver. Methods Enzymol. 35:37–44. 1975. View Article : Google Scholar : PubMed/NCBI

8 

Targher G, Bertolini I, Rodella S, Zoppini G, Lippi G, Day C and Muggeo M: Non-alcoholic fatty liver disease is independently associated with an increased prevalence of chronic kidney disease and proliferative/laser-treated retinopathy in type 2 diabetic patients. Diabetologia. 51:444–450. 2008. View Article : Google Scholar

9 

Unger RH, Clark GO, Scherer PE and Orci L: Lipid homeostasis, lipotoxicity and the metabolic syndrome. Biochim Biophys Acta. 1801:209–214. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Lindor KD, Kowdley KV, Heathcote EJ, Harrison ME, Jorgensen R, Angulo P, Lymp JF, Burgart L and Colin P: Ursodeoxycholic acid for treatment of nonalcoholic steatosis steatohepatitis: results of a randomized trial. Hepatology. 39:770–778. 2004. View Article : Google Scholar : PubMed/NCBI

11 

Sgro C and Escousse A: Side effects of fibrates (except liver and muscle). Therapie. 46:351–354. 1991.(In French).

12 

Cha HW, Park MS and Park KM: Physiological activities of Rubus coreanus Miquel. Korean J Food Sci Tech. 33:409–415. 2001.

13 

Yang HM, Oh SM, Lim SS, Shin HK, Oh YS and Kim JK: Antiinflammatory activities of Rubus coreanus depend on the degree of fruit ripening. Phytother Res. 22:102–107. 2008.

14 

Oh MS, Yang WM, Chang MS, Park W, Kim do R, Lee HK, Kim WN and Park SK: Effect of Rubus coreanus on sperm parameters and cAMP responsive element modulator (CREM) expression in rat testes. J Ethnopharmacol. 114:463–467. 2007.

15 

Lee MW: Phenolic compounds from the leaves of Rubus coreanus. Yakhak Hoeji. 39:200–204. 1995.

16 

Perry LM: Medicinal plants of east and southeast Asia, attributed properties and uses. MIT press; Cambridge, MA: pp. 346–356. 1980

17 

Sohn DW, Kim HY, Kim SD, Lee EJ, Kim HS, Kim JK, Hwang SY, Cho YH and Kim SW: Elevation of intracavernous pressure and NO-cGMP activity by a new herbal formula in penile tissues of spontaneous hypertensive male rats. J Ethnopharmacol. 120:176–180. 2008. View Article : Google Scholar : PubMed/NCBI

18 

Lee YI, Choi SK, Yang JY, Cho JS and Kim TH: Hepatoprotective activities of Rubus coreanus depends on the degree of ripening. Natural Product Sciences. 15:156–161. 2009.

19 

Lee YI, Whang KE, Cho JS, Ahn BM, Lee SB, Dong MS and Kim TH: Rubus coreanus extract attenuates acetaminophen induced hepatotoxicity; involvement of cytochrome P450 3A4. Biomol Ther. 17:455–460. 2009. View Article : Google Scholar

20 

Hwang JM, Cho JS, Kim TH and Lee YI: Ellagic acid protects hepatocytes from damage by inhibiting mitochondrial production of reactive oxygen species. Biomed Pharmacother. 64:264–270. 2010. View Article : Google Scholar : PubMed/NCBI

21 

Kang EH, Kown TY, Oh GT, Park WF, Park SI, Park SK and Lee YI: The flavonoid ellagic acid from a medicinal herb inhibits host immune tolerance induced by the hepatitis B virus-e antigen. Antiviral Res. 72:100–106. 2006. View Article : Google Scholar : PubMed/NCBI

22 

Kaul A and Khanduja KL: Plant polyphenols inhibit benzoyl peroxide-induced superoxide anion radical production and diacylglyceride formation in murine peritoneal macrophages. Nutr Cancer. 35:207–211. 1999. View Article : Google Scholar

23 

Folch J, Lees M and Sloane Stanley GH: A simple method for the isolation and purification of total lipids from animal tissues. J Biol Chem. 226:497–509. 1957.

24 

Hulcher FH and Oleson WH: Simplified spectrophotometric assay for microsomal 3-hydroxy-3-methylglutaryl CoA reductase by measurement of coenzyme A. J Lipid Res. 14:625–631. 1973.

25 

Markwell MA, McGroarty EJ, Bieber LL and Tolbert NE: The subcellular distribution of carnitine acyltransferases in mammalian liver and kidney. J Biol Chem. 248:3426–3432. 1973.PubMed/NCBI

26 

Angulo P: Nonalcoholic fatty liver disease. N Eng J Med. 346:1221–1231. 2002. View Article : Google Scholar : PubMed/NCBI

27 

Dixon JB, Bhathal PS and O’Brien PE: Nonalcoholic fatty liver disease: predictors of nonalcoholic steatohepatitis and liver fibrosis in the severely obese. Gastroenterology. 121:91–100. 2001. View Article : Google Scholar : PubMed/NCBI

28 

Zelcer N and Tontonoz P: Liver X receptors as integrators of metabolic and inflammatory signaling. J Clin Invest. 116:607–614. 2006. View Article : Google Scholar : PubMed/NCBI

29 

Horton JD, Goldstein JL and Brown MS: SREBPs: Activators of the complete program of cholesterol and fatty acid synthesis in the liver. J Clin Invest. 109:1125–1131. 2002. View Article : Google Scholar : PubMed/NCBI

30 

Zhou G, Myers R, Li Y, Chen Y, Shen X, Fenyk-Melody J, Wu M, Ventre J, Doebber T, Fujii N, Musi N, Hirshman MF, Goodyear LJ and Moller DE: Role of AMP-activated protein kinase in mechanism of metformin action. J Clin Invest. 108:1167–1174. 2001. View Article : Google Scholar : PubMed/NCBI

31 

Liu H, Li J, Zhao W, Bao L, Song X, Xia Y, Wang X, Zhang C, Wang X, Yao X and Li M: Fatty acid synthase inhibitors from Geum japonicum Thunb. var chinense. Chem Biodivers. 6:402–410. 2009. View Article : Google Scholar

32 

Meyer AS, Heinonen M and Frankel EN: Antioxidant interactions of catechin, cyanidin, caffeic acid, quercetin and ellagic acid on human LDL oxidation. Food Chem. 61:71–75. 1998. View Article : Google Scholar

33 

Yu YM, Chang WC, Wu CH and Chiang SY: Reduction of oxidative stress and apoptosis in hyperlipidemic rabbits by ellagic acid. J Nutr Biochem. 16:675–681. 2005. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Nam MK, Choi HR, Cho JS, Cho SM, Ha KC, Kim T, Ryu H and Lee Y: Inhibitory effects of Rubi Fructus extracts on hepatic steatosis development in high-fat diet-induced obese mice. Mol Med Rep 10: 1821-1827, 2014.
APA
Nam, M.K., Choi, H.R., Cho, J.S., Cho, S.M., Ha, K.C., Kim, T. ... Lee, Y. (2014). Inhibitory effects of Rubi Fructus extracts on hepatic steatosis development in high-fat diet-induced obese mice. Molecular Medicine Reports, 10, 1821-1827. https://doi.org/10.3892/mmr.2014.2398
MLA
Nam, M. K., Choi, H. R., Cho, J. S., Cho, S. M., Ha, K. C., Kim, T., Ryu, H., Lee, Y."Inhibitory effects of Rubi Fructus extracts on hepatic steatosis development in high-fat diet-induced obese mice". Molecular Medicine Reports 10.4 (2014): 1821-1827.
Chicago
Nam, M. K., Choi, H. R., Cho, J. S., Cho, S. M., Ha, K. C., Kim, T., Ryu, H., Lee, Y."Inhibitory effects of Rubi Fructus extracts on hepatic steatosis development in high-fat diet-induced obese mice". Molecular Medicine Reports 10, no. 4 (2014): 1821-1827. https://doi.org/10.3892/mmr.2014.2398
Copy and paste a formatted citation
x
Spandidos Publications style
Nam MK, Choi HR, Cho JS, Cho SM, Ha KC, Kim T, Ryu H and Lee Y: Inhibitory effects of Rubi Fructus extracts on hepatic steatosis development in high-fat diet-induced obese mice. Mol Med Rep 10: 1821-1827, 2014.
APA
Nam, M.K., Choi, H.R., Cho, J.S., Cho, S.M., Ha, K.C., Kim, T. ... Lee, Y. (2014). Inhibitory effects of Rubi Fructus extracts on hepatic steatosis development in high-fat diet-induced obese mice. Molecular Medicine Reports, 10, 1821-1827. https://doi.org/10.3892/mmr.2014.2398
MLA
Nam, M. K., Choi, H. R., Cho, J. S., Cho, S. M., Ha, K. C., Kim, T., Ryu, H., Lee, Y."Inhibitory effects of Rubi Fructus extracts on hepatic steatosis development in high-fat diet-induced obese mice". Molecular Medicine Reports 10.4 (2014): 1821-1827.
Chicago
Nam, M. K., Choi, H. R., Cho, J. S., Cho, S. M., Ha, K. C., Kim, T., Ryu, H., Lee, Y."Inhibitory effects of Rubi Fructus extracts on hepatic steatosis development in high-fat diet-induced obese mice". Molecular Medicine Reports 10, no. 4 (2014): 1821-1827. https://doi.org/10.3892/mmr.2014.2398
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team