Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
March-2015 Volume 11 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2015 Volume 11 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Endoplasmic reticulum stress preconditioning antagonizes low-density lipoprotein-induced inflammation in human mesangial cells through upregulation of XBP1 and suppression of the IRE1α/IKK/NF‑κB pathway

  • Authors:
    • Yuan Yu
    • Ling Zhang
    • Qi Liu
    • Lin Tang
    • Hang Sun
    • Hui Guo
  • View Affiliations / Copyright

    Affiliations: Department of Nephrology, The Second Affiliated Hospital, Chongqing Medical University, Chongqing 400010, P.R. China, Institute for Viral Hepatitis, Key Laboratory of Molecular Biology for Infectious Diseases, The Second Affiliated Hospital, Chongqing Medical University, Chongqing 400010, P.R. China
  • Pages: 2048-2054
    |
    Published online on: November 17, 2014
       https://doi.org/10.3892/mmr.2014.2960
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Elevated plasma low‑density lipoprotein (LDL) is associated with systemic inflammation, and is an important factor in the pathogenesis of chronic kidney disease. The aim of the present study was to investigate the effects of endoplasmic reticulum (ER) stress preconditioning on LDL‑induced inflammatory responses, in human mesangial cells (HMCs). HMCs were exposed to LDL (200 nm), with or without pretreatment with tunicamycin, an ER stress inducer, and tested for changes to gene expression levels. Small interfering RNA technology was used to knockdown the expression of inositol‑requiring enzyme‑1α (IRE1α) and X‑box‑binding protein‑1 (XBP‑1), in order to determine their effects on LDL‑treated HMCs. LDL treatment resulted in a significant, and time‑dependent, increase in the relative mRNA expression levels of proinflammatory cytokines and CD40, which was coupled with enhanced phosphorylation of IRE1α, IκB kinase (IKK), and nuclear factor (NF)‑κB p65 and p65 nuclear translocation. The LDL‑induced inflammatory responses were significantly reduced in the IRE1α‑depleted HMCs. Furthermore, pretreatment with tunicamycin significantly attenuated the induction of proinflammatory cytokines and CD40, by LDL. Whereas, silencing XBP1 expression significantly restored the production of proinflammatory cytokines, in the LDL‑treated HMCs with ER stress preconditioning. The phosphorylation levels of IRE1α, IKK, and NF‑κB p65 were markedly increased in the XBP1‑depleted HMCs. Conversely, overexpression of XBP1 blocked LDL‑induced inflammation in the HMCs. The results of the present study demonstrate that ER stress preconditioning antagonizes LDL‑induced inflammatory responses in HMCs, which may be mediated through upregulation of XBP1, and subsequent inactivation of the IRE1α/IKK/NF‑κB pathway.

Introduction

Chronic kidney disease (CKD) is a growing health problem worldwide (1), which manifests as a progressive loss of renal function. Numerous factors, including oxidative stress, systemic inflammation, hypertension, and dyslipidemia, contribute to the onset and progression of CKD (2). Lipid abnormalities in patients with CKD usually consist of reduced high-density lipoprotein (HDL) concentrations and elevated plasma triglyceride, low-density lipoprotein (LDL), and oxidized lipids and lipoproteins (3). HDL facilitates cholesterol efflux from peripheral tissues and delivers cholesterol to the liver for excretion, therefore it has a key role in reverse cholesterol transport (4). HDL confers protection from cardiovascular disease due to its high anti-oxidant and anti-inflammatory activities. LDL has converse roles to HDL in the regulation of cholesterol transport. Oxidized LDL is capable of inducing inflammatory responses and is therefore implicated in the progression of numerous inflammatory disorders, such as atherosclerosis (5) and CKD (3).

The endoplasmic reticulum (ER) is a central organelle of eukaryotic cells and has principle functions in lipid synthesis and protein folding, maturation, and transport. Disturbances to the normal functions of the ER (e.g. due to redox dysregulation, aberrant calcium regulation, and glucose deprivation) may result in the accumulation of unfolded or misfolded proteins in the ER, a state known as ER stress (6). Three major ER stress response transducers have previously been identified: Activating transcription factor-6, inositol-requiring enzyme-1α (IRE1α), and protein kinase RNA-like endoplasmic reticulum kinase (7). IRE1α is activated by homodimerization and autophosphorylation under ER stress. It functions as an endoribonuclease which splices X-box-binding protein-1 (XBP-1) mRNA, yielding a potent transcriptional activator. Splicing of XBP-1 has previously been shown to initiate the transcription of genes involved in protein folding, transport and ER-associated protein degradation (7).

ER stress initially serves as an adaptive response but may lead to cell death, if severe or prolonged ER dysfunction occurs. Previous research has demonstrated the importance of ER stress in the pathophysiology of both acute and chronic kidney diseases (8). Chiang et al (9) reported that overwhelming ER stress may induce renal cell apoptosis and subsequent fibrosis. However, numerous studies have recently supported a protective role of the induction of ER stress in cell damage (10–12). Li et al (10) reported that ER stress preconditioning mitigated retinal endothelial inflammation, which was mediated through activation of the XBP-1-mediated unfolded protein response (UPR) and inhibition of NF-κB signaling. In a rat model, preconditioning with ER stress ameliorated mesangioproliferative glomerulonephritis (12). These previous findings suggest that transiently targeting ER stress may have therapeutic benefits in the treatment of inflammatory diseases.

Inflammation is an important mechanism leading to glomerular damage in CKD (13). Native and modified LDL have previously been shown to increase the production of numerous inflammatory mediators, including interleukin-6 (IL-6), CD40, and macrophage migration inhibitory factor, in human mesangial cells (HMCs) (14). The present study aimed to investigate whether ER stress preconditioning could attenuate LDL-induced inflammatory responses in HMCs, and to explore the associated molecular mechanisms.

Materials and methods

Chemical reagents and antibodies

LDL was purchased from ProSpec (East Brunswick, NJ, USA) and tunicamycin from Sigma-Aldrich (St. Louis, MO, USA). Mouse anti-human monoclonal antibodies anti-XBP1 and anti-β-actin were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA), anti-phospho-NF-κB p65 (Ser536), and anti-phospho-IκB kinase (IKK)α/β (Ser176/180) were obtained from Cell Signaling Technology, Inc. (Danvers, MA, USA), and anti-phospho-IRE1α and anti-IRE1α were purchased from Novus Biologicals (Littleton, CO., USA).

Cell culture and drug treatment

Primary HMCs were obtained from the Key Laboratory of Infectious Diseases of Chongqing Medical University (Chongqing, China). The cells were cultured in Dulbecco’s Modified Eagle’s Medium, supplemented with 10% fetal bovine serum, 100 μg/ml streptomycin, and 100 U/ml penicillin (Invitrogen Life Technologies, Carlsbad, CA, USA), at 37°C in an atmosphere containing 5% CO2. The experiments were performed with cells taken from passages 3–8.

The HMCs were treated with LDL (200 nm) for various durations (1–24 h), and then subjected to gene expression analysis. To assess the effects of ER stress preconditioning on the LDL-induced inflammatory responses, the cells were exposed for 8 h to a low dose (0.1 μg/ml) of tunicamycin, an ER stress inducer, followed by treatment with LDL.

Plasmids, small interfering RNA (siRNA) oligonucleotides, and transfection

The full-length human XBP1 cDNA was amplified and subcloned into an expression vector pEGFP-C1 (ClonTech, Palo Alto, CA, USA), which encoded a C-terminal green fluorescent protein tag. Specific siRNAs targeting human IRE1α and XBP1 were synthesized by Invitrogen Life Technologies, with the following sense sequences: IRE1α, 5′-GUCCCACUUUGUGUCCAAUTT-3′; and XBP1, 5′-CCAAGCUGGAAGCCAUUAATT-3′. A scrambled siRNA sequence, 5′-UUCUCCGAACGUGUCACGUTT-3′, was used as a negative control. The final concentration of each siRNA was 2 μM. The HMCs were seeded in 6-well plates, at a density of 5×104 cells/well, 24 h prior to transfection. The siRNA molecules were transfected into the cells using Lipofectamine® 2000 reagent, according to the manufacturer’s instructions (Invitrogen Life Technologies). The transfection efficiency was determined by western blot analysis of the corresponding protein levels, 24 h following siRNA transfection.

Quantitative polymerase chain reaction (qPCR)

Total cellular RNA was extracted using the RNeasy kit, according to the manufacturer’s instructions (Qiagen, Hilden, Germany). Reverse transcription was performed using the AMV First Strand cDNA Synthesis kit (Bio Basic Inc., Amhurst, NY, USA). The qPCR was conducted using an Applied Biosystems StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) and the SYBR® green PCR master mix (Applied Biosystems). GAPDH was amplified in a parallel reaction, and was used as an internal quantitative control. The cycle threshold (Ct) was calculated for each gene tested. The relative mRNA expression levels were normalized to those of GAPDH, using the 2−ΔΔCt method (15). Primers are listed in Table I.

Table I

Sequences of the primers for RT-qPCR analysis.

Table I

Sequences of the primers for RT-qPCR analysis.

GeneSequence (5′-3′)
IL-6Forward: TGCAATAACCACCCCTGACC
Reverse: ATTTGCCGAAGAGCCCTCAG
TNF-αForward: CTTCTCGAACCCCGAGTGAC
Reverse: TGAGGTACAGGCCCTCTGAT
CD40Forward: ACCCTTGGACAAGCTGTGAG
Reverse: GGCAAACAGGATCCCGAAGA
MCP-1Forward: AGCAGCAAGTGTCCCAAAGA
Reverse: TTTGCTTGTCCAGGTGGTCC
XBP1Forward: CAGTTGTCACCCCTCCAGAA
Reverse: GGCTGGTAAGGAACTGGGTC
IRE1αForward: AAAACTACGCCTCCCCTGTG
Reverse: GTCAGATAGCGCAGGGTCTC
GAPDHForward: CAATGACCCCTTCATTGACC
Reverse: GACAAGCTTCCCGTTCTCAG

[i] RT-qPCR, reverse transcription-quantitative polymerase chain reaction; IL-6, interleukin-6; TNF-α, tumor necrosis factor-α; MCP-1, monocyte chemoattractant protein-1; XBP1, X-box binding protein 1; IRE1α, inositol-requiring enzyme 1α.

Western blot analysis

Following LDL treatment, the cells were lysed in lysis buffer (50 mm Tris, pH 7.4, 150 mm NaCl, 1% NP-40, and 0.1% SDS), supplemented with protease inhibitors (2 μg/ml aprotinin, 2 μg/ml leupeptin, and 1 mm phenylmethylsulfonyl fluoride). The protein samples were separated by electrophoresis on polyacrylamide gels containing 0.1% SDS, and then transferred to nitrocellulose membranes (Pierce Biotechnology, Inc., Rockford, IL, USA). The membranes were incubated with the individual primary antibodies (goat anti-mouse NF-κB p65 antibody, sc-166748; Santa Cruz Biotechnology, Inc; dilution, 1:1,000) overnight at 4°C, followed by incubation for 1 h with the appropriate secondary antibodies (Alexa Fluor® 488-labeled goat anti-rabbit immunoglobulin G, #4412; Cell Signaling Technology, Inc.; dilution, 1:200), at room temperature. Immune complexes were visualized using enzyme-linked chemiluminescence (GE Heakthcare Life Sciences, Chalfont, UK). The band density was densitometrically analyzed using the Quantity One software (Bio-Rad Laboratories, Inc., Hercules, CA, USA), and normalized against the density of β-actin.

Immunocytochemistry staining

The cells were washed with phosphate-buffered saline (PBS; pH 7.4) and fixed in 4% formaldehyde in PBS for 15 min. The cells were blocked by preincubation with 10% normal goat serum in PBS for 1 h at room temperature, and were then incubated with anti-NF-κB p65 antibodies, at 4°C overnight. Following further washes with PBS, the cells were incubated with Alexa Fluor® 488-labeled goat anti-rabbit immunoglobulin G (1:200 dilution), at room temperature for 1 h. The cells were counterstained with 4,6-diamidino-2-phenylindole, in order to visualize the nuclei. The cells were visualized under a fluorescent microscope (LeicaTCS-SP5, Leica, Mannheim, Germany).

Statistical analysis

The data are expressed as the means ± standard deviation. The statistical differences among the numerous groups were calculated using a one-way analysis of variance, followed by the Tukey post hoc test. A P<0.05 was considered to indicate a statistically significant difference. All statistical tests were performed using SPSS version 13.0 software package for Windows (SPSS, Inc., Chicago, IL, USA)

Results

LDL treatment stimulates expression of CD40 and proinflammatory cytokines in HMCs

HMCs were exposed to LDL for various durations, and any changes to gene expression levels were determined by qPCR. LDL treatment caused a significant increase in the relative mRNA expression levels of IL-6, monocyte chemoattractant protein-1 (MCP-1), tumor necrosis factor-α (TNF-α), and CD40, as compared with the untreated control cells (P<0.05; Fig. 1). Furthermore, this induction was time-dependent, peaking at 24 h of culture.

Figure 1

Quantitative polymerase chain reaction analysis of proinflammatory gene expression in human mesangial cells treated with low-density lipoprotein (200 nm), for the indicated durations. The results are expressed as the fold change, relative to the control cells (0 h), assigned as 1-fold. *P<0.05 vs. the control cells. H, hours; IL, interleukin; TNF, tumor necrosis factor; MCP, monocyte chemoattractant protein.

Activation of the IRE1α/IKK/NF-κB pathway is involved in LDL-induced proinflammatory cytokine expression

Treatment with LDL induced a time-dependent increase in the phosphorylation of IRE1α, IKK, and NF-κB p65, as determined by western blot analysis (Fig. 2A). This result is indicative of activation of the IRE1α/IKK/NF-κB pathway. However, the total protein expression levels of IRE1α, IKK, and NF-κB p65 remained unchanged (data not shown). To further assess the activation of NF-κB signaling, immunocytochemistry was used to examine the nuclear translocation of NF-κB p65. Treatment with LDL markedly promoted NF-κB p65 nuclear translocation, in a time-dependent manner (Fig. 2B).

Figure 2

Treatment with low-density lipoprotein (LDL) activates the inositol-requiring enzyme (IRE)1α/IκB kinase (IKK)/nuclear factor (NF)-κB pathway in human mesangial cells. (A) Western blot analysis of the phosphorylation of IRE1α, IKK, and NF-κB p65 in HMCs, with or without LDL treatment. The Western blots for LDL 1, 6, 24 h are presented again in Figs. 3B, 4B and 7B, and are used as a comparison for the other experimental conditions. Representative blots of three independent experiments with similar results are shown. (B) Immunohistochemistry for NF-κB p65 subcellular expression in HMCs, with or without LDL treatment. Green staining indicates the localization of p65, and blue staining indicates the nucleus. Magnification, ×200; h, hours; p, phosphorylated.

To confirm the essential role of IRE1α in LDL-induced inflammatory responses, HMCs were transfected with IRE1α specific siRNA, or scrambled control siRNA, 24 h before treatment with LDL. The delivery of the IRE1α specific siRNA, but not control siRNA, markedly reduced the mRNA expression levels of endogenous IRE1α in HMCs, as compared with the non-transfected cells (data not shown). Depletion of IRE1α expression significantly blocked the induction of IL-6, MCP-1, TNF-α, and CD40 exerted by LDL, as determined by qPCR (P<0.05; Fig. 3A). Furthermore, knockdown of IRE1α expression markedly reduced the phosphorylation levels of IKK and NF-κB p65 (Fig. 3B).

Figure 3

Inositol-requiring enzyme (IRE)1α depletion blocks low-density lipoprotein (LDL)-induced inflammation in human mesangial cells (HMCs). The HMCs were transiently transfected with or without IRE1α specific small interfering (si)RNA, 24 h prior to the addition of LDL, and then subjected to gene expression analysis. (A) Quantitative polymerase chain reaction analysis of mRNA expression levels of the indicated proinflammatory genes. The results are expressed as a fold change relative to the untreated cells, assigned as 1-fold. *P<0.05 vs. the cells treated with LDL alone. (B) Western blot analysis of the phosphorylation of IκB kinase (IKK) and nuclear factor (NF)-κB p65. Representative blots of three independent experiments with similar results are shown. H, hours; IL, interleukin; TNF, tumor necrosis factor; MCP, monocyte chemoattractant protein.

ER stress preconditioning attenuates the LDL-induced inflammatory response

The effects of ER stress preconditioning were also determined on LDL-induced inflammatory responses in HMCs. Pretreatment with tunicamycin significantly attenuated the induction of IL-6, MCP-1, TNF-α, and CD40 by LDL (P<0.05; Fig. 4A). Furthermore, the phosphorylation levels of IRE1α, IKK, and NF-κB p65 were markedly reduced in the LDL-treated HMCs with tunicamycin pretreatment (Fig. 4B).

Figure 4

Endoplasmic reticulum (ER) stress preconditioning attenuates low-density lipoprotein (LDL)-induced inflammation in human mesangial cells (HMCs). The HMCs were exposed for 8 h to a low dose (0.1 μg/ml) of tunicamycin, prior to treatment with LDL. Following an incubation for 1–24 h, the cells were tested for gene expression level changes. (A) Quantitative polymerase chain reaction analysis of mRNA expression levels of the indicated proinflammatory genes. The results are expressed as fold change relative to untreated cells, assigned as 1-fold. *P<0.05 vs. the cells treated with LDL alone. (B) Western blot analysis of the phosphorylation of inositol-requiring enzyme (IRE)1α, IκB kinase (IKK), and nuclear factor (NF)-κB p65. Representative blots of three independent experiments with similar results are shown. H, hours; IL, interleukin; TNF, tumor necrosis factor; MCP, monocyte chemoattractant protein.

Tunicamycin pretreatment upregulates the expression levels of XBP1 in HMCs

Treatment with tunicamycin alone markedly increased the protein expression levels of XBP1 in the HMCs, as determined by western blot analysis (Fig. 5A). However, the mRNA expression levels of IL-6, MCP-1, TNF-α, and CD40 remained unchanged in the tunicamycin-treated cells (Fig. 5B).

Figure 5

Tunicamycin treatment alone upregulates the expression levels of X-box-binding protein-1 (XBP1) in human mesangial cells (HMCs). The HMCs were treated with tunicamycin (0.1 μg/ml) for 8 h, and a gene expression analysis was conducted. (A) Western blot analysis of XBP1 protein expression levels. A representative blot of three independent experiments with similar results is shown. (B) Quantitative polymerase chain reaction analysis of mRNA expression levels of the indicated proinflammatory genes. The results are expressed as fold change relative to untreated cells, assigned as 1-fold. *P<0.05 vs. the untreated cells. H, hours; IL, interleukin; TNF, tumor necrosis factor; MCP, monocyte chemoattractant protein.

Depletion of XBP1 reverses the anti-inflammatory effects of ER stress preconditioning on LDL-treated HMCs

The role of XBP1 on the anti-inflammatory effects of ER stress preconditioning in HMCs was then determined. Transfection with specific XBP1 siRNA resulted in a marked reduction in endogenous XBP1 protein expression levels in the HMCs, as compared with the cells transfected with control siRNA (data not shown). Notably, silencing XBP1 expression significantly restored the mRNA expression of IL-6, MCP-1, TNF-α, and CD40, in the LDL-treated HMCs with ER stress preconditioning (P<0.05; Fig. 6A). Furthermore, the phosphorylation levels of IRE1α, IKK, and NF-κB p65 were markedly increased in the XBP1-depleted HMCs with ER stress preconditioning (Fig. 6B).

Figure 6

Silencing of X-box-binding protein-1 (XBP1) expression reverses the anti-inflammatory effects of tunicamycin pretreatment on low-density lipoprotein (LDL)-treated human mesangial cells (HMCs). The HMCs were transiently transfected with or without XBP1 specific small interfering (si)RNA, 24 h prior to treatment with tunicamycin (TM) and LDL and then subjected to gene expression analysis. (A) Quantitative polymerase chain reaction analysis of the mRNA expression levels of the indicated proinflammatory genes. The results are expressed as a fold change relative to the untreated cells, assigned as 1-fold. *P<0.05 vs. cells treated with LDL alone. (B) Western blot analysis of the phosphorylation of. Representative blots of three independent experiments with similar results are shown. H, hours; IL, interleukin; TNF, tumor necrosis factor; MCP, monocyte chemoattractant protein; IRE1α, inositol-requiring enzyme; IKK, IκB kinase; p65, nuclear factor-κB p65.

Overexpression of XBP1 antagonizes LDL-induced inflammation

The present study also examined whether overexpression of XBP1 could block LDL-induced inflammatory responses in HMCs. The overexpression of XBP1 in the HMCs transfected with the XBP1-expressing plasmid was confirmed by western blot analysis (data not shown). Overexpression of XBP1 significantly reduced the mRNA expression levels of IL-6, MCP-1, TNF-α, and CD40 in LDL-treated HMCs, as determined by qPCR (Fig. 7A). Furthermore, the phosphorylation levels of IRE1α, IKK, and NF-κB p65 in LDL-treated cells were diminished in response to overexpression of XBP1 (Fig. 7B).

Figure 7

Overexpression of X-box-binding protein-1 (XBP1) diminishes low-density lipoprotein (LDL)-induced inflammation in human mesangial cells (HMCs). The HMCs were transiently transfected with or without XBP1-expressing plasmid, 24 h prior to treatment with LDL, and then subjected to gene expression analysis. (A) Quantitative polymerase chain reaction analysis of mRNA expression levels of the indicated proinflammatory genes. The results are expressed as a fold change relative to the untreated cells, assigned as 1-fold. *P<0.05 vs. the cells treated with LDL alone. (B) Western blot analysis of the phosphorylation of inositol-requiring enzyme (IRE)1α, IκB kinase (IKK), and nuclear factor (NF)-κB p65. Representative blots of three independent experiments with similar results are shown. H, hours; IL, interleukin; TNF, tumor necrosis factor; MCP, monocyte chemoattractant protein.

Discussion

Native and modified LDL has previously been shown to possess potent proinflammatory activities in various biological contexts. Meng et al (16) reported that oxidized LDL triggers inflammatory responses in cultured human mast cells by activating the Toll-like receptor 4-dependent signaling pathway. Oxidized LDL has also been shown to stimulate proinflammatory responses in alternatively activated M2 macrophages (17). The present study showed that LDL treatment promoted inflammatory responses in HMCs, as evidenced by the increased expression levels of proinflammatory cytokines IL-6, MCP-1, and TNF-α. These results are concordant with previous studies (14,18). Systemic inflammation is regarded as a key factor in the pathogenesis of CKD (13). The proinflammatory activity of LDL in HMCs may partially explain the association between dyslipidemia and the progression of CKD (2).

CD40 is expressed in a wide range of cells, including macrophages, lymphocytes, endothelial cells, vascular smooth muscle cells, and mesangial cells (19,20). CD40/CD40 ligand interactions between infiltrating mononuclear cells and resident renal cells, are associated with the pathogenesis of immune-mediated glomerulonephritis (21). Increasing evidence has indicated that activation of the CD40/CD40 ligand pathway is associated with the initiation of inflammatory responses (19). Tanaka et al (22) reported that human platelets stimulate mesangial cells to produce MCP-1, via the CD40/CD40 ligand pathway. The results of the present study demonstrated that upregulation of CD40 expression occurs in LDL-induced inflammatory responses in HMCs. In addition to initiation of inflammatory responses, activation of CD40-dependent signaling has been found to protect HMCs from oxidized LDL-induced apoptosis (23). These findings suggest that LDL-mediated toxic effects on HMCs are associated with the regulation of CD40 signaling.

There is known to be a close association between ER stress and the inflammatory response (24). Li et al (25) showed that induction of ER stress contributes to retinal inflammation in diabetic retinopathy (24). The results of the present study showed that, in parallel with induction of proinflammatory cytokines, LDL treatment resulted in a time-dependent increase in the phosphorylation of IRE1α, IKK, and NF-κB p65. IRE1α is a major sensor of unfolded proteins in the ER, and is activated by autophosphorylation (7). In response to ER stress, activated IRE1α may bind to the IKK complex and activate NF-κB (10,26). In the present study siRNA technology was used to induce a specific depletion of IRE1α expression. The loss of IRE1α expression antagonized the induction of IL-6, MCP-1, TNF-α, and CD40 exerted by LDL, coupled with the suppression of NF-κB activation. These findings indicate that ER stress has a mediating role in LDL-induced inflammatory responses in HMCs, which involves the activation of the IRE1α/IKK/NF-κB pathway. Consistently, phospholipolyzed LDL has been found to induce an inflammatory response in endothelial cells, by activating ER stress signaling pathways (27).

Accumulating evidence indicates that ER stress preconditioning confers protection against cellular injury in various biological settings (12,28). Hung et al (28) reported that ER stress preconditioning attenuated hydrogen peroxide-induced oxidative injury in LLC-PK1 renal epithelial cells. Li et al (10) previously demonstrated that preconditioning with ER stress mitigated retinal endothelial inflammation. The present study showed that LDL-induced inflammatory cytokine production was significantly diminished in ER stress-primed HMCs, suggesting a protective role for ER stress preconditioning. Notably, the results of the present study revealed that pretreatment with the ER stress inducer tunicamycin, caused an upregulation of XBP1, but not of the proinflammatory cytokines. In addition, siRNA-mediated inhibition of XBP1 attenuated the protective effects of tunicamycin pretreatment on LDL-induced inflammation, which was coupled with an enhanced activation of the IRE1α/IKK/NF-κB pathway. Numerous studies have shown that XBP1 ablation triggers feedback activation of its upstream enzyme IRE1α (29,30). Furthermore, the present study revealed that XBP1 overexpression inhibited LDL-induced activation of the IRE1α/IKK/NF-κB pathway. These results collectively indicate that ER stress preconditioning ameliorates LDL-induced inflammation in HMCs, which is largely mediated through activation of XBP1 signaling and blockade of the IRE1α/IKK/NF-κB pathway.

In conclusion, activation of the IRE1α/IKK/NF-κB pathway is required for LDL-induced inflammation in HMCs. ER stress preconditioning resulted in the upregulation of XBP1 expression and subsequent inhibition of the IRE1α/IKK/NF-κB pathway, which consequently interfered with the LDL-induced inflammatory responses. These findings warrant further investigation of the therapeutic potential of ER stress preconditioning in inflammatory disorders, such as CKD.

References

1 

Wakasugi M, Kazama JJ and Narita I: Differences in the local and national prevalences of chronic kidney disease based on annual health check program data. Clin Exp Nephrol. 16:749–754. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Nitta K: Clinical assessment and management of dyslipidemia in patients with chronic kidney disease. Clin Exp Nephrol. 16:522–529. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Vaziri ND and Norris K: Lipid disorders and their relevance to outcomes in chronic kidney disease. Blood Purif. 31:189–196. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Podrez EA: Anti-oxidant properties of high-density lipoprotein and atherosclerosis. Clin Exp Pharmacol Physiol. 37:719–725. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Pirillo A, Norata GD and Catapano AL: LOX-1, OxLDL, and atherosclerosis. Mediators Inflamm. 2013:1527862013. View Article : Google Scholar : PubMed/NCBI

6 

Xu C, Bailly-Maitre B and Reed JC: Endoplasmic reticulum stress: cell life and death decisions. J Clin Invest. 115:2656–2664. 2005. View Article : Google Scholar : PubMed/NCBI

7 

Inagi R: Endoplasmic reticulum stress as a progression factor for kidney injury. Curr Opin Pharmacol. 10:156–165. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Dickhout JG and Krepinsky JC: Endoplasmic reticulum stress and renal disease. Antioxid Redox Signal. 11:2341–2352. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Chiang CK, Hsu SP, Wu CT, et al: Endoplasmic reticulum stress implicated in the development of renal fibrosis. Mol Med. 17:1295–1305. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Li J, Wang JJ and Zhang SX: Preconditioning with endoplasmic reticulum stress mitigates retinal endothelial inflammation via activation of X-box binding protein 1. J Biol Chem. 286:4912–4921. 2011. View Article : Google Scholar :

11 

Aminzadeh MA, Sato T and Vaziri ND: Participation of endoplasmic reticulum stress in the pathogenesis of spontaneous glomerulosclerosis - role of intra-renal angiotensin system. Transl Res. 160:309–318. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Inagi R, Kumagai T, Nishi H, et al: Preconditioning with endoplasmic reticulum stress ameliorates mesangioproliferative glomerulonephritis. J Am Soc Nephrol. 19:915–922. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Cottone S, Lorito MC, Riccobene R, et al: Oxidative stress, inflammation and cardiovascular disease in chronic renal failure. J Nephrol. 21:175–179. 2008.PubMed/NCBI

14 

Santini E, Lupi R, Baldi S, et al: Effects of different LDL particles on inflammatory molecules in human mesangial cells. Diabetologia. 51:2117–2125. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Livak MJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

16 

Meng Z, Yan C, Deng Q, et al: Oxidized low-density lipoprotein induces inflammatory responses in cultured human mast cells via Toll-like receptor 4. Cell Physiol Biochem. 31:842–853. 2013. View Article : Google Scholar : PubMed/NCBI

17 

van Tits LJ, Stienstra R, van Lent PL, et al: Oxidized LDL enhances pro-inflammatory responses of alternatively activated M2 macrophages: a crucial role for Krüppel-like factor 2. Atherosclerosis. 214:345–349. 2011. View Article : Google Scholar

18 

Massy ZA, Kim Y, Guijarro C, et al: Low-density lipoprotein-induced expression of interleukin-6, a marker of human mesangial cell inflammation: effects of oxidation and modulation by lovastatin. Biochem Biophys Res Commun. 267:536–540. 2000. View Article : Google Scholar : PubMed/NCBI

19 

Antoniades C, Bakogiannis C, Tousoulis D, Antonopoulos AS and Stefanadis C: The CD40/CD40 ligand system: linking inflammation with atherothrombosis. J Am Coll Cardiol. 54:669–677. 2009. View Article : Google Scholar : PubMed/NCBI

20 

Yellin MJ, D’Agati V, Parkinson G, et al: Immunohistologic analysis of renal CD40 and CD40L expression in lupus nephritis and other glomerulonephritides. Arthritis Rheum. 40:124–134. 1997. View Article : Google Scholar : PubMed/NCBI

21 

Kuroiwa T, Schlimgen R, Illei GG, McInnes IB and Boumpas DT: Distinct T cell/renal tubular epithelial cell interactions define differential chemokine production: implications for tubulointerstitial injury in chronic glomerulonephritides. J Immunol. 164:3323–3329. 2000. View Article : Google Scholar : PubMed/NCBI

22 

Tanaka T, Kuroiwa T, Ikeuchi H, et al: Human platelets stimulate mesangial cells to produce monocyte chemoattractant protein-1 via the CD40/CD40 ligand pathway and may amplify glomerular injury. J Am Soc Nephrol. 13:2488–2496. 2002. View Article : Google Scholar : PubMed/NCBI

23 

Deambrosis I, Scalabrino E, Deregibus MC, Camussi G and Bussolati B: CD40-dependent activation of phosphatidylinositol 3-kinase/AKT pathway inhibits apoptosis of human cultured mesangial cells induced by oxidized LDL. Int J Immunopathol Pharmacol. 18:327–337. 2005.PubMed/NCBI

24 

Su J, Zhou L, Kong X, et al: Endoplasmic reticulum is at the crossroads of autophagy, inflammation, and apoptosis signaling pathways and participates in the pathogenesis of diabetes mellitus. J Diabetes Res. 2013:1934612013. View Article : Google Scholar : PubMed/NCBI

25 

Li J, Wang JJ, Yu Q, Wang M and Zhang SX: Endoplasmic reticulum stress is implicated in retinal inflammation and diabetic retinopathy. FEBS Lett. 583:1521–1527. 2009. View Article : Google Scholar : PubMed/NCBI

26 

Hayakawa K, Hiramatsu N, Okamura M, et al: Acquisition of anergy to proinflammatory cytokines in nonimmune cells through endoplasmic reticulum stress response: a mechanism for subsidence of inflammation. J Immunol. 182:1182–1191. 2009. View Article : Google Scholar : PubMed/NCBI

27 

Gora S, Maouche S, Atout R, et al: Phospholipolyzed LDL induces an inflammatory response in endothelial cells through endoplasmic reticulum stress signaling. FASEB J. 24:3284–3297. 2010. View Article : Google Scholar : PubMed/NCBI

28 

Hung CC, Ichimura T, Stevens JL and Bonventre JV: Protection of renal epithelial cells against oxidative injury by endoplasmic reticulum stress preconditioning is mediated by ERK1/2 activation. J Biol Chem. 278:29317–29326. 2003. View Article : Google Scholar : PubMed/NCBI

29 

So JS, Hur KY, Tarrio M, et al: Silencing of lipid metabolism genes through IRE1α-mediated mRNA decay lowers plasma lipids in mice. Cell Metab. 16:487–499. 2012. View Article : Google Scholar : PubMed/NCBI

30 

Lee AH, Heidtman K, Hotamisligil GS and Glimcher LH: Dual and opposing roles of the unfolded protein response regulated by IRE1alpha and XBP1 in proinsulin processing and insulin secretion. Proc Natl Acad Sci USA. 108:8885–8890. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yu Y, Zhang L, Liu Q, Tang L, Sun H and Guo H: Endoplasmic reticulum stress preconditioning antagonizes low-density lipoprotein-induced inflammation in human mesangial cells through upregulation of XBP1 and suppression of the IRE1α/IKK/NF‑κB pathway. Mol Med Rep 11: 2048-2054, 2015.
APA
Yu, Y., Zhang, L., Liu, Q., Tang, L., Sun, H., & Guo, H. (2015). Endoplasmic reticulum stress preconditioning antagonizes low-density lipoprotein-induced inflammation in human mesangial cells through upregulation of XBP1 and suppression of the IRE1α/IKK/NF‑κB pathway. Molecular Medicine Reports, 11, 2048-2054. https://doi.org/10.3892/mmr.2014.2960
MLA
Yu, Y., Zhang, L., Liu, Q., Tang, L., Sun, H., Guo, H."Endoplasmic reticulum stress preconditioning antagonizes low-density lipoprotein-induced inflammation in human mesangial cells through upregulation of XBP1 and suppression of the IRE1α/IKK/NF‑κB pathway". Molecular Medicine Reports 11.3 (2015): 2048-2054.
Chicago
Yu, Y., Zhang, L., Liu, Q., Tang, L., Sun, H., Guo, H."Endoplasmic reticulum stress preconditioning antagonizes low-density lipoprotein-induced inflammation in human mesangial cells through upregulation of XBP1 and suppression of the IRE1α/IKK/NF‑κB pathway". Molecular Medicine Reports 11, no. 3 (2015): 2048-2054. https://doi.org/10.3892/mmr.2014.2960
Copy and paste a formatted citation
x
Spandidos Publications style
Yu Y, Zhang L, Liu Q, Tang L, Sun H and Guo H: Endoplasmic reticulum stress preconditioning antagonizes low-density lipoprotein-induced inflammation in human mesangial cells through upregulation of XBP1 and suppression of the IRE1α/IKK/NF‑κB pathway. Mol Med Rep 11: 2048-2054, 2015.
APA
Yu, Y., Zhang, L., Liu, Q., Tang, L., Sun, H., & Guo, H. (2015). Endoplasmic reticulum stress preconditioning antagonizes low-density lipoprotein-induced inflammation in human mesangial cells through upregulation of XBP1 and suppression of the IRE1α/IKK/NF‑κB pathway. Molecular Medicine Reports, 11, 2048-2054. https://doi.org/10.3892/mmr.2014.2960
MLA
Yu, Y., Zhang, L., Liu, Q., Tang, L., Sun, H., Guo, H."Endoplasmic reticulum stress preconditioning antagonizes low-density lipoprotein-induced inflammation in human mesangial cells through upregulation of XBP1 and suppression of the IRE1α/IKK/NF‑κB pathway". Molecular Medicine Reports 11.3 (2015): 2048-2054.
Chicago
Yu, Y., Zhang, L., Liu, Q., Tang, L., Sun, H., Guo, H."Endoplasmic reticulum stress preconditioning antagonizes low-density lipoprotein-induced inflammation in human mesangial cells through upregulation of XBP1 and suppression of the IRE1α/IKK/NF‑κB pathway". Molecular Medicine Reports 11, no. 3 (2015): 2048-2054. https://doi.org/10.3892/mmr.2014.2960
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team