Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
June-2015 Volume 11 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2015 Volume 11 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Inhibition of microRNA-25 by tumor necrosis factor α is critical in the modulation of vascular smooth muscle cell proliferation

  • Authors:
    • Lichun Qi
    • Jixin Zhi
    • Tong Zhang
    • Xue Cao
    • Lixiu Sun
    • Yuanyuan Xu
    • Xueqi Li
  • View Affiliations / Copyright

    Affiliations: Cardiovascular Department, The Fourth Affiliated Hospital, Harbin Medical University, Harbin, Heilongjiang 150001, P.R. China
  • Pages: 4353-4358
    |
    Published online on: February 11, 2015
       https://doi.org/10.3892/mmr.2015.3329
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Atherosclerosis and coronary heart disease are characterized by a hyperplastic neointima and inflammation involving cytokines, such as tumor necrosis factor‑α (TNF‑α). TNF‑α is pleiotropic and mediates inflammation and proliferation in various cell types, such as vascular smooth muscle cells (VSMCs). The molecular mechanism for the pleiotropic effects of TNF‑α has not previously been fully elucidated. The current study identified that the expression of microRNA‑25 (miR‑25), a small noncoding RNA, was reduced in response to TNF‑α signaling in VSMCs. Restored miR‑25 expression inhibited cell proliferation and Ki‑67 expression. The present study indicated that cyclin‑dependent kinase 6 (CDK6) was the direct target gene of miR‑25 using mRNA and protein expression analysis, and luciferase assays. It was also observed that restored CDK6 expression in the miR‑25 mimic‑treated VSMCs partly reduced miR‑25‑mediated VSMC proliferation. In conclusion, miR‑25 is suggested to be important in TNF‑α‑induced abnormal proliferation of VSMCs.

Introduction

The vasculature is predominantly comprised of vascular smooth muscle cells (VSMCs), and these cells are involved in the maintenance of vessel tone and blood pressure (1,2). Abnormal proliferation of VSMCs is key in the pathogenesis of cardiovascular diseases, such as coronary heart disease, hypertension and atherosclerosis (3,4). Several growth factors and cytokines have been reported to be capable of stimulating the migration and proliferation of VSMCs, for example leptin, which is vital in restenosis (5–7). A previous study indicated that tumor necrosis factor-α (TNF-α) is a major risk factor in atherosclerosis and coronary heart disease (8). TNF-α is a pleiotropic inflammatory cytokine that has been reported to serve a pathophysiological role in vascular atherosclerosis (9,10). In addition, TNF-α has been demonstrated to regulate the proliferation, apoptosis, migration and differentiation of VSMCs, which are critical in the pathogenesis of cardiovascular disease (8,11,12). However, the precise mechanism underlying TNF-α-induced proliferation of VSMCs remains to be fully elucidated.

MicroRNAs (miRNAs) are a class of small (22-nucleotide) noncoding RNA molecules that function as endogenous silencers of various target genes (13–15). The majority of mature miRNAs suppress gene expression either by facilitating the cleavage of their target messenger RNAs (mRNAs) or by inhibiting mRNA translation upon imperfect base pairing to the 3′-untranslated region (3′-UTR) of the mRNA (16,17). It has been reported that miRNAs are highly conserved among species and are crucial in various physiological and pathological processes, including age-associated diseases, developmental abnormalities, autoimmune diseases and various types of cancer (18–21). The role of miRNAs in the cardiovascular system has been previously investigated (22,23); however, the function of miRNAs in the proliferation of VSMCs induced by TNF-α remains to be fully investigated.

In the current study, it was hypothesized that the expression of miR-25 was inhibited in TNF-α-stimulated VSMCs and that overexpression of miR-25 in the VSMCs inhibited cell proliferation by targeting cyclin-dependent kinase 6 (CDK6). Thus, the current study aimed to elucidate whether miR-25 was impaired in the pathogenesis of atherosclerosis and coronary heart disease, and may be a potential therapeutic target in atherosclerosis and coronary heart disease.

Materials and methods

Ethical statement

All experiments were approved by the Clinical Research Ethics Committee of The Fourth Affiliated Hospital, Harbin Medical University (Harbin, China).

Vectors and cell culture

The pcDNA-CDK6 vector was purchased from Sigma-Aldrich (Oakville, ON, Canada). The CDK6 3′UTR sequence with the binding site for miR-25 was cloned into the pMIR-REPORT luciferase construct (Ambion Life Technologies, Carlsbad, CA, USA). The mutant construct of CDK6 3′UTR was generated using the QuikChange Site-Directed Mutagenesis kit (Agilent Technologies, Inc., Santa Clara, CA, USA). The reagents for cell culture (fetal bovine serum, penicillin and streptomycin) were purchased from Gibco Life Technologies (Carlsbad, CA, USA). Human VSMCs were obtained from the American Type Culture Collection (Manassas, VA, USA) and cultured in the medium 231 supplemented with smooth muscle cell growth supplement (Gibco Life Technologies) at 37°C in a humidified atmosphere of 95% air and 5% CO2.

Cell transfection

The miR-25 mimics and the control were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China) and transfected into the cells to a final oligonucleotide concentration of 20 nmol/l. All cell transfections were introduced using DharmaFECT 1 reagent (GE Healthcare Biosciences, Pittsburgh, PA, USA) according to the manufacturer’s instructions.

RNA isolation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) and the miRNA was reverse transcribed into cDNA (miRNA reverse kit, Promega Corp., Madison, WI, USA). The reaction mixture contained 1 μg purified total RNA, 5X M-MLV buffer (Invitrogen Life Technologies), 200 U/μl (M-MLV; Invitrogen Life Technologies), 1.0 μl dithiothreitol (Invitrogen Life Technologies), 1.0 μl of 10 μmol/l stem-loop RT primer (Invitrogen Life Technologies), 0.5 μl of 40 U/μl RNase inhibitor (Invitrogen Life Technologies) and 1.0 μl of 10 mmol/l deoxyribonucleotide triphosphate (Invitrogen Life Technologies). Relative transcript levels of mRNA were determined by RT-qPCR using the ABI 7300 Real-time PCR system (Applied Biosystems Life Technologies, Foster City, CA, USA). The RT-qPCR reaction was composed of 1X SYBR green fluorescent dye (Takara Biotechnology Co., Ltd., Dalian, China), 1 μl of 10 μM forward primers, 1 μl of 10 μM reverse primers, 1X qPCR mix (Invitrogen Life Technologies) and 1 μl cDNA. Reactions were run with the following thermal cycling parameters: 95°C for 5 min followed by 35 cycles of 95°C for 5 sec and 60°C for 30 sec; melting curve program (60–95°C) with a heating rate of 0.1°C/sec. The relative gene expression was assessed by the ΔΔCt method. GAPDH or U6 was used as an internal control (Table I).

Table I

Primer sequences.

Table I

Primer sequences.

PrimerSequence (5′-3′)
MicroRNA reverse transcription primer
 MicroRNA-25 GTCGTATCCAGTGCGTGTCGTGGAGTCG
GCAATTGCACTGGATACGACTCAGAC
 U6 snRNA AAAATATGGAACGCTTCACGAATTTG
Real-time polymerase chain reaction primer sequence
 MicroRNA-25F: CATTGCACTTGTCTCGGTCTG
R: ATTGCGTGTCGTGGAGTCG
 U6 snRNAF: CTCGCTTCGGCAGCACATATACT
R: ACGCTTCACGAATTTGCGTGTC
 GAPDHF: AATGGGCAGCCGTTAGGAAA
R: TGAAGGGGTCATTGATGGCA
 Ki-67F: TCCTTTGGTGGGCACCTAAGACCTG
R: TGATGGTTGAGGTCGTTCCTTGATG
 CDK6F: GGACTTTCTTCATTCACACCG
R: GACCACTGAGGTTAGGCCA

[i] F, forward; R, reverse; snRNA, small nuclear RNA.

Cell proliferation assays

Cells were seeded in 96-well plates at a density of 1,000 cells/well with 100 μl complete culture medium. The cells were then cultured for an additional 24, 48 or 72 h. The supernatant was removed and 100 μl medium 231 containing 10 μl Cell Counting kit 8 (CCK-8; Dojindo Molecular Technologies, Inc., Kumamoto, Japan) was added to each well for a 2-h incubation at 37°C. The culture plates were then agitated for 10 min and the optical density values were read at a wavelength of 450 nm using a Thermo Fisher Scientific microplate reader (Beijing, China).

Dual luciferase assays

Cells were co-transfected with 0.4 μg miR-25 or negative controls and the reporter construct 0.2 μg pGL-3 control vector (Promega Corp.). Cells were plated at a density of 5×105 cells/well in 24-well plates 24 h prior to transfection. The cells were harvested 24 h post-transfection and assayed using the Dual-Luciferase Reporter Assay system (Promega Corp.) according to manufacturer’s instructions. Firefly luciferase values were normalized to Renilla and the ratio of Firefly/Renilla luciferase values was reported.

Western blotting

Total cellular protein extraction and western blotting procedures were conducted using standard methods (14). CDK-6 and GAPDH proteins were incubated with rat polyclonal anti-human CDK-6 (1:1,000; Abcam, Cambridge, UK) and mouse polyclonal anti-human GAPDH (1:5,000: ProteinTech Group, Inc., Chicago, IL, USA) primary antibodies, respectively. The membranes were subsequently incubated with horseradish peroxidase-labeled rabbit anti-mouse and goat anti-rabbit antibodies (ZSGB-BIO, Beijing, China). the signal was detected using an enhanced chemiluminescence kit (EMD Millipore, Billerica, MA, USA).

Statistical analysis

Each experiment was repeated a minimum of three times. Statistical analysis was performed using SPSS, version 15.0 (SPSS, Inc., Chicago, IL, USA). Data are presented as the mean ± standard deviation. Either the analysis of variance or Student’s t-test was completed in order to analyze the data and P<0.05 (two-tailed) was considered to indicate a statistically significant difference.

Results

Expression of miR-25 is reduced in VSMCs induced by TNF-α

A significant time-dependent induction of cell proliferation by TNF-α (100 ng/ml) was observed with the maximal response at 72 h (P<0.001) using the CCK-8 proliferation assay (Fig. 1A). Inhibition of miR-25 expression was observed in VSMCs following TNF-α stimulation with RT-qPCR analysis (Fig. 1B).

Figure 1

Expression of miR-25 is reduced in VSMCs induced by TNF-α. (A) The Cell Counting kit-8 proliferation assay demonstrated that TNF-α (100 ng/ml) can promote VSMC proliferation. (B) Reverse transcription-quantitative polymerase chain reaction analysis demonstrated that TNF-α can inhibit the expression of miR-25. **P<0.01 and ***P<0.001 vs. control. miR-25, microRNA-25; VSMCs, vascular smooth muscle cells; TNF-α, tumor necrosis factor-α; OD, optical density.

Overexpression of miR-25 inhibits VSMC proliferation

VSMCs were transfected with miR-25 mimics or control oligo, which were demonstrated to have high transfection efficiency (Fig. 2A; P<0.001). The CCK-8 proliferation assay indicated that cell proliferation was significantly decreased in miR-25 mimic-transfected VSMCs compared with the control oligo-transfected cells or untreated cells (Fig. 2B). This proliferative effect of miR-25 was further confirmed by Ki-67 expression. As demonstrated in Fig. 2C, a significant decrease in the protein expression of Ki-67 was observed in the group transfected with miR-25 mimics as compared with the control group or untreated group.

Figure 2

Overexpression of miR-25 inhibits VSMC proliferation. (A) The expression levels of miR-25 were examined following transfection of miR-25 mimics or control or no transfection using reverse transcription-quantitative polymerase chain reaction. (B) The Cell Counting kit-8 proliferation assay demonstrated that the miR-25 mimic was able to inhibit the proliferation of VSMCs. (C) Western blot analysis demonstrated that overexpression of miR-25 inhibited the protein expression of Ki-67. GAPDH was also detected as a loading control. *P<0.05 and ***P<0.001 vs. control. miR-25, microRNA-25; VSMC, vascular smooth muscle cells; OD, optical density; untreat, untreated.

miR-25 directly regulates the CDK6 gene in VSMCs

The current study suggested CDK6 as a potential target of miR-25 (Fig. 3A). To confirm whether CDK6 is a target, luciferase reporter gene assays were conducted. The miR-25 mimic rather than control significantly suppressed the luciferase activity of the reporter gene containing wild-type 3′-UTR of CDK6 (P<0.001); however, did not affect the activity of the gene containing the mutant 3′-UTR (Fig. 3B). Furthermore, the mRNA and protein levels of CDK6 were detected following transfection of cells with the miR-25 mimic. Notably, mRNA and protein levels of CDK6 were substantially reduced upon transfection with the miR-25 mimic (Fig. 3C and D; P<0.001).

Figure 3

miR-25 directly regulates the CDK6 gene in VSMCs. (A) CDK6 was identified as a potential target of miR-25. CDK6 3′-mut indicates the CDK6 3′-UTRs with six mutation sites (underlined) in miR-25 binding sites. (B) miR-25 mimic but not the control mimic significantly suppressed the luciferase activity of the reporter gene containing WT 3′-untranslated region of CDK6, but did not affect the activity of the gene containing mutant 3′-UTR. (C) Reverse transcription-quantitative polymerase chain reaction analysis demonstrated that overexpression of miR-25 suppressed the mRNA expression of CDK6. (D) Overexpression of miR-25 was observed to inhibit CDK6 protein expression using western blot analysis. GAPDH was also detected as a loading control. ***P<0.001 vs. control. miR-25, microRNA-25; CDK6, cyclin-dependent kinase 6; VSMCs, vascular smooth muscle cells; WT, wild type; MUT, mutant; untreat, untreated.

CDK6 is involved in miR-25-mediated VSMC proliferation

To explore whether miR-25 mediated tumor suppression in VSMCs via directly targeting CDK6, a ‘rescue’ methodology was used. The expression of CDK6 was restored in cells that had been previously treated with miR-25 mimics. In agreement with the restored expression of CDK6 protein (Fig. 4A), an increase in cell proliferation was observed upon transfection with the CDK6 plasmid (Fig. 4B). Furthermore, miR-25 mimics were able to inhibit cell proliferation and the promotion of cell proliferation following TNF-α treatment was significantly attenuated by the re-introduction of miR-25 (Fig. 4C). In addition, TNF-α was able to enhance CDK6 protein expression and miR-25 attenuated this effect (Fig. 4D).

Figure 4

CDK6 is involved in miR-25-mediated proliferation of VSMCs. (A) Western blot analysis of CDK6 expression in untreated VSMCs or those co-transfected with either miR-25 mimics or control with pCDNA-CDK6 or a pCDNA empty vector; GAPDH was also detected as a loading control. (B) Cell growth curves in the VSMCs transfected with different combinations using CCK8 proliferation analysis. (C) CCK8 proliferation analysis demonstrated that the promotion of cell proliferation upon TNF-α stimulation was significantly attenuated by the re-introduction of miR-25. (D) Western blot analysis demonstrated that TNF-α can enhance the CDK6 protein expression and miR-25 can attenuate this effect. GAPDH was also detected as a loading control. *P<0.05, **P<0.01 and ***P<0.001, vs. untreated. CDK6, cyclin-dependent kinase 6; miR-25, microRNA-25; VSMCs, vascular smooth muscle cells; CCK8, Cell Counting kit 8; TNF-α, tumor necrosis factor-α; OD, optical density; untreat, untreated.

Discussion

The abnormal proliferation of VSMCs is critical in the pathogenesis of atherosclerosis, coronary heart disease and restenosis (24,25). The presence of chronic or mild inflammation in the arteries is a risk factor for cardiovascular disease (26,27) and TNF-α is a potent inflammatory cytokine. TNF-α has been reported to possess the ability to induce vascular damage and promote the pathogenesis of atherosclerosis (8,28). In addition, TNF-α is known to regulate the proliferation and migration of VSMCs, which results in calcium deposition and an increase in arterial stiffness (12,29,30). However, the precise mechanisms of TNF-α in the regulation of abnormal VSMC proliferation remains to be fully elucidated. The data of the current study suggested that TNF-α inhibits miR-25 expression, overexpression of miR-25 suppresses the proliferation of VSMCs and overexpression of CDK6 impairs the miR-25-induced inhibition of proliferation of VSMCs. These observations suggest that TNF-α may function to promote abnormal proliferation of the VSMCs via the inhibition of miR-25. Thus, miR-25 may be a potential therapeutic target in the treatment of vascular disease.

Previous studies have demonstrated that miR-25 is able to regulate various developmental and cellular processes, and is implicated in a number of human diseases (31–33). miR-25 is known to be important in several types of cancer, including hepatocellular carcinoma, and colon, gastric and lung cancer (34–36). miR-25 has been indicated to be involved in various cellular processes, including cell proliferation, apoptosis and the release of cytokines (37–40). Esposito et al (36) demonstrated that miR-25 was reduced in anaplastic thyroid carcinomas, and ectopic expression of miR-25 suppressed the proliferation and colony formation of anaplastic thyroid carcinoma cells via the induction of G2/M-phase cell cycle arrest (36). However, the precise function of miR-25 in VSMCs remains unknown. In the present study, TNF-α was observed to inhibit the expression of miR-25. Furthermore, overexpression of miR-25 was suggested to inhibit VSMC proliferation. Thus, it is possible that TNF-α induces VSMC proliferation partly via the inhibition of miR-25 expression.

Various previous studies have suggested that cell proliferation may be caused by dysregulation of cell cycle-associated proteins, including cyclins, CDKs and CDK inhibitors (41,42). CDK6 is a member of the family of serine-threonine kinases, which predominantly mediate the regulation of cell cycle progression (43). The CDK6 gene has been observed to often be amplified or overexpressed in various types of human cancer, including gastric cancer, Ewing’s sarcoma and lymphoid malignancies (44–46). A previous study demonstrated that acetylbritannilactone (ABL) treatment inhibited platelet-derived growth factor-induced synthesis and proliferation of DNA in cultured VSMCs. The ABL-mediated inhibition of cell growth was associated with G1 phase arrest. This was correlated with a reduction in expression levels of cyclins D1, A and E, and CDK2, 4 and 6, in addition to an increase in the expression of the CDK inhibitory protein p21cip1 and enhanced binding of p21cip1 to CDKs (47). The current study demonstrated that CDK8 is the target of miR-25 in VSMCs, as transfection of miR-25 resulted in a substantial reduction of luciferase activity by the luciferase expression constructs that carry the target CDK6 fragment compared with the mutant constructs that lack this site. Furthermore, ectopic expression levels of miR-25 significantly downregulated the transcription of the CDK6 gene and the expression of CDK6 protein. Thus, decreased expression of miR-25 in tumor cells is suggested to contribute to the increasing expression levels of CDK6 at the post-transcriptional level and in atherosclerotic progression.

In conclusion, the present study suggests that TNF-α inhibits the expression of miR-25 and overexpression of miR-25 inhibits the proliferation of VSMC via targeting CDK6. These results aid in the understanding of the pro-atherogenic mechanisms of TNF-α. miR-25 is suggested to serve an important role in the proliferation of VSMCs and atherosclerosis induced by TNF-α. However, in order to further elucidate the precise mechanisms of the TNF-α-mediated regulation of VSMC proliferation, further investigation is required.

References

1 

Zeidan A, Purdham DM, Rajapurohitam V, Javadov S, Chakrabarti S and Karmazyn M: Leptin induces vascular smooth muscle cell hypertrophy through angiotensin II- and endothelin-1-dependent mechanisms and mediates stretch-induced hypertrophy. J Pharmacol Exp Ther. 315:1075–1084. 2005. View Article : Google Scholar : PubMed/NCBI

2 

Chen NX, Kiattisunthorn K, O’Neill KD, et al: Decreased microRNA is involved in the vascular remodeling abnormalities in chronic kidney disease (CKD). PloS One. 8:e645582013. View Article : Google Scholar : PubMed/NCBI

3 

Davis-Dusenbery BN, Wu C and Hata A: Micromanaging vascular smooth muscle cell differentiation and phenotypic modulation. Arterioscler Thromb Vasc Biol. 31:2370–2377. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Kothapalli D, Castagnino P, Rader DJ, Phillips MC, Lund-Katz S and Assoian RK: Apolipoprotein E-mediated cell cycle arrest linked to p27 and the Cox2-dependent repression of miR221/222. Atherosclerosis. 227:65–71. 2013. View Article : Google Scholar : PubMed/NCBI

5 

Bohlen F, Kratzsch J, Mueller M, et al: Leptin inhibits cell growth of human vascular smooth muscle cells. Vascul Pharmacol. 46:67–71. 2007. View Article : Google Scholar

6 

Bodary PF, Shen Y, Ohman M, et al: Leptin regulates neointima formation after arterial injury through mechanisms independent of blood pressure and the leptin receptor/STAT3 signaling pathways involved in energy balance. Arterioscler Thromb Vasc Biol. 27:70–76. 2007. View Article : Google Scholar

7 

Beltowski J: Leptin and atherosclerosis. Atherosclerosis. 189:47–60. 2006. View Article : Google Scholar : PubMed/NCBI

8 

Davis R, Pillai S, Lawrence N, Sebti S and Chellappan SP: TNF-α-mediated proliferation of vascular smooth muscle cells involves Raf-1-mediated inactivation of Rb and transcription of E2F1-regulated genes. Cell Cycle. 11:109–118. 2012. View Article : Google Scholar :

9 

Gao X, Belmadani S, Picchi A, et al: Tumor necrosis factor-alpha induces endothelial dysfunction in Lepr(db) mice. Circulation. 115:245–254. 2007. View Article : Google Scholar : PubMed/NCBI

10 

Rajesh M, Mukhopadhyay P, Haskó G, Huffman JW, Mackie K and Pacher P: CB2 cannabinoid receptor agonists attenuate TNF-alpha-induced human vascular smooth muscle cell proliferation and migration. Br J Pharmacol. 153:347–357. 2008. View Article : Google Scholar

11 

Lee SJ, Kim WJ and Moon SK: TNF-alpha regulates vascular smooth muscle cell responses in genetic hypertension. Int Immunopharmacol. 9:837–843. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Rho MC, Ah Lee K, Mi Kim S, et al: Sensitization of vascular smooth muscle cell to TNF-alpha-mediated death in the presence of palmitate. Toxicol Appl Pharmacol. 220:311–319. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Song B, Wang Y, Xi Y, et al: Mechanism of chemoresistance mediated by miR-140 in human osteosarcoma and colon cancer cells. Oncogene. 28:4065–4074. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Yu X, Li Z, Shen J, et al: MicroRNA-10b promotes nucleus pulposus cell proliferation through RhoC-Akt pathway by targeting HOXD10 in intervetebral disc degeneration. PloS One. 8:e830802013. View Article : Google Scholar :

15 

Hutcheson R, Terry R, Chaplin J, et al: MicroRNA-145 restores contractile vascular smooth muscle phenotype and coronary collateral growth in the metabolic syndrome. Arterioscler Thromb Vasc Biol. 33:727–736. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Martello G, Rosato A, Ferrari F, et al: A MicroRNA targeting dicer for metastasis control. Cell. 141:1195–1207. 2010. View Article : Google Scholar : PubMed/NCBI

17 

Majid S, Dar AA, Saini S, et al: MicroRNA-23b functions as a tumor suppressor by regulating Zeb1 in bladder cancer. PloS One. 8:e676862013. View Article : Google Scholar : PubMed/NCBI

18 

Wu WK, Lee CW, Cho CH, et al: MicroRNA dysregulation in gastric cancer: a new player enters the game. Oncogene. 29:5761–5771. 2010. View Article : Google Scholar : PubMed/NCBI

19 

Brenner B, Hoshen MB, Purim O, et al: MicroRNAs as a potential prognostic factor in gastric cancer. World J Gastroenterol. 17:3976–3985. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Cullen BR: MicroRNAs as mediators of viral evasion of the immune system. Nat Immunol. 14:205–210. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Rotllan N and Fernández-Hernando C: MicroRNA regulation of cholesterol metabolism. Cholesterol. 2012:8478492012. View Article : Google Scholar : PubMed/NCBI

22 

Chen KC and Juo SH: MicroRNAs in atherosclerosis. Kaohsiung J Med Sci. 28:631–640. 2012. View Article : Google Scholar : PubMed/NCBI

23 

Chen LJ, Lim SH, Yeh YT, Lien SC and Chiu JJ: Roles of microRNAs in atherosclerosis and restenosis. J Biomed Sci. 19:792012. View Article : Google Scholar : PubMed/NCBI

24 

Sun Y, Chen D, Cao L, et al: MiR-490-3p modulates the proliferation of vascular smooth muscle cells induced by ox-LDL through targeting PAPP-A. Cardiovasc Res. 100:272–279. 2013. View Article : Google Scholar : PubMed/NCBI

25 

Yu ML, Wang JF, Wang GK, et al: Vascular smooth muscle cell proliferation is influenced by let-7d microRNA and its interaction with KRAS. Circ J. 75:703–709. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Kim S and Kang H: miR-15b induced by platelet-derived growth factor signaling is required for vascular smooth muscle cell proliferation. BMB Rep. 46:550–554. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Li P, Liu Y, Yi B, et al: MicroRNA-638 is highly expressed in human vascular smooth muscle cells and inhibits PDGF-BB-induced cell proliferation and migration through targeting orphan nuclear receptor NOR1. Cardiovasc Res. 99:185–193. 2013. View Article : Google Scholar : PubMed/NCBI

28 

Gómez-Hernández A, Escribano Ó, Perdomo L, et al: Implication of insulin receptor A isoform and IRA/IGF-IR hybrid receptors in the aortic vascular smooth muscle cell proliferation: role of TNF-α and IGF-II. Endocrinology. 154:2352–2364. 2013. View Article : Google Scholar

29 

Jiang F, Jiang R, Zhu X, Zhang X and Zhan Z: Genipin inhibits TNF-α-induced vascular smooth muscle cell proliferation and migration via induction of HO-1. PloS One. 8:e748262013. View Article : Google Scholar

30 

Kim HH and Kim K: Enhancement of TNF-alpha-mediated cell death in vascular smooth muscle cells through cytochrome c-independent pathway by the proteasome inhibitor. FEBS Lett. 535:190–194. 2003. View Article : Google Scholar : PubMed/NCBI

31 

Li Q, Zou C, Han Z, et al: MicroRNA-25 functions as a potential tumor suppressor in colon cancer by targeting Smad7. Cancer Lett. 335:168–174. 2013. View Article : Google Scholar : PubMed/NCBI

32 

Razumilava N, Bronk SF, Smoot RL, et al: miR-25 targets TNF-related apoptosis inducing ligand (TRAIL) death receptor-4 and promotes apoptosis resistance in cholangiocarcinoma. Hepatology. 55:465–475. 2012. View Article : Google Scholar :

33 

Lu D, Davis MP, Abreu-Goodger C, et al: MiR-25 regulates Wwp2 and Fbxw7 and promotes reprogramming of mouse fibroblast cells to iPSCs. PloS One. 7:e409382012. View Article : Google Scholar : PubMed/NCBI

34 

Su ZX, Zhao J, Rong ZH, Geng WM, Wu YG and Qin CK: Upregulation of microRNA-25 associates with prognosis in hepatocellular carcinoma. Diagn Pathol. 9:472014. View Article : Google Scholar : PubMed/NCBI

35 

Xu FX, Su YL, Zhang H, Kong JY, Yu H and Qian BY: Prognostic implications for high expression of MiR-25 in lung adenocarcinomas of female non-smokers. Asian Pac J Cancer Prev. 15:1197–1203. 2014. View Article : Google Scholar : PubMed/NCBI

36 

Esposito F, Tornincasa M, Pallante P, et al: Down-regulation of the miR-25 and miR-30d contributes to the development of anaplastic thyroid carcinoma targeting the polycomb protein EZH2. J Clin Endocrinol Metab. 97:E710–E718. 2012. View Article : Google Scholar : PubMed/NCBI

37 

Li X, Yang C, Wang X, Zhang J, Zhang R and Liu R: The expression of miR-25 is increased in colorectal cancer and is associated with patient prognosis. Med Oncol. 31:7812014. View Article : Google Scholar

38 

Wahlquist C, Jeong D, Rojas-Muñoz A, et al: Inhibition of miR-25 improves cardiac contractility in the failing heart. Nature. 508:531–535. 2014. View Article : Google Scholar : PubMed/NCBI

39 

Setyowati Karolina D, Sepramaniam S, Tan HZ, Armugam A and Jeyaseelan K: miR-25 and miR-92a regulate insulin I biosynthesis in rats. RNA Biol. 10:1365–1378. 2013. View Article : Google Scholar : PubMed/NCBI

40 

Zhang H, Zuo Z, Lu X, Wang L, Wang H and Zhu Z: MiR-25 regulates apoptosis by targeting Bim in human ovarian cancer. Oncol Rep. 27:594–598. 2012.

41 

Grossel MJ and Hinds PW: Beyond the cell cycle: a new role for Cdk6 in differentiation. J Cell Biochem. 97:485–493. 2006. View Article : Google Scholar

42 

Pauls E, Ruiz A, Badia R, et al: Cell cycle control and HIV-1 susceptibility are linked by CDK6-dependent CDK2 phosphorylation of SAMHD1 in myeloid and lymphoid cells. J Immunol. 193:1988–1997. 2014. View Article : Google Scholar : PubMed/NCBI

43 

Kohrt D, Crary J, Zimmer M, et al: CDK6 binds and promotes the degradation of the EYA2 protein. Cell Cycle. 13:62–71. 2014. View Article : Google Scholar :

44 

Wu J, Qian J, Li C, et al: miR-129 regulates cell proliferation by downregulating Cdk6 expression. Cell Cycle. 9:1809–1818. 2010. View Article : Google Scholar : PubMed/NCBI

45 

Dauphinot L, De Oliveira C, Melot T, et al: Analysis of the expression of cell cycle regulators in Ewing cell lines: EWS-FLI-1 modulates p57KIP2and c-Myc expression. Oncogene. 20:3258–3265. 2001. View Article : Google Scholar : PubMed/NCBI

46 

Kollmann K and Sexl V: CDK6 and p16INK4A in lymphoid malignancies. Oncotarget. 4:1858–1859. 2013.PubMed/NCBI

47 

Liu B, Han M, Sun RH, Wang JJ, Liu YP and Wen JK: Acetylbritannilactone induces G1 arrest and apoptosis in vascular smooth muscle cells. Int J Cardiol. 149:30–38. 2011. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Qi L, Zhi J, Zhang T, Cao X, Sun L, Xu Y and Li X: Inhibition of microRNA-25 by tumor necrosis factor α is critical in the modulation of vascular smooth muscle cell proliferation. Mol Med Rep 11: 4353-4358, 2015.
APA
Qi, L., Zhi, J., Zhang, T., Cao, X., Sun, L., Xu, Y., & Li, X. (2015). Inhibition of microRNA-25 by tumor necrosis factor α is critical in the modulation of vascular smooth muscle cell proliferation. Molecular Medicine Reports, 11, 4353-4358. https://doi.org/10.3892/mmr.2015.3329
MLA
Qi, L., Zhi, J., Zhang, T., Cao, X., Sun, L., Xu, Y., Li, X."Inhibition of microRNA-25 by tumor necrosis factor α is critical in the modulation of vascular smooth muscle cell proliferation". Molecular Medicine Reports 11.6 (2015): 4353-4358.
Chicago
Qi, L., Zhi, J., Zhang, T., Cao, X., Sun, L., Xu, Y., Li, X."Inhibition of microRNA-25 by tumor necrosis factor α is critical in the modulation of vascular smooth muscle cell proliferation". Molecular Medicine Reports 11, no. 6 (2015): 4353-4358. https://doi.org/10.3892/mmr.2015.3329
Copy and paste a formatted citation
x
Spandidos Publications style
Qi L, Zhi J, Zhang T, Cao X, Sun L, Xu Y and Li X: Inhibition of microRNA-25 by tumor necrosis factor α is critical in the modulation of vascular smooth muscle cell proliferation. Mol Med Rep 11: 4353-4358, 2015.
APA
Qi, L., Zhi, J., Zhang, T., Cao, X., Sun, L., Xu, Y., & Li, X. (2015). Inhibition of microRNA-25 by tumor necrosis factor α is critical in the modulation of vascular smooth muscle cell proliferation. Molecular Medicine Reports, 11, 4353-4358. https://doi.org/10.3892/mmr.2015.3329
MLA
Qi, L., Zhi, J., Zhang, T., Cao, X., Sun, L., Xu, Y., Li, X."Inhibition of microRNA-25 by tumor necrosis factor α is critical in the modulation of vascular smooth muscle cell proliferation". Molecular Medicine Reports 11.6 (2015): 4353-4358.
Chicago
Qi, L., Zhi, J., Zhang, T., Cao, X., Sun, L., Xu, Y., Li, X."Inhibition of microRNA-25 by tumor necrosis factor α is critical in the modulation of vascular smooth muscle cell proliferation". Molecular Medicine Reports 11, no. 6 (2015): 4353-4358. https://doi.org/10.3892/mmr.2015.3329
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team