Brain‑derived neurotrophic factor is a novel target gene of the hsa‑miR‑183/96/182 cluster in retinal pigment epithelial cells following visible light exposure

  • Authors:
    • Hongyang Li
    • Yan Gong
    • Haiyan Qian
    • Tingjun Chen
    • Zihao Liu
    • Zhaocai Jiang
    • Shihui Wei
  • View Affiliations

  • Published online on: May 6, 2015     https://doi.org/10.3892/mmr.2015.3736
  • Pages: 2793-2799
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Light‑induced retinal injury is clinically and experimentally well‑documented. It may be categorized into three types: Photothermal, photomechanical and photochemical injuries. To date, the variation in the hsa‑miR‑183/96/182 cluster and its potential target genes in human primary retinal pigment epithelial (RPE) cells, following visible light exposure, has not been reported. In the present study, RPE cells were exposed to 4 h of constant visible light. The expression of the hsa‑miR‑183/96/182 cluster was determined using reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) and its potential target genes were investigated. Additionally, hsa‑miR‑183, hsa‑miR‑96, hsa‑miR‑182 and has‑miR‑183/96/182 mimics were designed and synthesized in vitro, and transfected into the RPE cells. Subsequently, the expression of brain‑derived neurotrophic factor (BDNF) mRNA and protein was measured, using RT‑qPCR and western blotting, respectively. The regulation of miRNAs to the BDNF gene were then validated using a dual luciferase reporter gene assay system. The expression of hsa‑miR‑183, hsa‑miR‑96 and hsa‑miR‑182 significantly increased in RPE cells following 4 h of visible light exposure, compared with RPE cells that had been exposed to dark conditions (P<0.01). Following RPE cell transfection with mimics, BDNF mRNA and protein expression in the RPE cells was significantly downregulated compared with control RPE cells (P<0.05, P<0.01, respectively). Similarly, the ratio of Renilla luciferase/firefly luciferase significantly decreased in the RPE cells of the mimic + wild type (WT) group compared with cells of the psiCHECKTM‑2 (a vector lacking the sequence of the BDNF gene), wild type and mimic + mutation groups (P<0.05,  P<0.01). The present study suggests that BDNF is a target gene of the has‑miR‑183‑96‑182 cluster in RPE cells. The present study suggests an underlying protective mechanism against retinal light injury and may provide a novel target for the prevention and treatment of light‑induced retinal injury.

Introduction

Retinal injury is one of most common eye diseases and is associated with old age, light damage and trauma (13). When eyes are directly and chronically exposed to sources of light (46), such as the Sun and lasers, the retina may be irreversibly damaged. Visible light (400–760 nm) may damage the retina through photochemical injury (79), which is considered to be the most common mechanism of light-induced retinal injury. Photochemical injury is independent of either mechanical or thermal retinal damage, and was first documented by Noell et al in 1966 (10). The authors showed that the retinas of albino rats were irreversibly damaged by continuous exposure to ambient light within the range of the visible light spectrum. Photochemical retinal-injury may be categorized into two distinct classes (11). Class I injury is characterized by exposure to low levels of white light irradiance (<1 mW/cm2) over hours to weeks. Class II injury is characterized by exposure to high levels of white light irradiance (>10 mW/cm2), with an action spectrum at shorter wavelengths. Rattner et al (12) found an increase in RNA transcripts coding for protective proteins, such as matrix metalloproteinase-3, serine peptidase inhibitor, clade A, member 3N; Serpin b1a; and the oncostatin M receptor. Rattner et al (12) also demonstrated a decrease in the transcription of genes coding for visual cycle components in neurosensory and retinal pigment epithelial (RPE) cells in response to light, using microarray RNA blotting and in situ hybridization (12).

MicroRNA (miRNA; ~22 nucleotides) is a type of small, endogenous and non-coding regulatory RNA, which is involved in the downregulation of target genes in a number of organisms, such as microorganisms and mammals (1316). A study by Lee et al (17), demonstrated that lin-4 and let-7 in Caenorhabditis elegans caused phenotypic functional loss, and their mutation prevented them from developing into larval stage. Since then, numerous studies have identified miRNA in organisms, including Drosophila (18,19) and mammals (20,21). miRNA binds to complementary sequences in the 3′-untranslated region (UTR) of multiple target mRNAs, usually inhibiting translation or causing destabilization (22,23). Certain miRNAs, such as the hsa-miR-183/96/182 cluster and hsa-miR-220, are able to silence retinal-specific genes, which are predominantly expressed in the retina (2426). Xu et al (27) reported that in mouse embryonic retinas, hsa-miR-183/96/182 expression is minimal, whereas its expression increases markedly following birth and peaks in adult retinas. hsa-miR-183/96/182 expression has a function in the maturation and healthy functioning of the adult retina (27). Krol et al (28) demonstrated that hsa-miR-183/96/182 exhibits a response to light and rapid turnover as a common property of neuronal microRNAs, which is independent of the circadian cycle. Lumayag et al (29) showed that inactivation of the hsa-miR-183/96/182 cluster results in changes in retinal gene expression, postnatal functional differentiation and synaptic connectivity of photoreceptors. A study by Liu et al’s (25) demonstrated that synthetic miRNA-mowers, targeting the has-miR-183/96/182 cluster, are involved in bladder cancer development. However, to the best of our knowledge, the influence of the hsa-miR-183/96/182 cluster on the downregulation of brain-derived neurotrophic factor (BDNF) in the retina has not been investigated. Therefore, the aim of the present study was to investigate the expression of hsa-miR-183/96/182 cluster following light treatment and to further investigate its regulation on the BDNF gene.

Materials and methods

Culturing human primary RPE cells and experimental grouping

The human primary cultured RPE cells (Beijing Research Biotechnology Co., Ltd. Beijing, China) were resurrected and cultured in α modified Eagle’s medium (Thermo Fisher Scientific Co., Ltd., Waltham, MA, USA) with 2 mM L-glutamine (Beijing Beifangtongzheng Co., Ltd., Beijing, China), 100 U/ml penicillin (Beijing Beifangtongzheng Co., Ltd.), 100 mg/ml streptomycin (Beijing Beifangtongzheng Co., Ltd.) and 10% fetal bovine serum (Thermo Fisher Scientific Co., Ltd.). Following this, the RPE cells were incubated at 37°C in 5% CO2 for one week, and randomly divided into two groups when cells were planked with 80%. The RPE cells in the visible light exposure group were exposed to visible light (400–760 nm) for 4 h, while the RPE cells in the dark condition group were shaded with silver paper for 4 h. Subsequently, cells were harvested in order to separate total RNA for reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Experiments for each group were repeated at least three times.

The potential target genes of the has-miR-183/96/182 cluster were identified using TargetScan software (http://www.targetscan.org/) according to the manufacturer’s instructions.

Synthesis of hsa-miR-183-96-182 mimics and transfection of the RPE cells

The hsa-miR-183, hsa-miR-96, hsa-miR-182 and has-miR-183/96/182 mimics were designed according to the sequence from the miRBase website (http://www.mirbase.org/). They were artificially synthesized by Invitrogen Life Technologies (Carlsbad, CA, USA). RPE cells were inoculated on a 12-well plate for 24 h prior to transfection, when planked with 80% and then transfected into RPE cells with 1 μg of each vector using lipofectamine 2000® transfection reagent (Invitrogen Life Technologies), according to the manufacturer’s instructions. Following 24 h transfection, cells were harvested to separate total RNA and total protein for subsequent experiments. Experiments for each group were repeated at least three times.

RT-qPCR

Total RNA from the RPE cells was extracted using a miRcute miRNA isolation kit (Tiangen Biotech, Beijing, China) according to the manufacturer’s instructions. The RPE cells (1×108/cm3) were harvested and disrupted by buffer MZ at room temperature (RT) for 5 min. Chloroform (200 μl) was added to the supernatant, followed by vigorous shaking for 15 sec and incubation at RT for 5 min. Following this, the cells were centrifuged at 12,000 × g at 4°C for 15 min. The upper aqueous phase was transferred to a 2 ml collection tube, and 1.5X volumes of anhydrous ethanol (Beijing Beifangtongzheng Co., Ltd.) was added followed by thorough mixing. The sample (700 μl) was added into a miRelute column and centrifuged at 12,000 × g at RT for 30 sec in order to discard the flow-through. MRD buffer (500 μl) was added to the miRelute column, incubated at RT for 2 min and centrifuged at 12,000 × g at RT for 30 sec to discard the flow-through. RW buffer (700 μl) was added to the miRelute column, incubated at RT for 2 min and then centrifuged at 12,000 × g at RT for 30 sec in to wash the column and repeated again. The miRelute column was placed into a new collection tube and centrifuged at 12,000 × g at 4°C for 1 min in order to dry the miRspin column. RNase-free ddH2O (30–100 μl; Beijing Beifangtongzheng Co., Ltd.) was added directly onto the miRspin column, incubated at RT for 2 min, and centrifuged at 12,000 × g at RT for 2 min in order to elute total RNA.

In order to conduct an RT-qPCR assay of the hsa-miR-183/96/182 cluster in RPE cells, total RNA was reverse-transcribed and analyzed using a SYBR® PrimeScript™ miRNA qPCR kit (Takara Bio, Inc., Shiga, Japan) according to the manufacturer’s instructions. The following primers were used in order to amplify the hsa-miR-183, hsa-miR-96 and hsa-miR-182 in the RPE cells after visible light exposure: Forward: 5′-ACACTCCAGCTGGGTATGGCACTGGTAGAA-3′ and reverse: 5′-CTCAACTGGTGTCGTGGAGTCG-GCAATTCAGTTGAG AGUGAAUU-3′ for hsa-miR-183, forward: 5′-ACACTCCAGCTGGGTTTGGCACTAGCACATT-3′ and reverse: 5′-CTCAACTGGTGTCGTGGAGTCGGCA ATTCAGTTGAGAGCAAAAA-3′ for hsa-miR-9, forward: 5′-ACACTCCAGCTGGGTTTGGCAATGGTAGAACT-3′ and reverse: 5′-CTCAACTGGTGTCGTGGAGTCGGCA ATTCAGTTGAGAGUGUGAG-3′ for hsa-miR-182, and forward: 5′-CTCGCTTCGGCAGCACA-3′ and reverse: 5′-AACGCTTCACGAATTTGCGT-3′ for U6.

In order to conduct an RT-qPCR assay of BDNF in RPE cells, total RNA was reverse-transcribed using a total RNA kit II (Omega-Biotek, Norcross, GA, USA) according to the manufacturer’s instructions. Amplification was conducted using SYBR® Premix Ex Taq™ II system (Takara Bio, Inc.) using the following primers: Forward: 5′-CTACGAGACCAAGTGCAATCC-3′ and reverse: 5′-AATCGCCAGCCAATTCTCTTT-3′ for BDNF.

All PCR reactions consisted of a 20 μl solution of 10 μl SYBR Green PCR Master Mix (Takara Bio, Inc., Shiga, Japan), 2 μl forward primer, 2 μl reverse primer, 1 μl template and 5 μl RNase-free water in a 0.2 ml EP tube, and used the following PCR protocol: 95°C for 15 min, followed by 45 cycles of 94°C for 15 sec, 55°C for 30 sec and 70°C for 30 sec. The relative quantification of miRNA was calculated using the 2−ΔΔCT method.

Western blot analysis

Protein concentration was measured using the bicinchoninic acid protein assay reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA) and. Samples (~35 μg) were separated using electrophoresis through 15% polyacrylamide gels, and transferred to polyvinylidene difluoride membranes (GE Healthcare, Cleveland, OH, USA) according to the manufacturer’s instructions. The membranes were probed with mouse-derived anti-BDNF monoclonal antibody (Beijing Zhongshan Golden Bridge Biotechnology, Co., Ltd., Beijing, China) diluted to 1:1,000 in Tris-Buffered Saline with Tween-20 (TBST; Sigma-Aldrich, St. Louis, MO, USA) and mouse-derived anti-β-actin antibody diluted to 1:1,000 in TBST (Beijing Zhongshan Golden Bridge, Biotechnology, Co., Beijing China) for 1.5 h at RT, followed by a horseradish peroxidase-conjugated goat anti-mouse secondary antibody (1:5,000 in TBST; Beijing Zhongshan Golden Bridge Biotechnology, Co., Ltd.) and incubated at RT for 1 h. The immunolabeled bands were examined by exposure to an X-ray film using the chemiluminescent substrate luminal reagent (GE Healthcare). The optical density of the band was scanned and quantified using the ImageJ software version 1.46 (http://www.originlab.com/).

Construction of psiCHECK™-2-BDNF (wild type) and psiCHECK-2-BDNF (mutation)

The BDNF mutant was designed based on the putative miR-182 recognition site (located at 252–258 bp) in the BDNF 3′-UTR, and mutated using QuikChange Lightning Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA, USA) according to the manufacturer’s instructions. The BDNF cDNA encoding sequences, including wild type and mutant, were amplified using PCR of human genomic DNA, using the following primers: 5′-CTCGAGACATGTCCATGACCAGAAGGG-3′ (underline indicates the Xho I restriction endonuclease site and 5′-GCGGCCGCTCACAATTAAAGCAGCATGCAA-3′ (underline indicates the Not I restriction endonuclease site. Subsequently, the PCR products and psiCHECK-2 vector were digested using restriction endonucleases Xho I (Takara Bio, Inc.) and Not I (Takara Bio, Inc.), and conjugated using T4 DNA ligase (Takara Bio, Inc.), followed by direct sequencing by Invitrogen Life Technologies.

Luciferase activity assay

In order to conduct a dual luciferase (Renilla luciferase/firefly luciferase) reporter gene assay, the 293T cells (Beijing Research Biotechnology Co., Ltd.) were cultured with Dulbecco’s modified Eagle’s medium, inoculated on a 12 well plate, and divided into four groups: psiCHECK-2, BDNF (wild type); mimic + BDNF (wild type); and mimic + BDNF (mutant). When the 293T cells were planked with 80%, 1 μg of each device was then transfected into 293T cells using Lipofectamine 2000 transfection reagent according to the manufacturer’s instructions. Following 48 h transfection, the 293T cells were harvested and digested with 0.25% trypsin (Takara Bio, Inc.). The 293T cells (75 μl; 5×104/ml) were separated and equal volumes of luciferase reagent was added to the cells for lysis at RT for 10 min, following which the firefly luciferase activity was measured Subsequently, 75 μl dual luciferase was added in order to fix the reagent to the plate and lysed at RT for 10 min, and then the Renilla luciferase activity was measured. The ratio of Renilla luciferase/firefly luciferase was then calculated and a histogram was produced using Origin 9.0 software (http://www.originlab.com/).

Statistical analysis

The data were analyzed by SPSS 21.0 (IBM SPSS, Armonk, NY, USA) using Student’s t-test. P<0.05 was considered to indicate a statistically significant difference.

Results

Visible light exposure increased hsa-miR-183/96/182 cluster expression in the RPE cells

hsa-miR-183, hsa-miR-96 and hsa-miR-182 transcription increased significantly in the RPE cells exposed to visible light compared with that in the RPE cells exposed to dark conditions (Fig. 1A, P<0.01). The potential target genes of the hsa-miR-183/96/182 cluster in the RPE cells were predicted using TargetScan software and the results suggested that BDNF is a novel target gene of the hsa-miR-183/96/182 cluster in RPE cells (Fig. 1B).

hsa-miR-183/96/182 mimics downregulates the mRNA and protein expression of BDNF in RPE cells

In order to investigate the influence of the hsa-miR-183/96/182 cluster on BDNF mRNA and protein expression in RPE cells, mimic sequences of hsa-miR-183, hsa-miR-96, hsa-miR-182 and hsa-miR-183/96/182 were designed (Table I) The mimics were then transfected into RPE cells. BDNF mRNA expression was significantly downregulated in cells transfected with hsa-miR-183/96/182 mimics when compared with BDNF mRNA expression in the control RPE cells, including mimics of hsa-miR-183, hsa-miR-96, hsa-miR-182 (Fig. 2, P<0.01). Similarly, BDNF protein expression was significantly downregulated in the RPE cells transfected with hsa-miR-183/96/182 mimics, compared with that in the control RPE cells (Fig. 3, P<0.05; P<0.01).

Table I

miRNA mimic sequences.

Table I

miRNA mimic sequences.

Mimic nameSequence (5′→3′)
miR-182UUUGGCAAUGGUAGAACUCACACU
miR-183UAUGGCACUGGUAGAAUUCACU
miR-96UUUGGCACUAGCACAUUUUUGCU
miR-183/96/182 UUGGCAAAUGGCACUUGGCAC

[i] Underline indicates seed sequences (miRNA nucleotides 2–8). miRNA, microRNA.

BDNF is a novel target gene of the hsa-miR-183/96/182 cluster

In order to validate the targeting of the hsa-miR-183/96/182 cluster to BDNF, a luciferase reporter vector was designed (Fig. 4A). Following transfection of hsa-miR-183/96/182 mimics into RPE cells, the ratio of Renilla luciferase/firefly luciferase was found to be significantly lower in mimic + wild type RPE cells, compared with the ratios in the psiCHECK-2, wild type and mimic + mutant RPE cells (Fig. 4B, P<0.01). The ratio of Renilla luciferase/firefly luciferase in the RPE cells of the wild type, mimic+mutant and psiCHECK-2 RPE cells were not significantly different (Fig. 4B).

Discussion

The present study demonstrated that photostimulation upregulated the expression of hsa-miR-183, hsa-miR-96 and hsa-miR-182 in RPE cells. Artificially synthesized hsa-miR-183/96/182 cluster mimics led to the downregulation of BDNF mRNA and protein expression in RPE cells, and significantly decreased the Renilla luciferase/firefly luciferase ratio in the RPE cells of the mimic + wild type group. The results indicated that BDNF is a novel target gene of the hsa-miR-183/96/182 cluster and BDNF provides a novel target for the prevention and treatment of light-induced retinal damage.

BDNF is an important member of the nerve growth factor family (30,31). It targets certain neurons of the central and peripheral nervous systems, and supports the survival of existing neurons, thereby facilitating synapse growth and differentiation (3234). It is found in a number of tissues, including the brain (35), retina (36,37), central nervous system (38,39) and motor neurons (4042). In the retina, BDNF controls the development of certain amacrine cell subtypes (4345) and regulates morphological maturation of ganglion cells (4648). Ladewig et al (49) demonstrated that BDNF activates the N-methyl-D-aspartate receptor to develop retinal ganglion cells. Rothe et al (50) showed that BDNF exhibits specific ionic channels that are necessary for repetitive firing in early retinal ganglion cell development. Numerous studies have documented that BDNF is involved in increasing the survival of photoreceptors in RPE cells that have undergone inherited retinal degeneration, light damage and experimental retinal detachment (51,52). Therefore, BDNF may be useful for the treatment and cure of light-induced retinal damage. However, to the best of our knowledge, there have been no studies investigating the regulation of BDNF by miRNAs, such as miR-183/96/182.

The hsa-miR-183/96/182 cluster is a highly conserved, intergenic sensory organ-specific and paralogous miRNA cluster, and regulates an attractive candidate gene, as described previously (26,53,54). The hsa-miR-183/96/182 cluster is expressed in photoreceptor cells and in the inner nuclear layer of the adult retina (24). The present study investigated the hypothesis that the miR-183/96/182 cluster is involved in BDNF gene regulation in the retina.

The expression of hsa-miR-183, hsa-miR-96 and hsa-miR-182 was measured in RPE cells following exposure to visible light or exposure to dark conditions. The results indicated that hsa-miR-183, hsa-miR-96 and hsa-miR-182 expression in the RPE cells is upregulated following exposure to visible light and downregulated following maintenance in dark conditions. Subsequently, hsa-miR-183/96/182 cluster mimics were synthesized in vitro and their regulatory effect on BDNF expression was investigated. According to a TargetScan software prediction, BDNF is a novel target of hsa-miR-183/96/182 cluster mimics. Furthermore, when RPE cells were transfected with hsa-miR-183/96/182 mimics, the expression of BDNF mRNA and protein was downregulated.

In conclusion, the results of the present study show that BDNF is a novel target of the hsa-miR-183/96/182 cluster in the retina. hsa-miR-183/96/182 mimics exhibited potential protective mechanisms against light injury in RPE cells via the BDNF gene. Therefore, the current study provides a novel approach for the prevention and treatment of light-induced retinal injury.

Acknowledgments

This study was supported by the China Postdoctoral Science Foundation (grant no. 2013M532109).

References

1 

Iandiev I, Wurm A, Hollborn M, et al: Müller cell response to blue light injury of the rat retina. Invest Ophthalmol Vis Sci. 49:3559–3567. 2008. View Article : Google Scholar : PubMed/NCBI

2 

Vázquez-Chona F, Song BK and Geisert EE Jr: Temporal changes in gene expression after injury in the rat retina. Invest Ophthalmol Vis Sci. 45:2737–2746. 2004. View Article : Google Scholar : PubMed/NCBI

3 

Wang AG, Chen CH, Yang CW, et al: Change of gene expression profiles in the retina following optic nerve injury. Brain Res Mol Brain Res. 101:82–92. 2002. View Article : Google Scholar : PubMed/NCBI

4 

Brod RD, Olsen KR, Ball SF and Packer AJ: The site of operating microscope light-induced injury on the human retina. Am J Ophthalmol. 107:390–397. 1989. View Article : Google Scholar : PubMed/NCBI

5 

Henkes HE: Light injury to the retina. Manifestation of acute posterior multifocal placoid pigment epitheliopathy (author’s transl). Klin Monbl Augenheilkd. 170:813–818. 1977.In German. PubMed/NCBI

6 

Meier-Koll A: Differential diagnosis of injury to the retina by means of electrically evoked light sensations (electrophosphene). Albrecht Von Graefes Arch Klin Exp Ophthalmol. 184:177–192. 1972.In German. View Article : Google Scholar

7 

Wilson KM, Lynch CM, Faraci FM and Lentz SR: Effect of mechanical ventilation on carotid artery thrombosis induced by photochemical injury in mice. J Thromb Haemost. 1:2669–2674. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Parver LM: Photochemical injury to the foveomacula of the monkey eye following argon blue-green panretinal photocoagu-lation. Trans Am Ophthalmol Soc. 98:365–374. 2000.

9 

Costa E, Kharlamov A, Guidotti A, Hayes R and Armstrong D: Sequelae of biochemical events following photochemical injury of rat sensory-motor cortex: mechanism of ganglioside protection. Patol Fiziol Eksp Ter. 4:17–23. 1992.PubMed/NCBI

10 

Noell WK, Walker VS, Kang BS and Berman S: Retinal damage by light in rats. Invest Ophthalmol. 5:450–473. 1966.PubMed/NCBI

11 

Cai YS, Xu D and Mo X: Clinical, pathological and photochemical studies of laser injury of the retina. Health Phys. 56:643–646. 1989. View Article : Google Scholar : PubMed/NCBI

12 

Rattner A, Yu H, Williams J, Smallwood PM and Nathans J: Endothelin-2 signaling in the neural retina promotes the endothelial tip cell state and inhibits angiogenesis. Proc Natl Acad Sci USA. 110:E3830–E3839. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Kawasaki H, Wadhwa R and Taira K: World of small RNAs: from ribozymes to siRNA and miRNA. Differentiation. 72:58–64. 2004. View Article : Google Scholar : PubMed/NCBI

14 

Li CM, Zheng JG and Du GS: miRNA: a new regulator of gene expression. Yi Chuan. 26:133–136. 2004.In Chinese.

15 

Luciano DJ, Mirsky H, Vendetti NJ and Maas S: RNA editing of a miRNA precursor. RNA. 10:1174–1177. 2004. View Article : Google Scholar : PubMed/NCBI

16 

Huang KM, Dentchev T and Stambolian D: MiRNA expression in the eye. Mamm Genome. 19:510–516. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Lee RC, Feinbaum RL and Ambros V: The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75:843–854. 1993. View Article : Google Scholar : PubMed/NCBI

18 

Reich J, Snee MJ and Macdonald PM: miRNA-dependent translational repression in the Drosophila ovary. PLoS One. 4:e46692009. View Article : Google Scholar : PubMed/NCBI

19 

Lee YS, Nakahara K, Pham JW, et al: Distinct roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways. Cell. 117:69–81. 2004. View Article : Google Scholar : PubMed/NCBI

20 

Liang XH, Hart CE and Crooke ST: Transfection of siRNAs can alter miRNA levels and trigger non-specific protein degradation in mammalian cells. Biochim Biophys Acta. 1829:455–468. 2013. View Article : Google Scholar : PubMed/NCBI

21 

McIver SC, Roman SD, Nixon B and McLaughlin EA: miRNA and mammalian male germ cells. Hum Reprod Update. 18:44–59. 2012. View Article : Google Scholar

22 

Zhou P, Xu W, Peng X, et al: Large-scale screens of miRNA-mRNA interactions unveiled that the 3′UTR of a gene is targeted by multiple miRNAs. PLoS One. 8:e682042013. View Article : Google Scholar

23 

Fang L, Du WW, Yang X, et al: Versican 3′-untranslated region (3′-UTR) functions as a ceRNA in inducing the development of hepatocellular carcinoma by regulating miRNA activity. FASEB J. 27:907–919. 2013. View Article : Google Scholar

24 

Zhu Q, Sun W, Okano K, et al: Sponge transgenic mouse model reveals important roles for the microRNA-183 (miR-183)/96/182 cluster in postmitotic photoreceptors of the retina. J Biol Chem. 286:31749–31760. 2011. View Article : Google Scholar : PubMed/NCBI

25 

Liu Y, Han Y, Zhang H, et al: Synthetic miRNA-mowers targeting miR-183-96-182 cluster or miR-210 inhibit growth and migration and induce apoptosis in bladder cancer cells. PLoS One. 7:e522802012. View Article : Google Scholar

26 

Tang H, Bian Y, Tu C, et al: The miR-183/96/182 cluster regulates oxidative apoptosis and sensitizes cells to chemotherapy in gliomas. Curr Cancer Drug Targets. 13:221–231. 2013. View Article : Google Scholar

27 

Xu S, Witmer PD, Lumayag S, Kovacs B and Valle D: MicroRNA (miRNA) transcriptome of mouse retina and identification of a sensory organ-specific miRNA cluster. J Biol Chem. 282:25053–25066. 2007. View Article : Google Scholar : PubMed/NCBI

28 

Krol J, Busskamp V, Markiewicz I, et al: Characterizing light-regulated retinal microRNAs reveals rapid turnover as a common property of neuronal microRNAs. Cell. 141:618–631. 2010. View Article : Google Scholar : PubMed/NCBI

29 

Lumayag S, Haldin CE, Corbett NJ, et al: Inactivation of the microRNA-183/96/182 cluster results in syndromic retinal degeneration. Proc Natl Acad Sci USA. 110:E507–E516. 2013. View Article : Google Scholar : PubMed/NCBI

30 

Lüesse HG, Roskoden T, Linke R, Otten U, Heese K and Schwegler H: Modulation of mRNA expression of the neurotrophins of the nerve growth factor family and their receptors in the septum and hippocampus of rats after transient postnatal thyroxine treatment. I Expression of nerve growth factor, brain-derived neurotrophic factor, neurotrophin-3 and neuro-trophin 4 mRNA. Exp Brain Res. 119:1–8. 1998. View Article : Google Scholar

31 

Hohn A, Leibrock J, Bailey K and Barde YA: Identification and characterization of a novel member of the nerve growth factor/brain-derived neurotrophic factor family. Nature. 344:339–341. 1990. View Article : Google Scholar : PubMed/NCBI

32 

Alvarez-Borda B, Haripal B and Nottebohm F: Timing of brain-derived neurotrophic factor exposure affects life expectancy of new neurons. Proc Natl Acad Sci USA. 101:3957–3961. 2004. View Article : Google Scholar : PubMed/NCBI

33 

Chmielnicki E, Benraiss A, Economides AN and Goldman SA: Adenovirally expressed noggin and brain-derived neurotrophic factor cooperate to induce new medium spiny neurons from resident progenitor cells in the adult striatal ventricular zone. J Neurosci. 24:2133–2142. 2004. View Article : Google Scholar : PubMed/NCBI

34 

Pencea V, Bingaman KD, Wiegand SJ and Luskin MB: Infusion of brain-derived neurotrophic factor into the lateral ventricle of the adult rat leads to new neurons in the parenchyma of the striatum, septum, thalamus and hypothalamus. J Neurosci. 21:6706–6717. 2001.PubMed/NCBI

35 

von Diemen L, Kapczinski F, Sordi AO, et al: Increase in brain-derived neurotrophic factor expression in early crack cocaine withdrawal. Int J Neuropsychopharmacol. 17:33–40. 2014. View Article : Google Scholar

36 

Abu El-Asrar AM, Nawaz MI, Siddiquei MM, Al-Kharashi AS, Kangave D and Mohammad G: High-mobility group box-1 induces decreased brain-derived neurotrophic factor-mediated neuroprotection in the diabetic retina. Mediators Inflamm. 2013:8630362013. View Article : Google Scholar : PubMed/NCBI

37 

Chen R, Yin XB, Peng CX and Li GL: Effect of brain-derived neurotrophic factor on c-jun expression in the rd mouse retina. Int J Ophthalmol. 5:266–271. 2012.PubMed/NCBI

38 

Numakawa T, Adachi N, Richards M, Chiba S and Kunugi H: Brain-derived neurotrophic factor and glucocorticoids: reciprocal influence on the central nervous system. Neuroscience. 239:157–172. 2013. View Article : Google Scholar

39 

Yan Q, Rosenfeld RD, Matheson CR, et al: Expression of brain-derived neurotrophic factor protein in the adult rat central nervous system. Neuroscience. 78:431–448. 1997. View Article : Google Scholar : PubMed/NCBI

40 

Niu C and Yip HK: Neuroprotective signaling mechanisms of telomerase are regulated by brain-derived neurotrophic factor in rat spinal cord motor neurons. J Neuropathol Exp Neurol. 70:634–652. 2011. View Article : Google Scholar : PubMed/NCBI

41 

Fryer HJ, Wolf DH, Knox RJ, et al: Brain-derived neurotrophic factor induces excitotoxic sensitivity in cultured embryonic rat spinal motor neurons through activation of the phosphati-dylinositol 3-kinase pathway. J Neurochem. 74:582–595. 2000. View Article : Google Scholar : PubMed/NCBI

42 

Wang W, Salvaterra PM, Loera S and Chiu AY: Brain-derived neurotrophic factor spares choline acetyltransferase mRNA following axotomy of motor neurons in vivo. J Neurosci Res. 47:134–143. 1997. View Article : Google Scholar : PubMed/NCBI

43 

Fujieda H and Sasaki H: Expression of brain-derived neurotrophic factor in cholinergic and dopaminergic amacrine cells in the rat retina and the effects of constant light rearing. Exp Eye Res. 86:335–343. 2008. View Article : Google Scholar

44 

Cellerino A, Arango-González BA and Kohler K: Effects of brain-derived neurotrophic factor on the development of NADPH-diaphorase/nitric oxide synthase-positive amacrine cells in the rodent retina. Eur J Neurosci. 11:2824–2834. 1999. View Article : Google Scholar : PubMed/NCBI

45 

Cellerino A and Kohler K: Brain-derived neurotrophic factor/neurotrophin-4 receptor TrkB is localized on ganglion cells and dopaminergic amacrine cells in the vertebrate retina. J Comp Neurol. 386:149–160. 1997. View Article : Google Scholar : PubMed/NCBI

46 

Leake PA, Hradek GT, Hetherington AM and Stakhovskaya O: Brain-derived neurotrophic factor promotes cochlear spiral ganglion cell survival and function in deafened, developing cats. J Comp Neurol. 519:1526–1545. 2011. View Article : Google Scholar : PubMed/NCBI

47 

Bonnet D, Garcia M, Vecino E, Lorentz JG, Sahel J and Hicks D: Brain-derived neurotrophic factor signalling in adult pig retinal ganglion cell neurite regeneration in vitro. Brain Res. 1007:142–151. 2004. View Article : Google Scholar : PubMed/NCBI

48 

Nakazawa T, Tamai M and Mori N: Brain-derived neurotrophic factor prevents axotomized retinal ganglion cell death through MAPK and PI3K signaling pathways. Invest Ophthalmol Vis Sci. 43:3319–3326. 2002.PubMed/NCBI

49 

Ladewig T, Fellner S, Zrenner E, Kohler K and Guenther E: BDNF regulates NMDA receptor activity in developing retinal ganglion cells. Neuroreport. 15:2495–2499. 2004. View Article : Google Scholar : PubMed/NCBI

50 

Rothe T, Bähring R, Carroll P and Grantyn R: Repetitive firing deficits and reduced sodium current density in retinal ganglion cells developing in the absence of BDNF. J Neurobiol. 40:407–419. 1999. View Article : Google Scholar : PubMed/NCBI

51 

Zhang M, Mo X, Fang Y, et al: Rescue of photoreceptors by BDNF gene transfer using in vivo electroporation in the RCS rat of retinitis pigmentosa. Curr Eye Res. 34:791–799. 2009. View Article : Google Scholar : PubMed/NCBI

52 

Caffé AR, Söderpalm AK, Holmqvist I and van Veen T: A combination of CNTF and BDNF rescues rd photoreceptors but changes rod differentiation in the presence of RPE in retinal explants. Invest Ophthalmol Vis Sci. 42:275–282. 2001.PubMed/NCBI

53 

Weeraratne SD, Amani V, Teider N, et al: Pleiotropic effects of miR-183~96~182 converge to regulate cell survival, proliferation and migration in medulloblastoma. Acta Neuropathol. 123:539–552. 2012. View Article : Google Scholar : PubMed/NCBI

54 

Mihelich BL, Khramtsova EA, Arva N, et al: miR-183-96-182 cluster is overexpressed in prostate tissue and regulates zinc homeostasis in prostate cells. J Biol Chem. 286:44503–44511. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

August-2015
Volume 12 Issue 2

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Li H, Gong Y, Qian H, Chen T, Liu Z, Jiang Z and Wei S: Brain‑derived neurotrophic factor is a novel target gene of the hsa‑miR‑183/96/182 cluster in retinal pigment epithelial cells following visible light exposure. Mol Med Rep 12: 2793-2799, 2015.
APA
Li, H., Gong, Y., Qian, H., Chen, T., Liu, Z., Jiang, Z., & Wei, S. (2015). Brain‑derived neurotrophic factor is a novel target gene of the hsa‑miR‑183/96/182 cluster in retinal pigment epithelial cells following visible light exposure. Molecular Medicine Reports, 12, 2793-2799. https://doi.org/10.3892/mmr.2015.3736
MLA
Li, H., Gong, Y., Qian, H., Chen, T., Liu, Z., Jiang, Z., Wei, S."Brain‑derived neurotrophic factor is a novel target gene of the hsa‑miR‑183/96/182 cluster in retinal pigment epithelial cells following visible light exposure". Molecular Medicine Reports 12.2 (2015): 2793-2799.
Chicago
Li, H., Gong, Y., Qian, H., Chen, T., Liu, Z., Jiang, Z., Wei, S."Brain‑derived neurotrophic factor is a novel target gene of the hsa‑miR‑183/96/182 cluster in retinal pigment epithelial cells following visible light exposure". Molecular Medicine Reports 12, no. 2 (2015): 2793-2799. https://doi.org/10.3892/mmr.2015.3736