This article is mentioned in:

Introduction

Pigs are one of the most important large animal models for xenotransplantation associated with various human diseases, since pigs are physiologically similar to humans and are widely available (1). Thus, pigs serve as a biomedical animal model, and they have been genetically modified (GM) and primarily produced using the technique of somatic cell nuclear transfer (SCNT) (2). Until recently, most genetically altered pigs were generated by random insertions of expression cassettes into porcine fetal fibroblasts (PFFs), or by editing the genome (3). Zinc finger nucleases (4–6) and transcription activator-like effector nucleases, or ʻTALENsʼ (7–9), have provided powerful tools to generate specific gene modifications in pigs; however, the complex design and generation greatly limit the application of these systems. The so-called clustered regularly interspaced short palindromic repeats (CRISPR) system, relying on CRISPR RNAs (crRNAs) in combination with CRISPR-associated (Cas) proteins to direct the degradation of complementary sequences present within invading viral and plasmid DNA, has been demonstrated to be an alternative strategy for precise gene editing (10,11). Cas9 endonuclease, from the Streptococcus pyogenes type II CRISPR/Cas system, functions as an RNA-guided endonuclease that uses a dual-guide RNA, consisting of crRNA and trans-activating crRNA (tracrRNA), for target recognition and cleavage by a mechanism involving two nuclease active sites that together generate double-stranded DNA (dsDNA) breaks, which requires the recognition of a short trinucleotide proto-spacer adjacent motif (PAM) sequence (-NGG) following the 20 bp crRNA target (12).

RNA-guided Cas9 nucleases have been successfully used to generate GM pigs via the direct cytoplasmic injection of Cas9 mRNA and single guide (sg)RNA into zygotes (13,14), or through the modification of somatic cells followed by SCNT (15). The CRISPR/Cas9 system has been applied to genome-wide loss-of-function screening in human cells (16,17) and mouse embryonic stem cells (18), and it is superior as a method to RNA interference (RNAi); however, the loss-of-function genes have not been verified in vitro and the approach has not been used in pig cells, particularly in primary cells. Additionally, for certain genes that are lethal to embryos, it is difficult to generate knockouts to study other functions.

In the present study, lentiviral cas9 was used to infect pig primary fibroblasts in order to generate cell colonies carrying the Cas9 protein. Subsequently, SCNT from pools of stably nucleofected cell clones was used to generate inducible transgenic expression cell lines for Cas9 protein. Thus, the Cas9 cell lines are a convenient and useful tool for editing the pig genome and for establishing pig models.

Materials and methods

Animal and recombinant DNA usage

The use of animals was approved by the Animal Care and Use Committee of the South China Agricultural University, Guangzhou, China. Recombinant DNA use was approved by the Institutional Biosafety Committee. All surgical procedures were performed under anesthesia, and all efforts were made to minimize animal suffering.

Guide (g)RNA design and plasmid construction

The lentiviral doxycycline-inducible FLAG-Cas9 (50661) and U6-sgRNA cloning vector (50662) plasmids were purchased from Addgene, Inc. (Cambridge, MA, USA). Targeting sgRNA was designed as previously described (16). An extra guanine was added to the 5′ end of the gRNA in which the first nucleotide was not guanine for more efficient transcription by RNA polymerase III (19). These constructs were confirmed by sequence analysis.

Virus production, transduction and selection

Lentivirus of FLAG-Cas9 was produced by co-transfection of the lentiviral transfer vector with the pMD2.G and pPAX2 packaging plasmids (Addgene, Inc.) into 293FT cells using Lipofectamine 3000 transfection reagent (Invitrogen Life Technologies; Thermo Fisher Scientific, Waltham, MA, USA). The virus-containing supernatant was collected 48 and 72 h following transfection, cleared of cell debris by filtering through a 0.45 µm filter and concentrated by ultracentrifugation (Merck Millipore, Darmstadt, Germany) at 4,000 g for 30 min at 4°C. PFFs were cultured until they had reached 50–80% confluence in six-well tissue culture plates, and were subsequently infected in media containing 10 µg/ml polybrene (Sigma-Aldrich, St. Louis, MO, USA) and concentrated lentivirus. At 12 h following infection, the virus was removed and cells were selected with 2 µg/ml puromycin (Sigma-Aldrich) for 5–7 days. Cell colonies were picked and cultured in 48-well plates. After 2 days, the cell colonies were subcultured and selected with 1 µg/ml puromycin for an additional 10 days. Subsequently, a fraction of selected cells was used for polymerase chain reaction (PCR) and reverse transcription (RT)-PCR detection, and the other cells were frozen for future use.

SCNT

Porcine SCNT was performed as described previously (15,20). Briefly, cumulus-oocyte complexes were aspirated from the ovaries and matured in maturation medium for 42–44 h at 39°C, as described previously (21). Cumulus cells were removed by repeated pipetting in 0.1% hyaluronidase (Sigma-Aldrich). Matured oocytes with a first polar body were enucleated manually in the presence of 7.5 mg/ml cytochalasin B (Sigma-Aldrich). A single fibroblast cell that was identified for gene integration by genotyping was microinjected into the perivitelline space of the oocytes. The oocyte-donor cell complexes were cultured in PZM3 medium (21) at 39°C for 1.5 h, and subsequently fusion and activation were performed with two successive direct current pulses at 1.2 kV/cm for 30 µs using an electrofusion instrument (model, CF-150/B; BLS Ltd., Budapest, Hungary). The reconstructed embryos were cultured in PZM3 medium at 39°C for 20 h and surgically transferred to the oviducts of the embryo recipients that were estrous-synchronized. The pregnancy status of the recipient sows was monitored by ultrasonography at ~25 days following the embryo transfer.

Cas9-PFF generation and culture

PFFs were isolated from 30-day-old fetuses of cloned pigs that were integrated with the Cas9 gene by tissue explant culture, as described previously (22). First, the fetuses were washed in phosphate buffered saline (PBS) containing 100 U/ml penicillin and 100 mg/ml streptomycin (Sigma-Aldrich China, Inc., Shanghai, China), and subsequently the heads, tails, limbs and viscera were removed under sterile conditions. Secondly, the residual tissues were washed twice in PBS and cut into small pieces (≤1 mm3), pasted on to 100-mm cell culture dishes, and 5 ml fetal bovine serum (FBS) was subsequently added. The culture dishes were incubated in humidified 95% air with 5% CO2 at 39°C for 24 h. Typically, the first outgrowing cells from the fetal explants became visible within 24 h of incubation, at which point the medium was replaced with Dulbecco modified Eagle's medium (DMEM) supplemented with 2 mM glutamine, 100 units/ml penicillin and 100 mg/ml streptomycin containing 10% FBS (Gibco™; Thermo Fisher Scientific) for 2–3 days. The cultured cells were expanded and subsequently cryopreserved for future use.

PCR and RT-PCR detection

Genomic DNA was isolated from selected cell colonies or Cas9-PFFs and wild-type cells using a TIANamp Genomic DNA kit [Tiangen Biotech (Beijing) Co., Ltd, Beijing, China]. The total RNA of the cell colonies or Cas9-PFFs induced with 1 µg/ml doxycycline for 48 h was extracted using an E.Z.N.A.® Total RNA kit (Omega Bio-Tek, Inc., Norcross, GA, USA), following the manufacturer's protocol and including DNase I (Takara Biotechnology Co., Ltd., Dalian, China) treatment to remove the genomic DNA. Complementary DNA (cDNA) was synthesized at 42°C for 60 min using a PrimeScript™ RT-PCR kit (Takara Biotechnology Co., Ltd.) with oligo (dT) primers. PCR was performed for genomic lever and RT-PCR for gene transcripts of Cas9 in a programmed thermal cycler (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The following PCR and RT-PCR conditions were used: Initial denaturation at 94°C for 3 min, followed by 35 cycles of denaturation at 94°C for 30 sec; annealing at 60°C for 30 sec and extension at 72°C for 1 min; and 10 min final extension at 72°C.

Indirect immunofluorescent assay (IFA)

Treated and untreated control cells cultured on cover slips were fixed with 4% paraformaldehyde for 10 min, permeabilized with 0.5% Triton X-100 (Sigma-Aldrich) for 15 min, and blocked with 1% bovine serum albumin for 30 min. After rinsing twice with PBS, a 1:200 dilution of the anti-FLAG monoclonal antibody (cat. no. AE005; ABclonal Biotechnology Co., Ltd., Cambridge, MA, USA) was added to the cells, incubated overnight at 4°C, and subsequently washed thrice in the washing buffer. The cells were then sequentially incubated with fluorescein isothiocyanate-conjugated goat anti-mouse secondary antibody (cat. no. 7076; Cell Signaling Technology, Inc., Danvers, MA, USA) at a dilution of 1:50 for 1 h at 37°C. Following washing, the cells were stained for DNA with 10 µg/ml Hoechst 33342 (Molecular Probes) and viewed under a fluorescent microscope (IX71; Olympus Corporation, Tokyo, Japan).

Western blotting

Protein extracts were obtained from Cas9 PFFs induced with 1 µg/ml doxycycline for 72 h and wild-type PFFs. The protein concentrations were determined using the Bradford method (23). Primary anti-FLAG monoclonal antibody (1:2,000 dilution; ABclonal Biotechnology) and anti-mouse immunoglobulin G horseradish peroxidase (1:3,000 dilution; Cell Signaling Technology, Danvers, MA, USA) were used for the western blot analysis. Western blotting was performed as previously reported (24).

Inverse PCR and integration analysis

To analyze FLAG-Cas9 insertion sites, 2 µg transgenic pig genomic DNA was digested with XhoI, purified on a DNA purification column (Omega Bio-Tek, Inc.), and eluted with 20 µl doubly distilled (dd)H2O. Eluted DNA was self-ligated in a 400 µl reaction system, including 400 units T4 ligase at 16°C overnight, prior to being purified on a DNA purification column and eluted with 20 µl ddH2O. The resulting circular DNA underwent nested PCR, and was amplified using the specific primers, LTR-1+P1 and LTR-2+P2 (for primer sequences, see Table I). The PCR products were cloned into pMD-18T, a simple cloning vector (Takara Biotechnology Co., Ltd.) and sequenced. Sequences were aligned to the sequence of the donor vector, pCW-Cas9, and the Sus scrofa (wild pig) genomic DNA sequence database (Build Sscrofa10.2) using the National Center for Biotechnological Information's Basic Local Alignment Search Tool (ʻBLASTʼ).

Table I Primer sequences.

Table I

Primer sequences.

Name	Direction	Description	Sequences (5′–3′)
Cas9-1f	Forward	Cas9 gene PCR	ACAAGCTGATCCGGGAAGTG
Cas9-1r	Reverse	and RT-PCR primers	CTGTCTGCACCTCGGTCTTT
β-actin-f	Forward	Pig actin detection	GTGCGGGACATCAAGGAGAA
β-actin-r	Reverse	RT-PCR primers	GTCACCTTCACCGTTCCAGT
LTR1	Forward	First IPCR	GAGGGATCTCTAGTTACCAGAGTCACA
P1	Reverse	Primers	GAAGAATCGCAAAACCAGCAAGAAAAG
LTR2	Forward	Secondary IPCR	AGCCAGAGAGCTCCCAGGCTCAGATC
P2	Reverse	Primers	CATAATGATAGTAGGAGGCTTGGTAGG

[i] RT-PCR, reverse transcription-polymerase chain reaction; IPCR, inverse PCR; LTR, large untranscribed region.

Results

Assessment of doxycycline-inducible FLAG-Cas9 in porcine primary cells

To determine doxycycline-inducible FLAG-Cas9 gene expression in porcine primary cells, the plasmid-expressed Cas9 was transfected into porcine fibroblasts and 293T cells as a control. Cas9 expression was confirmed at 48 h using an IFA. The results demonstrated that the tet-on system, which expresses FLAG-Cas9, is able to function properly in porcine fibroblasts (Fig. 1), although it was weaker compared with 293T cells (Fig. 2).

Figure 1 Doxycycline-inducible FLAG-Cas9 expression in porcine primary cells. (A–C) PFF-transfected Cas9 without doxycycline treatment for 48 h. (D–F) PFF-transfected Cas9 with 1 µg/ml doxycycline treatment for 48 h. PFF, porcine fetal fibroblast.

Figure 2 Doxycycline-inducible FLAG-Cas9 expression in 293T cells. (A–C) PFF-transfected Cas9 without doxycycline treatment for 48 h. (D–F) PFF-transfected Cas9 with 1 µg/ml doxycycline treatment for 48 h. PFF, porcine fetal fibroblast.

Generation of transgenic PFF colonies

Following selection and culture for 20 days, 16 PFF colonies were obtained (Fig. 3A), and whether or not the target gene had been integrated into the porcine genome was subsequently determined. The results of the genomic DNA PCR analysis revealed that all colonies had integrated the Cas9 gene (Fig. 3B).

Figure 3 Generation of transgenic PFF colonies. (A) PFF clones after 7 days with 2 µg/ml of puromycin selection. Red bar=100 µm. (B) Detection of the Cas9 gene at the genomic level by polymerase chain reaction. c1-c16 represent transgenic PFF colonies with integrated Cas9 gene; c17 is the wild-type PFF colony. PFF, porcine fetal fibroblast.

Generation of FLAG-Cas9 PFFs via SCNT

Eleven transgenic PFF colonies containing the Cas9 gene were selected as donors for SCNT. A total of 835 reconstructed embryos were introduced into three surrogate mothers. Among the surrogate mothers, one was revealed to be pregnant by ultrasonography 25 days following embryo transfer, and the other two were not apparently pregnant (Table II). Therefore, the pregnant surrogate mother was sacrificed at 30 days, and three normal fetuses were obtained (Fig. 4A). The genomic DNA PCR analysis demonstrated three Cas9-positive PFFs (Fig. 4B). RT-PCR and western blot analyses indicated that three Cas9-positive PFFs successfully exhibited mRNA and protein expression of the Cas9 gene (Fig. 4C and D). However, the FLAG-Cas9 gene was expressed at a lower level in PFF1 compared with PFF2 and PFF3 (Fig. 4C).

Figure 4 Generation of FLAG-Cas9PFF. (A) Generation of three clonal 30 day fetuses. (B) Detection of the Cas9 gene of the clonal fetuses by PCR. (C) Expression of Cas9-PFFs. Clonal Cas9-PFFs were induced by dox for 48 h, and Cas9 protein was detected using FLAG-tag protein. (D) Detection of the Cas9 gene of the clonal fetuses at the transcriptome level by RT-PCR. Three clonal PFFs were treated with dox for 48 h, and untreated as the control. PFF, porcine fetal fibroblast; NE, untreated porcine embryo; dox, doxycycline; RT-PCR, reverse transcription-polymerase chain reaction.

Table II Somatic cell nuclear transfer results for the generation of FLAG-Cas9 PFFS.

Table II

Somatic cell nuclear transfer results for the generation of FLAG-Cas9 PFFS.

Target gene	Cell pool	Transferred embryos	No. recipients	No. (%) pregnancies	No. 30 day fetuses	No. (%) transgenic PFFs
Cas9	Clo1-4	280	1	0	0	0
	Clo5-7	270	1	0	0	0
	Clo8-11	285	1	1	3	3

[i] PFF, porcine fetal fibroblast.

Identification of FLAG-Cas9 integration sites in the transgenic PFFs genome

To analyze FLAG-Cas9 integration, inverse PCR was used to identify the lentiviral vector insertion sites in the genome of transgenic PFFs expressing Cas9. Three integration sites were identified in the transgenic PFF1 genome, integrated on chromosomes 2, 7 and 9 (Fig. 5A), one of which was located near to known functional genes. Two integration sites (on chromosomes 1 and 16) were identified in the transgenic PFF2 (Fig. 5B), and one integration site was identified in PFF3 (Fig. 5C), none of which were located near to known functional genes.

Figure 5 Identification of pCW-cas9 integration sites in the transgenic PFF genome. Identified integration sites of pCW-Cas9 in the transgenic (A) PFF1, (B) PFF2 and (C) PFF3 genomes are shown. All the identified insertion site sequences contain the lentiviral vector LRT sequences, which is indicative of the insertion border between the lentiviral vector and flanking genomic DNA. PFF, porcine fetal fibroblast.

Discussion

Cas9 is a dsDNA endonuclease that uses a crRNA guide to specify the site of cleavage, and is an essential component of the CRISPR/Cas9 system (11,25). The cell lines expressing Cas9 have provided a convenient system with which to generate targeted mutations of any gene by simple transfection with sgRNA (26). In the present study, three doxycycline-inducible flag-cas9 PFFs were successfully generated through SCNT, which conditionally expressed Cas9 endonuclease. Consistently with previous reports (27,28), the transfection efficiency of the doxycycline-inducible FLAG-Cas9 vector was lower in porcine fibroblasts; however, transgenic PFF1 expressed less Cas9 protein compared with the other transgenic PFFs, which may be associated with integration sites on the PFF genome.

The CRISPR/Cas9 system was initially used to edit the genomes of prokaryotic and eukaryotic organisms, including deletion and insertion by DNA double-stranded break (DSB) repair mechanisms. Cas9 endonuclease, with sgRNAs, was shown to be able to modify single (29,30) or multiple (31) genes. Previously, the CRISPR/Cas9 system has been used to create pigs of one genetic strain or multiple genetic modifications in a single pregnancy (32); however, the present study aimed to directly generate modified organisms using Cas9 endonuclease and targeted sgRNAs. In the present study, PFFs were generated expressing stable tetracycline-regulated Cas9 endonuclease. Subsequently, the genes of interest were specifically knocked out using inducible Cas9, in association with targeting sgRNAs in pigs, which is more convenient compared with the conventional CRISPR/Cas9 system. Premature microRNAs (miRNAs) exist as a classical stem-loop structure. Therefore, DSBs could be generated using the CRISPR/Cas9 system. DSBs in the loop region may affect miRNA maturation during processing by Drosha and Dicer, resulting in knockdown of the miRNA in mammalian cells (33). Therefore, doxycycline-inducible FLAG-Cas9 PFFs were able be used for porcine genome editing and miRNA expression and regulation. The CRISPR-associated protein Cas9 not only identifies genomic DNA and generates sequence-specific dsDNA cleavage, but it also binds with high affinity to single-stranded RNA (ssRNA) targets matching the Cas9-associated guide RNA sequence when the PAM is presented in trans as a separate DNA oligonucleotide, and stimulates site-specific endonucleolytic cleavage of ssRNA targets, including endogenous mRNA with PAM-presenting oligonucleotides (PAMmers) (34). It is hypothesized that the inducible Cas9 PFFs may be used to regulate porcine mRNA expression.

Loss-of-function screening is a powerful and hypothesis-free approach to identify genes and pathways that underlie biological processes. The CRISPR/Cas9 system was considered to be an ideal tool for genetic screening, since RNAi may only achieve a partial depletion of gene activity, and knockout-based screens are difficult to manage in diploid mammalian cells, for example, as has been applied to human and mouse cells (17,18). PFFs are highly undifferentiated cells compared with other cells retrieved from adult tissue, and have been demonstrated to be the most effective donor cells for SCNT (35,36). Therefore, the present study has revealed that a loss-of-function pig model may be generated on the basis of doxycycline-inducible flag-cas9 PFFs, and this function may be verified in vitro.

In conclusion, three porcine fibroblast cell lines that conditionally express Cas9 were established. These FLAG-Cas9 PFFs may be widely applicable in porcine genomic editing and the regulation of gene expression. In our future work, these cells are to be used with the intention of editing reproduction-associated genes in pigs. The porcine fibroblast cell lines expressing Cas9 endonuclease may be productively used in SCNT procedures to generate a porcine model of genomic modification, along with targeting sgRNAs.

Acknowledgments

This study was supported by the National Basic Research and Development Program of China (973 Program, nos. 2011CB944202 and 2010CB945001) and the National Natural Science Foundation of China (no. 31402072).

References