Calyptranthes grandifolia O.Berg (Myrtaceae) ethanolic extract inhibits TNF-α gene expression and cytokine release in vitro

  • Authors:
    • Geórgia Muccillo Dexheimer
    • Luciana Knabben de Oliveira Becker Delving
    • Henrique Sulzbach de Oliveira
    • Vanderlei Biolchi
    • Márcia Inês Goettert
    • Adriane Pozzobon
  • View Affiliations

  • Published online on: March 14, 2017     https://doi.org/10.3892/mmr.2017.6319
  • Pages: 2873-2880
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Anti-tumor therapies based on anti-inflammatory effects have been considered in cancer treatment. Survival, proliferation and, resultantly, invasion and metastasis of tumor cells are regulated by local inflammatory mediators. Primary inflammatory cytokines, such as tumor necrosis factor (TNF), are targets for anticancer therapy. Several anti‑inflammatory agents isolated from natural products are becoming important chemopreventive and therapeutic agents for cancer. The present study aimed to investigate the expression of TNF‑α, nuclear factor‑κΒ (NF‑κΒ) and p38α mitogen-activated protein kinase (p38α) genes, associated with proliferation and inflammation in the Caco‑2 cell line treated with ethanolic and hexanic extracts of Calyptranthes grandifolia O.Berg (Myrtaceae). Caco‑2 cells were cultured and treated with plant extract at different concentrations (25, 50, 100 and 200 µg/ml) and stimulated with lipopolysaccharide (LPS). For gene expression, analysis was performed by total RNA extraction followed by synthesis of complementary DNA and analysis by quantitative polymerase chain reaction. The release of TNF‑α cytokine was evaluated by ELISA in RAW 264.7 murine macrophages activated by LPS. Among the evaluated genes, there was a decrease in TNF-α expression at 100 and 200 µg/ml concentrations only with the ethanolic extract (P<0.025). The p38α gene exhibited a tendency to increase expression only when treated with ethanolic extract and the NF‑κΒ gene did not significantly differ compared with the positive control when treated with either analyzed extract. The inhibition of TNF-α cytokine in the RAW 264.7 cell line was significant (P<0.05) in ethanolic extract at 200 µg/ml compared with the positive control (LPS 1 µg/ml). In conclusion, the ethanolic extract may exhibit an anti‑inflammatory activity by inhibiting TNF‑α. However, further studies are required to confirm its potential anti-inflammatory effects.

Introduction

Inflammation associated with cancer is a promising target for the development of anticancer therapies. Cytokines, chemokines and growth factors may have an important function in the interaction between tumor cells and infiltrating leukocytes from blood vessels. The existence of inflammatory components in the microenvironment of neoplastic tissues frequently leads to increased angiogenesis, resistance to hormones and inhibition of adaptive anti-tumor immunity. The survival, proliferation and subsequent invasion and metastasis of tumor cells is regulated by inflammatory mediators present at the tumor site (1).

Primary inflammatory cytokines, including interleukin-1 (IL-1) and tumor necrosis factor (TNF), expressed by leukocytes and tumor infiltrating cells, are targets for anticancer therapy. Anti-cytokine strategies against tumors have been investigated with TNF inhibitors in certain inflammatory diseases (2). Clinical trials with TNF-α antagonists, alone or combined with other therapies, have been performed in patients with cancer. In cases of advanced solid cancer, TNF-α antagonists were well tolerated and exhibited biological activity and partial response with renal carcinoma or stable disease (3,4). Permanent activation of NF-κΒ contributes actively in tumorigenesis by promoting cell cycle progression and inhibiting apoptosis. NF-κΒ is activated through TNF-α, thus inhibition of this factor may support cancer therapies that target apoptosis (5,6). Inhibition of NF-κΒ is associated with apoptosis and reduced cell growth, and this inhibition may be beneficial in the treatment of cancer (7). The p38α mitogen-activated protein kinase (p38α MAPK) may have tumor suppressor activity through regulation of the p53 gene, which interferes with cell cycle progression and induces apoptosis. However, it also exhibits oncogenic activity associated with various processes, including invasion, inflammation and angiogenesis, which are essential in tumor development (8).

Plants are a major source of active substances that are used in therapeutic medicine as their metabolites have great structural diversity (9). Anti-inflammatory compounds have been extracted from natural products, including fruits, vegetables, spices and traditional medicinal herbs, and these compounds have been gaining importance as potential chemopreventive or therapeutic agents for cancer (10). In the last 2 decades, herbal products have been important candidates in the discovery of novel drugs for cancer (11). Drugs derived from natural products that have antibacterial, anticoagulant, antiparasitic, immunosuppressive and anticancer properties are able to treat 87% of categorized human diseases (12). There were 12 natural products and 32 derivatives of natural products among the 128 anticancer drugs released to the market between 1981 and 2010. They were obtained from various sources, including plants and microorganisms. Between 1940 and 2010, 175 small molecules were released for the treatment of cancer and of those, 131 molecules were developed from natural products (13). The investigation of novel plants with anti-inflammatory, anti-tumor and anti-carcinogenic potential is important and may enable the development of novel drugs for cancer treatment. Several members of Myrtaceae family have been previously investigated and various activities were observed, including antioxidant (14), anti-tumor (1521) and anti-inflammatory activities (2227). To the best of our knowledge, there are no existing studies investigating the activity of Calyptranthes grandifolia. However, important activities have been demonstrated in other members of the Calyptranthes genus (2835). Thus, this genus demonstrates potential and may be beneficial in the treatment of inflammatory and tumor processes. The objective of the present study was to investigate the expression of genes associated with proliferation and inflammation in cells of the Caco-2 cell line treated with extracts from Calyptranthes grandifolia O.Berg.

Materials and methods

Plant material

Leaves of Calyptranthes grandifolia O.Berg were collected in Lajeado, Rio Grande do Sul, in Southern Brazil and identified by Professor Elisete Maria de Freitas. From this material ethanol and hexane extracts were isolated according to the following methodology.

Hexanic extract preparation

The leaves of the plant were dried in an incubator with circulating air at 38°C for 24 h. Subsequently, leaves were reduced to small fragments to increase the contact surface with the extraction solution. The leaves of Calyptranthes grandifolia O.Berg were packed with hexane solvent in an amber bottle at room temperature for 72 h. Vacuum filtration was performed and the filtrate was stored in an amber jar at room temperature until the solvent was removed. Maceration of the leaves occurred for 2 weeks and the solvent was changed twice. Subsequently, vacuum filtration and removal of solvent was performed with the aid of a rotary evaporator at 40°C. Finally, the extract obtained was stored in amber bottles and refrigerated at 4±1°C until experiments were performed.

Ethanolic extract preparation

Plant leaves were dried in an oven with circulating air at 38°C for 24 h. Following this period, cold static soaking was performed on fragments of leaves with 90% ethanol and the material was placed in an amber bottle and kept at room temperature for 7 days. Subsequent to the extraction period, vacuum filtration and removal of solvent was performed with the aid of a rotary evaporator at 40°C. The extract was placed in amber bottles and refrigerated at 4±1°C until experiments were performed.

Dilution of extracts

Solubilization of the extract was performed with dimethylsulfoxide (DMSO) so that the final concentration was ≤0.5%.

Cell culture

Caco-2 colorectal adenocarcinoma cell line (HTB-37; American Type Culture Collection, Manassas, VA, USA) and RAW 264.7 murine macrophage cell line (TIB-71; American Type Culture Collection) were cultivated in microwell plates (1×105 cells/well) in an incubator (37°C, 5% CO2). Subsequently, treatment with plant extract was performed at different concentrations (25, 50, 100 and 200 µg/ml), with incubation in culture medium Dulbecco's modified Eagle's medium (DMEM, Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) supplemented with 10% fetal bovine serum (FBS, Sigma-Aldrich; Merck KGaA) for 1 h at 37ºC. Subsequently, lipopolysaccharides (LPS; 1 µg/ml) were added, and incubation was performed at 37°C and 5% CO2 for 24 h (36). Subsequent to 24 h incubation at different concentrations and treatments, extraction of total RNA was performed on the Caco-2 cell line and the supernatant of RAW 264.7 cells was collected for ELISA assay. In addition to treatment with extracts, each culture plate had a positive control, in which cells were stimulated with LPS only, and a negative control with no stimulation or treatment. A total of 5 different experiments were performed for gene expression analysis.

Cell viability assay by alamar Blue®

Caco-2 cells were plated at density of 1×105 cells/ml in 96-well plates containing 200 µl of DMEM low glucose and 10% FBS, and incubated for 24 h in an atmosphere of 5% CO2, 90% humidity and 37°C. Subsequently, cells were treated with concentrations of 25, 50, 100 or 200 µg/ml per well of extract, and incubated for 72 h. Following this period, treatment was removed and a solution of 10% alamar Blue® dye was added per well. The absorbance readings were performed following 6 h incubation at 37°C, at a wavelength of 540 nm (oxidized) and 620 nm (reduced) in an ELISA reader. As a negative control, cells were placed only in culture medium and DMSO. The percentage of cell viability was calculated using the following formula: % alamar Blue® reduction = absorbance at 540 nm-(absorbance at 630 nm×correction factor) ×100. Correction factor was calculated by staining the culture medium with no cells.

Cell viability assay by Trypan Blue

Cells were removed from the plates with the aid of a scraper and transferred to 15 ml centrifuge tubes (1×105 cells/centrifuge tube; Corning Incorporated, Corning, NY, USA), which were centrifuged at 600 × g for 10 min at room temperature. Following centrifugation, the supernatant was discarded and the pellet was resuspended in 1 ml DMEM in a 1:10 dilution with Trypan Blue dye, which stains non-viable cells. Finally, a total count of viable cells was performed in a Neubauer chamber for subsequent plating of viable Caco-2 and RAW264.7 cells (37).

RNA extraction

Total RNA extraction was performed by the TRIzol® method (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions and purification was performed by illustra RNAspin Mini kit (GE Healthcare Life Sciences, Chalfont, UK). Total RNA was quantified using aL-Quant® spectrophotometer (Loccus, São Paulo, Brazil) with a 2 µl final product of RNA extraction, and absorbance was read at 260 nm.

Complementary DNA (cDNA) synthesis

Synthesis of cDNA was performed from 0.5 µg total RNA, using poly-A tail complementary oligonucleotide primers and the Superscript™ II Reverse Transcriptase kit according to the manufacturer's protocol (Invitrogen; Thermo Fisher Scientific, Inc.). To each sample tube, 1 µl of dNTP mix and 1 µl OligodT was added prior to incubation for 5 min at 65°C. Then, 9 µl of a mix containing 10X PCR Buffer, 25 mM MgCl2, 0.1 M DTT and RNase OUT was added and further incubated for 2 min at 42°C. A total of 1 µl of Superscript II RT was added and incubated again at 42°C for 50 min and 70°C for 15 min. Finally, 1 µl of RNase H was added and incubated at 37°C for 20 min. At the end of synthesis, the cDNA was stored at −20°C until amplification was performed by quantitative polymerase chain reaction (qPCR).

qPCR

Gene expression analysis was performed by qPCR. The results were normalized to β-actin (38,39) and the efficiency of reactions was evaluated using the standard curve of each gene analyzed. The qPCR results were expressed as the relative quantification of amplified cDNA with respect to the normalizer gene (40). Primers used for amplification of specific cDNA fragments were selected from the published sequence of each gene using online tool Primer3 v.0.4.0 (41). All primers were synthesized by Invitrogen (Thermo Fisher Scientific, Inc.; Table I). DNA amplification and relative quantification was performed using a StepOnePlus™ Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) and the Platinum® SYBR® Green qPCR SuperMix-UDG kit (Invitrogen; Thermo Fisher Scientific, Inc.) in a total volume of 25 ml [12.5 µl SuperMix, 0.5 µl (50 µmol/l) Rox reference dye, 0.3 µl of each primer (10 µmol/l forward and 10 µmol/l reverse), 9.4 µl H2O and 2.0 µl 1:20 diluted template cDNA] according to the manufacturer's (SYBR® Green kit) instructions. Amplification and reading of samples was performed in duplicate with the following protocol for all genes: Initial incubation for 3 min at 94°C; followed by 45 cycles of 30 sec denaturation at 94°C; 30 sec annealing at 55°C and 30 sec extension at 60°C. To confirm specificity of the reaction, a dissociation curve was performed for each primer pair with melting temperature analysis of each gene.

Table I.

Oligonucleotide primers for quantitative polymerase chain reaction.

Table I.

Oligonucleotide primers for quantitative polymerase chain reaction.

GeneSequence (5′-3′)Fragment size (bp)
NF-κΒ 209
  Sense ACACCGTGTAAACCAAAGCC
  Antisense CAGCCAGTGTTGTGATTGCT
p38α 243
  Sense CAGTGGGATGCATAATGGCC
  Antisense GCATCTTCTCCAGCAAGTCG
TNF-α 120
  Sense CCCTGGTATGAGCCCATCTATC
  Antisense AAAGTAGACCTGCCCAGACTCG
β-actin 140
  Sense CTGGAACGGTGAAGGTGACA
  Antisense AAGGGACTTCCTGTAACAATGCA

[i] NF-κB, nuclear factor κB; p38α, p38α mitogen-activated protein kinase; TNF-α, tumor necrosis factor-α.

TNF-α cytokine release in RAW 264.7 cells by ELISA assay

Following 24 h incubation of RAW 264.7 cells with LPS stimulation, 0.4 ml supernatant was collected and stored at −80°C and used for quantification of the release of TNF-α pro-inflammatory cytokine using the Mouse TNF alpha ELISA Ready-SET-Go® ELISA kit (cat. no. 88-7324-86; e-Bioscience, Inc., San Diego, CA, USA) according to the manufacturer's instructions.

Statistical analysis

Data were tabulated and analyzed with descriptive statistics using SPSS software (version 20.0; IBM SPSS, Armonk, NY, USA) and GraphPad Prism (version 5.0; GraphPad Software, Inc., La Jolla, CA, USA). Comparison between the controls was performed using an unpaired Student's t-test and the effects of extracts were analyzed by one-way analysis of variance followed by the Tukey test. P<0.05 was considered to indicate a statistically significant difference.

Results

Cell viability by alamar Blue®

It was observed that the ethanolic and hexane extracts of Calyptranthes grandifolia O.Berg did not affect the cell proliferation when compared with the negative control. The negative control exhibited a viability of 62.6% (± 4.367), and for ethanolic and hexane extracts at tested concentrations, the percentages of viability were similar to the control (Fig. 1).

Gene expression analysis

For the analysis of the genes of interest, the positive control consisted of Caco-2 cells that were stimulated only by LPS with no extract treatment, and the negative control consisted only of cells in culture. The comparison between negative and positive controls was performed in order to verify whether there was a difference in gene expression when stimulated by LPS. Increased expression of TNF-α was observed following treatment with LPS compared with the negative control, however, this was not significantly different. In addition, the expression of NF-κB and p38α were similar in negative and positive control groups; expression was not altered by LPS treatment. Thus, the expression of these genes was stable in the negative and positive control groups (Fig. 2). When evaluating the effect of the ethanolic extract of Calyptranthes grandifolia on gene expression, a decrease in TNF-α expression was observed, which was significant at concentrations of 100 and 200 µg/ml, compared with the positive control (P<0.025; Fig. 3A). Regarding NF-κΒ gene expression, expression was similar for all treatments and there were no significant changes (Fig. 3B). The expression of p38α increased with increasing concentrations of ethanolic extract, however, these increases were not significant (Fig. 3C). The expression of TNF-α, NF-κΒ and p38α with hexane extract treatment exhibited no significant variation compared with the positive control (Fig. 3D-F).

TNF-α cytokine release in RAW 264.7 cells by ELISA

In order to demonstrate the decrease in TNF-α in gene expression, an ELISA colorimetric assay was performed to evaluate the level of cytokine release. A macrophage lineage was used, characterized by the release of inflammatory cytokines. The inhibition of TNF-α was significant (P<0.05) with the ethanolic extract at a concentration of 200 µg/ml (464.0±36.7 pg/ml) compared with the positive control (1143.0±118.0 pg/ml; Fig. 4) and also when compared with a concentration of 25 µg/ml (1272±293 pg/ml). Concentrations of 25 µg/ml (1272±293 pg/ml), 50 µg/ml (1179±261 pg/ml) and 100 µg/ml (1185±312 pg/ml) exhibited no significant difference compared with the positive control (Fig. 4). The negative control (53.6±36.8 pg/ml) exhibited a significant difference in TNF-α cytokine release compared with the positive control (P<0.0001; Fig. 4) and compared with concentrations of 25, 50 and 100 µg/ml (P<0.001; Fig. 4). There were no significant differences when treated with hexanic extract (data not shown).

Discussion

Stimulation by LPS increased TNF-α gene expression in the positive control (stimulated with LPS) compared with the negative control (no stimulation with LPS). The expression of p38α and NF-κΒ did not change in the positive control compared with the negative control. Herath et al (42) demonstrated that different serotypes of LPS produce different responses upon cell stimulation. For example, in human gingival fibroblasts there was no activation of the NF-κΒ pathway by LPS 1435/1449. However, LPS1690 significantly activated the pathway. Other pro-inflammatory genes also exhibit modified activation by different LPS serotypes.

When evaluating the effect of Calyptranthes grandifolia O.Berg extract treatment, on TNF-α gene expression, the present study observed reduced expression compared with the positive control at certain concentrations in both extracts. However, only the ethanolic extract at concentrations of 100 and 200 µg/ml significantly reduced TNF-α expression compared with the positive control. To the best of our knowledge, there are no previous studies that have evaluated the effect of this plant on TNF-α expression, however, Ferreira et al (43) evaluated the anti-inflammatory activity of Campomanesia adamantium extracts (also a member of the Myrtaceae family) and the production of nitric oxide (NO), TNF-α and IL-10 in J774.A1 macrophages stimulated with LPS/interferon-γ. Paw edema in mice was inhibited by oral administration of the extracts, it inhibited NO and TNF-α production, and increased IL-10 production. Thus, the anti-inflammatory activity of the extract may be associated with the inhibition of pro-inflammatory cytokines and increased IL-10. Li et al (44) evaluated the activity of flavonoids in RAW 264.7 cells and demonstrated the inhibition of NO, TNF-α, IL-6 and IL-Ip, indicating an important role for flavanoids in anti-inflammatory activity (44).

The present study observed no changes in NF-κΒ expression between the different extracts and concentrations tested. The activation of NF-κΒ in Caco-2 cells may be associated with the state of cell differentiation. NF-κΒ signaling pathways or IκΒ kinase do not exist in isolation, therefore, various mechanisms integrate their activity with other signaling pathways (45). NF-κΒ is a protein that modulates the apoptotic response as it is a transcription factor that protects against and contributes to apoptosis (46). The nuclear factor is a central regulator of immune responses and has an important role in the expression of cytokine genes, including IL-2, IL-6, C-C motif chemokine 2 and CD40 ligand. Furthermore, it is also involved in the expression of genes associated with cell survival and proliferation, including cyclin D1, cyclin D2, c-Myc, c-Myb, cyclooxygenase-2, Bcl-2 and Bcl-xl (47,48). Thus, NF-κΒ is considered as a tumor promoter and is frequently identified as constitutively active in tumors (4952). NF-κΒ may not have been activated due to the high expression of TNF-α, and thus by anti-inflammatory signals.

The present study observed no significant differences in p38α gene expression between the various treatments and concentrations. However, its expression did increase with increasing concentrations of ethanolic extract, with the highest expression at a concentration of 200 µg/ml. The activation of p38 isoforms is specifically controlled by different regulators and they are co-activated by several combinations (53,54). The p38α MAPK activates other kinases and therefore regulates diverse cellular responses. Thus, p38 signaling may be associated with inflammation, the cell cycle, cell death, development, differentiation, senescence and tumorigenesis (55). The anti-tumor effect of various chemotherapeutic drugs is based on apoptosis through p38α activation. However, it is important to note that this kinase is associated with various responses, and may also be involved in resistance to chemotherapy in certain types of tumors (56). Campbell et al (57) demonstrated that a modification of p38α MAPK inhibited TNF-α production in macrophages induced by LPS, post-transcriptionally. Furthermore, p38 negatively regulated the expression of NF-κΒ, which allows transcriptional control of TNF-α as the nuclear factor is required for its expression (57). Despite the pro-apoptotic role of p38α, p38α MAPK has also been previously associated with an anti-apoptotic activity (5861). Comes et al (62) demonstrated that p38α induced the survival of colorectal cancer cells by inhibiting autophagy. Another mechanism involved in p38α-induced survival is the activation of the activating transcription factor 6α-Ras homolog enriched in brain-mechanistic target of rapamycin (ATF6α-Rheb-mTOR) pathway, which promoted the survival of dormant tumor cells in vivo (63). Although the present study observed no significant differences in the mRNA levels of p38α and NF-κΒ, further studies are required with larger sample sizes, as well as studies that investigate the expression at the protein level, to verify the presence and activation of these proteins. The increase in mRNA levels is not directly proportional to the amount of protein translated, due to transcriptional and post-translational modifications.

The extracts included in the present study did not affect the cell viability when compared with the negative control. According to the US National Cancer Institute, an extract may be considered active or cytotoxic when it presents cytotoxicity with IC50 values <30 µg/ml (half maximal inhibitory concentration) (64). In this aspect, cytotoxic extracts maybe potential candidates for anti-carcinogenic studies (65). However, it is important to note that these statements should be tested in other cell lines in order to observe potential selective cytotoxicity.

The antioxidant activity was also determined in ethanolic and hexane extracts of Calyptranthes grandifolia by the research group (data not shown). This activity was evaluated by antioxidant activity testing, by capturing the free radical 2,2-diphenyl-1-picryl-hidrazila (66). The results demonstrated that the hexane extract exhibited no antioxidant activity, however, the ethanolic extract exhibited a dose dependent antioxidant activity. The observed antioxidant activity may be associated with a potential anti-inflammatory activity of the extract, based on the results observed for gene expression and TNF-α cytokine release. The ethanolic extract had significant antioxidant activity compared with hexane, which corresponds with the decrease of TNF-α gene expression.

Based on the significant reduction of TNF-α when Caco-2 cells were treated with the ethanolic extract of Calyptranthes grandifolia O.Berg, the significant inhibition of TNF-α cytokine release in RAW 264.7 murine macrophages, antioxidant activity of the extract and the lack of effects on cell viability, it is indicated that this extract may have anti-inflammatory potential. However, further studies are required to elucidate the signaling pathway that may be activated. Given the variation between experiments and potential post-transcriptional regulation, the analysis of other genes is required in order to assess the potential pathways implicated. Furthermore, it is important to analyze protein expression in order to confirm that the expressed genes in Caco-2 cells are translated and determine the respective levels of translation.

In conclusion, Calyptranthes grandifolia ethanolic extract at concentrations of 100 and 200 µg/ml significantly reduced TNF-α gene expression in the Caco-2 cell line. There were no significant differences in p38α and NF-κΒ gene expression. Cells treated with hexane extract exhibited no significant variations in the expression of the genes investigated at any of the concentrations. Ethanolic extract at 200 µg/ml significantly inhibited TNF-α pro-inflammatory cytokine release. The extracts were not considered to be cytotoxic and are not candidates for anti-carcinogenic studies in this lineage. However, other studies using different cell lines maybe performed to identify selective cytotoxicity. The results of the present study indicate that ethanolic extract has an anti-inflammatory potential by decreasing expression of TNF-α. Thus, it is important to investigate its genotoxicity and to conduct in vivo analysis to confirm its anti-inflammatory potential.

References

1 

Germano G, Allavena P and Mantovani A: Cytokines as key component of cancer-related inflammation. Cytokine. 43:374–379. 2008. View Article : Google Scholar : PubMed/NCBI

2 

Bartlett DL, Ma G, Alexander HR, Libutti SK and Fraker DL: Isolated limb reperfusion with tumor necrosis factor and melphalan in patients with extremity melanoma after failure of isolated limb perfusion with chemotherapeutics. Cancer. 80:2084–2090. 1997. View Article : Google Scholar : PubMed/NCBI

3 

Madhusudan S, Muthuramalingam SR, Braybrooke JP, Wilner S, Kaur K, Han C, Hoare S, Balkwill F and Ganesan TS: Study of etanercept, a tumor necrosis factor-alpha inhibitor, in recurrent ovarian cancer. J ClinOncol. 23:5950–5959. 2005. View Article : Google Scholar

4 

Harrison ML, Obermueller E, Maisey NR, Hoare S, Edmonds K, Li NF, Chao D, Hall K, Lee C, Timotheadou E, et al: Tumor necrosis factor alpha as a new target for renal cell carcinoma: Two sequential phase II trials of infliximab at standard and high dose. J ClinOncol. 25:4542–4549. 2007. View Article : Google Scholar

5 

Garg A and Aggarwal BB: Nuclear transcription factor-kappaB as a target for cancer drug development. Leukemia. 16:1053–1068. 2002. View Article : Google Scholar : PubMed/NCBI

6 

Beg AA and Baltimore D: An essential role for NF-kappaB in preventing TNF-alpha-induced cell death. Science. 274:782–784. 1996. View Article : Google Scholar : PubMed/NCBI

7 

Stroh C, Held J, Samraj AK and Schulze-Osthoff K: Specific inhibition of transcription factor NF-kappaB through intracellular protein delivery of IkappaBalpha by the Herpes virus protein VP22. Oncogene. 22:5367–5373. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Dolado I and Nebreda AR: Regulation of tumorigenesis by p38α MAP kinase. Topics Curr Genet. 20:99–128. 2008. View Article : Google Scholar

9 

Brandão HN, David JP, Couto RD, Nascimento JAP and David JM: Química e farmacologia de quimioterápicos antineoplásicos derivados de plantas. Quím Nova. 33:1359–1369. 2010. View Article : Google Scholar

10 

Aravindaram K and Yang NS: Anti-inflammatory plant natural products for cancer therapy. Planta Med. 76:1103–1117. 2010. View Article : Google Scholar : PubMed/NCBI

11 

Bhanot A, Sharma R and Noolvi MN: Natural sources as potential anti-cancer agents: A review. Int J Phytomed. 3:9–26. 2011.

12 

Newman DJ, Cragg GM and Snader KM: The influence of natural products upon drug discovery. Nat Prod Rep. 17:215–234. 2000. View Article : Google Scholar : PubMed/NCBI

13 

Newman DJ and Cragg GM: Natural products as sources of new drugs over the 30 years from 1981 to 2010. J Nat Prod. 75:311–335. 2012. View Article : Google Scholar : PubMed/NCBI

14 

Souza-Moreira TM, Moreira RRD, Sacramento LVS and Pietro RCLR: Histochemical, phytochemical and biological screening of Pliniacauliflora (Mart.) Kausel (Myrtaceae) leaves. RevBras Farmacogn. 20:48–53. 2010. View Article : Google Scholar

15 

Zhang P, Zhang E, Xiao M, Chen C and Xu W: Enhanced chemical and biological activities of a newly biosynthesized eugenol glycoconjugate, eugenol α-D-glucopyranoside. Appl Microbiol Biotechnol. 97:1043–1050. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Rizzo LY, Longato GB, Ruiz AL, Tinti SV, Possenti A, Vendramini-Costa DB, Sartoratto A, Figueira GM, Silva FL, Eberlin MN, et al: In vitro, in vivo and in silico analysis of the anticancer and estrogen-like activity of guava leaf extracts. Curr Med Chem. 21:2322–2330. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Sultana B, Anwar F, Mushtaq M, Aslam M and Ijaz S: In vitro antimutagenic, antioxidant activities and total phenolics of clove (Syzygiumaromaticum L.) seed extracts. Pak J Pharm Sci. 27:893–899. 2014.PubMed/NCBI

18 

Liu H, Schmitz JC, Wei J, Cao S, Beumer JH, Strychor S, Cheng L, Liu M, Wang C, Wu N, et al: Clove extract inhibits tumor growth and promotes cell cycle arrest and apoptosis. Oncol Res. 21:247–259. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Ye CL, Liu Y and Wei DZ: Antioxidant and anticancer activity of 3′-formyl-4′,6′-dihydroxy-2′-methoxy-5′-methylchalcone and (2S)-8-formyl-5-hydroxy-7-methoxy-6-methylflavanone. J Pharm Pharmacol. 59:553–559. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Aisha AF, Ismail Z, Abu-Salah KM, Siddiqui JM, Ghafar G and Majid Abdul AM: Syzygium campanulatum korth methanolic extract inhibits angiogenesis and tumor growth in nude mice. BMC Complement Altern Med. 13:1682013. View Article : Google Scholar : PubMed/NCBI

21 

Pascoal AC, Ehrenfried CA, Lopez BG, de Araujo TM, Pascoal VD, Gilioli R, Ruiz AL, Carvalho JE, Stefanello ME and Salvador MJ: Antiproliferative activity and induction of apoptosis IN PC-3 cells by the chalcone cardamonin from Campomanesia adamantium (Myrtaceae) in a bioactivity-guided study. Molecules. 19:1843–1855. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Michel MCP, Guimarães AG, Paula CA, Rezende SA, Sobral MEG and Guimarães DAS: Extracts from the leaves of Campomanesia velutina inhibits production of LPS/INF-γ induced inflammatory mediators in J774A.1 cells and exerts anti-inflammatory and antinociceptive effects in vivo. Rev Bras Farmacogn. 23:927–936. 2013. View Article : Google Scholar

23 

Jeong D, Yang WS, Yang Y, Nam G, Kim JH, Yoon DH, Noh HJ, Lee S, Kim TW, Sung GH and Cho JY: In vitro and in vivo anti-inflammatory effect of Rhodomyrtus tomentosa methanol extract. J Ethnopharmacol. 146:205–213. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Flores G, Dastmalchi K, Wu SB, Whalen K, Dabo AJ, Reynertson KA, Foronjy RFD, Armiento JM and Kennelly EJ: Phenolic-rich extract from the Costa Rican guava (Psidiumfriedrichsthalianum) pulp with antioxidant and anti-inflammatory activity. Potential for COPD therapy. Food Chem. 141:889–895. 2013. View Article : Google Scholar : PubMed/NCBI

25 

Serafino A, Vallebona Sinibaldi P, Andreola F, Zonfrillo M, Mercuri L, Federici M, Rasi G, Garaci E and Pierimarchi P: Stimulatory effect of Eucalyptus essential oil on innate cell-mediated immune response. BMC Immunol. 9:2008. View Article : Google Scholar : PubMed/NCBI

26 

Santos FA, Rao VSN and Silveira ER: Anti-inflammatory and analgesic activities of the essential oil of Psidium guianense. Fitoterapia. 68:65–68. 1997.

27 

Sharma R, Kishore N, Hussein A and Lall N: Antibacterial and anti-inflammatory effects of Syzygiumjambos L. (Alston) and isolated compounds on acne vulgaris. BMC Complement Altern Med. 13:2922013. View Article : Google Scholar : PubMed/NCBI

28 

Gourdeau H, Leblond L, Hamelin B, Desputeau C, Dong K, Kianicka I, Custeau D, Boudreau C, Geerts L, Cai SX, et al: Antivascular and antitumor evaluation of 2-amino-4-(3-bromo-4,5-dimethoxy-phenyl)-3-cyano-4H-chromenes, a novel series of anticancer agents. Mol Cancer Ther. 3:1375–1384. 2004.PubMed/NCBI

29 

Chetan BS, Nimesh MS, Manish PP and Ranjan GP: Microwave assisted synthesis of novel 4H-chromene derivatives bearing phenoxypyrazole and their antimicrobial activity assess. J Serb ChemSoc. 77:1165–1174. 2012. View Article : Google Scholar

30 

Mladenović M, Mihailović M, Bogojević D, Matić S, Nićiforović N, Mihailović V, Vuković N, Sukdolak S and Solujić S: In vitro antioxidant of selected 4-Hydroxy-chromene-2-one derivatives-SAR, QSAR and DFT studies. Int J MolSci. 12:2822–2841. 2011. View Article : Google Scholar

31 

Cheng JF, Ishikawa A, Ono Y, Arrhenius T and Nadzan A: Novel chromene derivatives as TNF-alpha inhibitors. Bioorg Med Chem Lett. 13:3647–3650. 2003. View Article : Google Scholar : PubMed/NCBI

32 

Thareja S, Verma A, Kalra A, Gosain S, Rewatkar PV and Kokil GR: Novel chromeneimidazole derivatives as antifungal compounds: Synthesis and in vitro evaluation. Acta Pol Pharm. 67:423–427. 2010.PubMed/NCBI

33 

Correa RGC, Silva ML, Maia JGS, Gottlieb OR, Mourão JC, Marx MC, Morais AA, Moura LL and Magalhães MT: Acta Amaz. 2:531972.

34 

Silva ML, Luz AIR, Zoghbi MGB, Ramos LS and Maia JGS: Essential oil variation in Calyptranthes spruceana. Phytochem. 23:2515–2516. 1984. View Article : Google Scholar

35 

Maia JGS, Zoghbi MGB and Andrade EHA: Aromatic Plants in the Amazon and their Essential Oils. Emílio Goeldi Paraense Museum (Adolpho Ducke Series): Belém. 2001.(Portuguese).

36 

Nanthakumar NN, Fusunyan RD, Sanderson I and Walker WA: Inflammation in the developing human intestine: A possible pathophysiologic contribution to necrotizing enterocolitis. Proc Natl Acad Sci USA. 97:6043–6048. 2000. View Article : Google Scholar : PubMed/NCBI

37 

Strober W: Trypan blue exclusion test of cell viability. Curr Protoc Immunol. 2001. View Article : Google Scholar

38 

Yang J, Yang Q, Yu S and Zhang X: Evaluation and validation of suitable reference genes for reverse transcription-quantitative polymerase chain reaction studies in cholangiocarcinoma patients and cell lines. Oncol Lett. 11:2673–2681. 2016.PubMed/NCBI

39 

Piana C, Wirth M, Gerbes S, Viernstein H, Gabor F and Toegel S: Validation of reference genes for qPCR studies on Caco-2 cell differentiation. Eur J Pharm Biopharm. 69:1187–1192. 2008. View Article : Google Scholar : PubMed/NCBI

40 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

41 

Rozen S and Skaletsky H: Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 132:365–386. 2000.PubMed/NCBI

42 

Herath TD, Darveau RP, Seneviratne CJ, Wang CY, Wang Y and Jin L: Tetra- and penta-acylated lipid A structures of Porphyromonasgingivalis LPS differentially activate TLR4-mediated NF-κB signal transduction cascade and immuno-inflammatory response in human gingival fibroblasts. PLoS One. 8:e584962013. View Article : Google Scholar : PubMed/NCBI

43 

Ferreira LC, Grabe-guimarães A, de Paula CA, Michel MC, Guimarães RG, Rezende SA, de Souza Filho JD and Saúde-Guimarães DA: Anti-inflammatory and antinociceptive activities of Campomanesia adamantium. J Ethnopharmacol. 9:100–108. 2013. View Article : Google Scholar

44 

Li LJ, Yu LJ, Li YC, Liu MY and Wu ZZ: In vitro anti-inflammatory and free radical scavenging activities of flavans from Ilex centrochinensis. Zhongguo Zhong Yao Za Zhi. 40:1523–1528. 2015.(In Chinese). PubMed/NCBI

45 

Perkins ND: Integrating cell-signalling pathways with NF-kappaB and IKK function. Nat Rev Mol Cell Biol. 8:49–62. 2007. View Article : Google Scholar : PubMed/NCBI

46 

Foo SY and Nolan GP: NF-kappaB to the rescue: RELs, apoptosis and cellular transformation. Trends Genet. 15:229–235. 1999. View Article : Google Scholar : PubMed/NCBI

47 

Clément JF, Meloche S and Servant MJ: The IKK-related kinases: From innate immunity to oncogenesis. Cell Res. 18:889–899. 2008. View Article : Google Scholar : PubMed/NCBI

48 

Vallabhapurapu S and Karin M: Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol. 27:693–733. 2009. View Article : Google Scholar : PubMed/NCBI

49 

Pikarsky E, Porat RM, Stein I, Abramovitch R, Amit S, Kasem S, Gutkovich-Pyest E, Urieli-Shoval S, Galun E and Ben-Neriah Y: NF-kappaB functions as a tumour promoter in inflammation-associated cancer. Nature. 23:461–466. 2004. View Article : Google Scholar

50 

Wolska A, Lech-Maranda E and Robak T: Toll-like receptors and their role in hematologic malignancies. CurrMol Med. 9:324–335. 2009.

51 

Surh YJ: Cancer chemoprevention with dietary phytochemicals. Nat Rev Cancer. 3:768–780. 2003. View Article : Google Scholar : PubMed/NCBI

52 

Aggarwal BB and Shishodia S: Molecular targets of dietary agents for prevention and therapy of cancer. Biochem Pharmacol. 71:1397–1421. 2006. View Article : Google Scholar : PubMed/NCBI

53 

Hu MC, Wang YP, Mikhail A, Qiu WR and Tan TH: Murine p38-delta mitogen activated protein kinase, a developmentally regulated protein kinase that is activated by stress and proinflammatory cytokines. J BiolChem. 274:7095–7102. 1999.

54 

Enslen H, Raingeaud J and Davis RJ: Selective activation of p38 mitogen-activated protein (MAP) kinase isoforms by the MAP kinase kinases MKK3 and MKK6. J BiolChem. 273:1741–1748. 1998.

55 

Zarubin T and Han J: Activation and signaling of the p38 MAP kinase pathway. Cell Res. 15:11–18. 2005. View Article : Google Scholar : PubMed/NCBI

56 

Porras A and Guerrero C: Role of p38α in apoptosis: Implication in cancer development and therapy. Atlas Genet Cytogenet Oncol Haematol. 15:316–326. 2011.

57 

Campbell J, Ciesielski CJ, Hunt AE, Horwood NJ, Beech JT, Hayes LA, Denys A, Feldmann M, Brennan FM and Foxwell BM: A novel mechanism for TNF-α regulation by p38 MAPK: Involvement of NF-kappaB with implications for therapy in rheumatoid arthritis. J Immunol. 173:6928–6937. 2004. View Article : Google Scholar : PubMed/NCBI

58 

Héron-Milhavet L and Leroith D: Insulin-like growth factor I induces MDM2-dependent degradation of p53 via the p38 MAPK pathway in response to DNA damage. J BiolChem. 3:15600–15606. 2002.

59 

Okamoto S, Krainc D, Sherman K and Lipton SA: Antiapoptotic role of the p38 mitogen-activated protein kinase-myocyte enhancer factor 2 transcription factor pathway during neuronal differentiation. Proc Natl AcadSci USA. 20:7561–7566. 2000. View Article : Google Scholar

60 

Park JM, Greten FR, Li ZW and Karin M: Macrophage apoptosis by anthrax lethal factor through p38 MAP kinase inhibition. Science. 20:2048–2051. 2002. View Article : Google Scholar

61 

Zhang X, Shan P, Alam J, Davis RJ, Flavell RA and Lee PJ: Carbon monoxide modulates Fas/Fas ligand, caspases, and Bcl-2 family proteins via the p38alpha mitogen-activated protein kinase pathway during ischemia-reperfusion lung injury. J BiolChem. 13:22061–22070. 2003.

62 

Comes F, Matrone A, Lastella P, Nico B, Susca FC, Bagnulo R, Ingravallo G, Modica S, Lo Sasso G, Moschetta A, et al: A novel cell type-specific role of p38alpha in the control of autophagy and cell death in colorectal cancer cells. Cell Death Differ. 14:693–702. 2007. View Article : Google Scholar : PubMed/NCBI

63 

Schewe DM and Aguirre-Ghiso JA: ATF6alpha-Rheb-mTOR signaling promotes survival of dormant tumor cells in vivo. Proc Natl Acad Sci USA. 29:10519–10524. 2008. View Article : Google Scholar

64 

Geran RI, Greenberg NH, McDonald MM, Schumacher AM and Abott BJ: Protocols for screening chemical agents and natural products against animal tumour and other biological systems. Cancer Chemother Rep. 3:17–19. 1972.

65 

Suffness M and Pezzuto JM: Assays related to cancer drug discovery. In: Hostettmann K (ed), Methods in Plant Biochemistry. Assays for Bioactivity. 6:71–133. 1990.

66 

Mensor LL, Menezes FS, Leitão GG, Reis AS, Santos TC, Coube CS and Leitão SG: Screening of Brazilian plant extracts for antioxidant activity by the use of DPPH free radical method. Phytother Res. 15:127–130. 2001. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

May-2017
Volume 15 Issue 5

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Dexheimer GM, Becker Delving LK, de Oliveira HS, Biolchi V, Goettert MI and Pozzobon A: Calyptranthes grandifolia O.Berg (Myrtaceae) ethanolic extract inhibits TNF-α gene expression and cytokine release in vitro. Mol Med Rep 15: 2873-2880, 2017.
APA
Dexheimer, G.M., Becker Delving, L.K., de Oliveira, H.S., Biolchi, V., Goettert, M.I., & Pozzobon, A. (2017). Calyptranthes grandifolia O.Berg (Myrtaceae) ethanolic extract inhibits TNF-α gene expression and cytokine release in vitro. Molecular Medicine Reports, 15, 2873-2880. https://doi.org/10.3892/mmr.2017.6319
MLA
Dexheimer, G. M., Becker Delving, L. K., de Oliveira, H. S., Biolchi, V., Goettert, M. I., Pozzobon, A."Calyptranthes grandifolia O.Berg (Myrtaceae) ethanolic extract inhibits TNF-α gene expression and cytokine release in vitro". Molecular Medicine Reports 15.5 (2017): 2873-2880.
Chicago
Dexheimer, G. M., Becker Delving, L. K., de Oliveira, H. S., Biolchi, V., Goettert, M. I., Pozzobon, A."Calyptranthes grandifolia O.Berg (Myrtaceae) ethanolic extract inhibits TNF-α gene expression and cytokine release in vitro". Molecular Medicine Reports 15, no. 5 (2017): 2873-2880. https://doi.org/10.3892/mmr.2017.6319