Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
July-2017 Volume 16 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2017 Volume 16 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Effects of maternal acrolein exposure during pregnancy on testicular testosterone production in fetal rats

  • Authors:
    • Yuzhuo Yang
    • Zhe Zhang
    • Hongliang Zhang
    • Kai Hong
    • Wenhao Tang
    • Lianming Zhao
    • Haocheng Lin
    • Defeng Liu
    • Jiaming Mao
    • Han Wu
    • Hui Jiang
  • View Affiliations / Copyright

    Affiliations: Department of Urology, Peking University Third Hospital, Beijing 100191, P.R. China, Reproductive Medicine Center, Peking University Third Hospital, Beijing 100191, P.R. China
    Copyright: © Yang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 491-498
    |
    Published online on: May 25, 2017
       https://doi.org/10.3892/mmr.2017.6624
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Acrolein has been reported to have diverse toxic effects on various organs, including the reproductive system. However, little is known regarding the effects of maternal acrolein exposure on testicular steroidogenesis in male offspring. The present study investigated the effects of acrolein on fetal testosterone production and associated genes. Pregnant Sprague‑Dawley rats were intraperitoneally injected with vehicle (normal saline) or 1, 2 or 5 mg/kg acrolein from gestational day (GD) 14‑20, and fetal testes were examined on GD 21. Fetal body and testicular weights were markedly reduced in pups following exposure to high doses of acrolein (5 mg/kg) in late pregnancy. Notably, in utero exposure of 5 mg/kg acrolein significantly decreased the testicular testosterone level and downregulated the expression levels of steroidogenic acute regulatory protein (StAR) and 3β‑hydroxysteroid dehydrogenase (3β‑HSD), whereas the levels of other steroidogenic enzymes, including scavenger receptor class B, cholesterol side‑chain cleavage enzyme and steroid 17 alpha‑hydroxylase/17,20 lyase, were unaffected. Furthermore, the 3β‑HSD immunoreactive area in the interstitial region of the fetal testes was reduced at a 5 mg/kg dose, whereas the protein expression levels of 4‑hydroxynonenalwere dose‑dependently increased following maternal exposure to acrolein. mRNA expression levels of insulin‑like factor 3, a critical gene involved in testicular descent, were unaltered following maternal acrolein exposure. Taken together, the results of the present study suggested that maternal exposure to high doses of acrolein inhibited fetal testosterone synthesis, and abnormal expression of StAR and 3β‑HSD may be associated with impairment of the steroidogenic capacity.

Introduction

Cryptorchidism and hypospadias in newborn males, and infertility and testicular germ cell cancer in adult males, are common male reproductive system disorders worldwide (1,2). These disorders have been hypothesized to be associated with testicular dysgenesis syndrome (TDS), which originates in male fetal life (3). An important factor contributing to TDS is androgen dysfunction during the masculinization programming window. Masculinization is a pivotal event during reproductive tract development, driven by androgen produced by the fetal testes (4). Specific factors influencing this process, including exposure to certain environmental pollutants, may cause inadequate production of androgen, and ultimately lead to abnormal reproductive development (5–7).

Acrolein, a cyclophosphamide metabolite, is a common environmental and dietary pollutant arising from the combustion of fuels, plastic and fried food, and is additionally a primary component of tobacco (8). Acrolein may be generated endogenously during cellular metabolism by lipid peroxidation and degradation of threonine and polyamines. It has been identified as one of the most harmful non-biological air pollutants in residences in the United States (9,10). Increased acrolein exposure has been reported to be associated with various diseases, including diabetes mellitus, hepatotoxicity, cardiovascular disease and Alzheimer's disease (11–13).

Acrolein has been demonstrated to induce embryo lethality and teratogenicity in cultured rat embryos, and causes reproductive toxicity in a yeast gametogenesis model (14,15). Cyclophosphamide (CP), the precursor of acrolein, is used as a therapeutic agent for the treatment of childhood cancers; however, it may be associated with a high risk of infertility and long-term gonadal toxicity in male survivors (16). Additionally, cytochrome P450 3A 4 and 5, the two key enzymes that metabolize CP into acrolein, are highly expressed in mammalian testes, which may lead to an increased concentration of acrolein in the testes of patients treated with CP (17,18). As acrolein efficiently reaches the testes, it may interfere with steroidogenesis during fetal development, when testosterone production by Leydig cells is critical for normal sexual development. However, little is known regarding the effects of acrolein exposure in maternal rats on the steroidogenic function and sexual development of male offspring. The present study aimed to investigate the dose-dependent effects of acrolein on prenatal testosterone production, and the expression levels of the factors involved in testosterone biosynthesis in the fetal rat testes.

Materials and methods

Ethical approval

The present study was performed in compliance with the regulations of the Medical Ethics Committee of Peking University Third Hospital (Beijing, China; ethical approval no. LA2015205).

Chemicals and reagents

Acrolein (10 mg/ml; CAS107-02-8) was purchased from AccuStandard, Inc. (New Haven, CT, USA). Anti-3β-hydroxysteroid dehydrogenase (3β-HSD; catalog no. ab150384), anti-steroidogenic acute regulatory protein (StAR; catalog no. ab203193), anti-4-hydroxynonenal (4-HNE; catalog no. ab46545) and anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH; catalog no. ab181602) rabbit primary antibodies were obtained from Abcam (Cambridge, MA, USA). All other reagents were purchased from Sigma-Aldrich; Merck Millipore (Darmstadt, Germany) or as otherwise specified.

Animals and treatments

Pregnant Sprague-Dawley rats (n=32, with n=8 used for preliminary studies and 24 for formal studies; Vital River Laboratories, Co., Ltd., Beijing, China) were individually housed and maintained under a 12-h light/dark cycle at a controlled temperature (20–25°C) and humidity (50±5%) for one week prior to the experiments. The study was performed according to the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health (Bethesda, MD, USA). Acrolein was administered intraperitoneally (i.p.), in accordance with previous studies of maternal exposure (19). Our preliminary study revealed that rats died 4 days following injection of 10 mg/kg acrolein, and as testosterone levels in the fetal testes decreased significantly in the 5 mg/kg group, a dose of 5 mg/kg was used in the present study. A total of 24 pregnant rats at gestational days (GD) 14–20 were divided into four groups (n=6) and injected i.p. with 1, 2 or 5 mg/kg acrolein, with an equal volume of saline serving as the control according to previous studies (20,21). Pregnant rats were anesthetized with an i.p. injection of 50 mg/kg sodium pentobarbital (Sinopharm Chemical Reagent, Co., Ltd., Beijing, China) at GD 21. The fetal rats were harvested by cesarean section, weighed and dissected under a stereomicroscope. Gender was determined by morphology and the gonads. All male fetuses were sacrificed by decapitation and whole blood was collected in a tube with heparin for testosterone analysis. Fetal testes were aseptically removed and stored at −80°C for analysis of testosterone levels, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and histology.

RT-qPCR

Total RNA was extracted using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The quantity and quality of the purified RNA was evaluated by spectroscopy. cDNA was synthesized using a RevertAid First Strand cDNA Synthesis Kit (catalog no. K1621; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. qPCR was performed using the SYBR® Green Master mix (Fermentas; Thermo Fisher Scientific, Inc.) and the Applied Biosystems 7500 Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The cycling conditions were as follows: 1 cycle at 95°C for 5 min, and 40 cycles of amplification at 95°C for 15 sec and 60°C for 1 min. All the samples were run in duplicate using the threshold suggested by the software for the instrument to calculate the quantitation cycle (Cq). Following RT-qPCR, a melting curve analysis was performed to demonstrate the specificity of the PCR products, which revealed that the melting curve for the PCR product of each gene transcript had a single peak (data not shown). To normalize the readings, Cq values from GAPDH served as internal controls for each run, obtaining a ΔCq value for each gene. Relative alterations in the gene expression data were analyzed using the 2−ΔΔCq method (22). Primer sequences are presented in Table I.

Table I.

Sequences of the specific oligonucleotide primers used for polymerase chain reaction amplification.

Table I.

Sequences of the specific oligonucleotide primers used for polymerase chain reaction amplification.

Target geneGenbank no.Product length (bp)Primer sequence (5′-3′)
Scavenger receptor class BNM_031541134 F:ctcctgactttctccgtctttc
R:caggatctggaactgcttgt
Steroidogenic acute regulatory proteinNM_031558125 F:tcaactggaagcaacactctac
R:cctgctggctttccttctt
Cytochrome P-450 side chain cleavageNM_017286156 F:ctggtgacaatggttggataaac
R:ccttagggtccaggatgtaaac
3β-hydroxysteroid dehydrogenaseM38178141 F:tgttggtgcaggagaaagaa
R:ggtactgggcatccagaatatc
Cytochrome P-450, family 17NM_012753170 F:gcctttgcagatgctggta
R:ggcgtggacaggtctat
17β-hydroxysteroid dehydrogenaseNM_012851180 F:aggctttaccagggtctttc
R:cagtggtcctctcaatctcttc
Insulin-like factor 3NM_053680130 F:gcacccagcaagaccttt
R:tagggatcctccaaggcaat
GAPDHNM_017008155 F:actcccattcttccacctttg
R:gtccagggtttcttactccttg

[i] F, forward; R, reverse.

Western blot analysis

Fetal testes were washed twice with ice-cold phosphate buffered saline (PBS) and homogenized with RIPA lysis buffer containing protease inhibitors (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China). The protein concentration was quantified using the Bicinchoninic Acid Protein assay kit (Beijing CoWin Biotech, Co., Ltd., Beijing, China). Proteins (30 µg) in lysates were separated by 10% SDS-PAGE, transferred to nitrocellulose membranes (Applygen Technologies, Inc., Beijing, China), and blocked with 5% bovine serum albumin (BSA; Sigma-Aldrich; Merck Millipore) at room temperature for 1 h. Membranes were subsequently incubated at 4°C overnight with the following rabbit primary antibodies, all at a 1:1,000 dilution: Anti-StAR, anti-4-HNE or anti-GAPDH, following which corresponding IRDye-conjugated goat anti-rabbit IgG secondary fluorescent antibodies (cat. no. 925-32211; 1:10,000 dilution; LI-COR Biosciences, Lincoln, NE, USA) were added and incubated for 1 h at room temperature in a dark place. Membranes were scanned using the Odyssey® CLx Imaging system (LI-COR Biosciences) and the protein expression was quantified using Image Studio™ Software (LI-COR Biosciences).

Radioimmunoassay (RIA) for testosterone analysis

Serum was separated from blood collected from male offspring by centrifugation at 3000 × g for 10 min at room temperature and stored at −80°C until required for the testosterone assay. Fetal testes were rinsed with 0.01 M PBS and homogenized in 150 µl 0.01 M PBS. The homogenate was centrifuged for 10 min at 5000 × g at 4°C, and the supernatant was collected and stored at −80°C until required. 125I-based RIA kits were purchased from the Beijing North Institute of Biological Technology (Beijing, China). Testosterone levels were measured according to the manufacturer's protocol, and expressed as ng/ml.

Histopathology and immunohistochemistry

The testes were immersed in 4% paraformaldehyde for fixation, dehydrated via a graded series of ethanol washes followed by xylene, and embedded in paraffin. Paraffin-embedded tissues were serially sectioned (5-µm thick), mounted onto glass slides coated with poly-L-lysine, deparaffinized with xylene and rehydrated with graded ethanol. At least two non-serial sections were stained with hematoxylin and eosin (H&E) using standard procedures for morphological analyses. For histological evaluation of apoptosis, DNA fragmentation was examined using the Terminal Deoxynucleotidyl Transferase dUTP Nick-End Labeling assay (TUNEL) Detection kit (cat. no. 11684817910; Roche Diagnostics, Basel, Switzerland) according to the manufacturer's protocol. Slides were incubated with 20 µg/ml proteinase K for 15 min at room temperature and washed with PBS three times. The slides were subsequently incubated with TUNEL reaction buffer for 60 min at 37°C in a humidified atmosphere in the dark. Following a further wash with PBS, the slides were incubated with an anti-converter-peroxidase secondary antibody, which was part of the TUNEL kit (Roche Diagnostics) for 30 min at 37°C, and the signal was visualized with diaminobenzidine (DAB; OriGene Technologies, Inc., Beijing, China). The number of positive cells was calculated for analysis under a light microscope.

Testicular Leydig cells were identified in 5-µm thick paraffin sections by immunohistochemistry for 3β-HSD. Antigen retrieval was performed by microwave oven heating for 5 min in 0.01 M citrate buffer (pH 6.0). The slides were incubated for 10 min in 3% (v/v) hydrogen peroxide in PBS to block endogenous peroxidase activity and subsequently washed with PBS. Following blocking with normal goat serum (Beijing Zhongshan Golden Bridge Biotechnology; OriGene Technologies, Inc., Rockville, MD, USA) diluted 1:5 in PBS containing 5% BSA, the slides were incubated overnight at 4°C with a rabbit polyclonal anti-3β-HSD antibody (diluted 1:100 in antibody dilutions liquid (cat. no. ZLI-9028; Beijing Zhongshan Golden Bridge Biotechnology; OriGene Technologies, Inc.). Following this, the slides were washed with PBS and incubated with the horseradish peroxidase-conjugated goat anti-rabbit IgG secondary antibody (provided at working dilution; cat. no. PV-6001; Beijing Zhongshan Golden Bridge Biotechnology; OriGene Technologies, Inc.) at 37°C for 30 min. The slides were subsequently stained using a DAB kit, washed with water, then stained with hematoxylin, dehydrated using sequential concentrations ethanol, being washed for 2 min in each starting with 80%, followed by 95% and finishing with 100% ethanol twice, and placed under cover slips. The density of 3β-HSD-immunoreactivity was detected as described previously (23). Briefly, photomicrographic digital images were obtained from 3β-HSD-immunostained sections of the fetal testes, and regions of these photomicrographs were analyzed to measure the density of 3β-HSD immunoreactivity in the interstitial region of the testes. The surface area of the total interstitial region and the 3β-HSD-immunoreactive area were subsequently measured using ImageJ software version 1.46 (National Institute of Health). Areas darker than 100 of 256 pixels were determined to be 3β-HSD-immunoreactive. The positive 3β-HSD-immunoreactive area was normalized by dividing by the total area of the interstitial region of interest, and was expressed as the 3β-HSD-immunoreactive area/1-mm2 area of the interstitial region of the fetal testes.

Statistical analysis

Statistical analysis was performed using SPSS software version 12.0 (SPSS, Inc., Chicago, IL, USA). The data were examined for normal distribution and homogeneity of variance. Normally distributed and variance homogeneous data were analyzed by one-way analysis of variance. Dunnett's post hoc test was used to compare the values from acrolein-treated animals with the control group. Data are presented as the mean ± standard deviation. P<0.05 was considered to indicate a statistically significant difference.

Results

Effects of maternal acrolein exposure on pregnant rats and fetus development

To investigate the effects of maternal acrolein exposure during pregnancy on maternal weight gain and fetus development, pregnant rats were injected i.p. with 0, 1, 2 or 5 mg/kg acrolein daily from GD 14–20. No significant differences in body weight gain in the pregnant rats were observed between the acrolein-treated and control groups (Fig. 1A). Although no significant differences were observed in the male-to-female sex ratio (Fig. 1B), the weight of the pups was markedly reduced when pregnant rats received acrolein at 5 mg/kg compared with the control (P=0.003, Fig. 1C). However, no significant effect on fetal weight was observed in groups administered with 1 or 2 mg/kg acrolein. In addition, the weight of the fetal testes in the group treated with 5 mg/kg acrolein was reduced compared with the control group (P=0.001), while no significant alterations were observed in the other groups (Fig. 1D).

Figure 1.

Effects of maternal acrolein exposure on offspring sex and male fetuses. (A) Maternal weight gain, (B) male to female ratio of offspring, and the (C) body and (D) testicular weight of male fetuses. Data are presented as the mean ± standard deviation (n=32–39).*P<0.01 vs. 0 mg/kg acrolein. n.s., non-significant.

Effects of maternal acrolein exposure on testosterone production in fetal rats

The effects of maternal acrolein exposure during pregnancy on testosterone production in the serum and testes were analyzed. As presented in Fig. 2A, no significant effects of acrolein on serum testosterone were observed in fetal rats. However, compared with the control, the intratesticular testosterone concentration was markedly reduced following treatment with 5 mg/kg acrolein (P<0.001, Fig. 2B). Although testosterone in the groups treated with 1 and 2 mg/kg acrolein decreased compared with the control group, no statistically significant differences were observed.

Figure 2.

Effects of maternal acrolein exposure on testosterone production. (A) Serum and (B) testicular testosterone concentration. Data are presented as the mean ± standard deviation (n=12–15). *P<0.01 vs. 0 mg/kg acrolein. n.s., non-significant.

Effects of maternal acrolein exposure on the expression levels of steroidogenic genes and insulin-like factor 3 (Insl3)

A panel of genetic markers associated with testosterone production was used to assess the steroidogenic function in the fetal testes following prenatal exposure to acrolein. No significant differences were observed in the mRNA expression levels of the scavenger receptor class B member 1 (SR-B1; Fig. 3A). However, there was a slight increase in 17β-HSD mRNA expression levels in the 1 mg/kg group (P=0.032, Fig. 3B). No significant differences in mRNA expression levels were observed in the other steroidogenic enzymes assessed, cholesterol side-chain cleavage enzyme (P450scc; Fig. 3C) and steroid 17 alpha-hydroxylase/17,20 lyase (P450c17; Fig. 3D). The mRNA expression levels of 3β-HSD were only reduced in the 5 mg/kg group (P=0.020, Fig. 3E). These alterations were consistent with reduced intratesticular testosterone levels. No significant alterations in the mRNA expression levels of Insl-3, a critical gene involved in testicular descent, were observed in any of the groups treated with acrolein, compared with the control group (Fig. 3F). The mRNA expression levels of the cholesterol transporter StAR in fetal testes were reduced following exposure to 2 and 5 mg/kg acrolein (P=0.009 and P=0.038, respectively), compared with the control group, while no significant differences were observed in the 1 mg/kg group (Fig. 3G). Alterations in protein expression levels of StAR were in accordance with mRNA expression levels (Fig. 3H).

Figure 3.

Gene expression analysis. Reverse transcription-quantitative polymerase chain reaction analysis of the expression of (A) SR-B1, (B) 17β HSD, (C) P450scc, (D) P450c17, (E) 3β HSD, (F) Ins13 and (G) StAR. (H) Representative western blot images and analysis of StAR protein expression levels in fetal testes following maternal acrolein exposure. Data are presented as the mean ± standard deviation (n=6–8). #P<0.05 and *P<0.01 vs. 0 mg/kg acrolein. SR-B1, scavenger receptor class B;StAR, steroidogenic acute regulatory protein; P450scc, cholesterol side-chain cleavage enzyme; P450c17, steroid 17 alpha-hydroxylase/17,20 lyase; HSD, hydroxysteroid dehydrogenase; Ins13, insulin-like factor 13; n.s., non-significant.

Effects of maternal acrolein exposure on fetal testes histopathology

The effects of maternal acrolein exposure during pregnancy on fetal testes histology were determined by H&E staining. As presented in Fig. 4, no abnormal morphology was observed in the fetal testes of the acrolein-treated rats compared with the control group. The distribution of Leydig cells was identified by immunohistochemical staining for the Leydig cell type-specific marker, 3β-HSD (Fig. 5A-D). The 3β-HSD immunoreactive area in the interstitial region of the fetal testes was reduced following exposure to 5 mg/kg acrolein during pregnancy (P=0.004), whereas the immunoreactive areas in the 1 and 2 mg/kg groups were unaltered compared with controls (Fig. 5E). ATUNEL assay revealed that there were no significant differences in cell death in fetal testes between the acrolein exposure and control groups (data not shown). The protein expression levels of 4-HNE, an indicator of oxidative stress, were subsequently examined in fetal testes. As presented in Fig. 5F, the protein expression levels of 4-HNE increased following fetal exposure to acrolein in a dose-dependent manner (P<0.001).

Figure 4.

Effects of maternal acrolein exposure on testicular histology. Representative hematoxylin and eosin stained sections from fetal testes following exposure to (A) 0, (B) 1, (C) 2 and (D) 5 mg/kg acrolein. Scale bar=100 µm.

Figure 5.

Effects of maternal acrolein exposure on 3β-HSD immunoreactivity in the interstitial region and the protein expression levels of 4-HNE in fetal testes. Representative images of 3β-HSD stained sections from fetal testes following exposure to (A) 0, (B) 1, (C) 2 and (D) 5 mg/kg acrolein. Scale bar=100 µm. Arrows indicate 3β-HSD-positive staining. (E) Quantification of the 3β-HSD immunoreactive area in each group. (F) Representative western blot images and analysis of the protein expression levels of 4-HNE in fetal testes following maternal exposure to acrolein. Data are presented as the mean ± standard deviation (n=6–8). *P<0.01 vs. 0 mg/kg acrolein. 3β-HSD, 3β-hydroxysteroid dehydrogenase; 4-HNE, 4-hydroxynonenal.

Discussion

Acrolein has been reported to have diverse toxic effects in numerous organs, including the reproductive system (11). Various studies have demonstrated that acrolein exposure impairs male germ cells, sertoli cells and spermatogenesis (14,24,25). In the present study, the dose-associated effects of acrolein exposure during pregnancy on fetal testosterone production and gene expression were investigated. The results demonstrated that the weight of pups and fetal testes were significantly decreased when prenatally exposed to high doses of acrolein (5 mg/kg). Furthermore, maternal acrolein exposure during pregnancy resulted in a reduction of intratesticular testosterone production and the expression of steroidogenic genes, including StAR and 3β-HSD, and impaired function of Leydig cells. These results indicated that high doses of acrolein exposure in utero impair steroidogenic capacity during the fetal period.

Testosterone is primarily synthesized by testicular Leydig cells. Fetal Leydig cells are a distinct population that exhibit a specific origin, structure and capacity for testosterone production, and are regulated by hormones and growth factors (26,27). Leydig cells begin to appear in the interstitial tissue of the developing testes following the formation of testicular cords, reach peak numbers around birth and gradually disappear following postnatal day 7 (28). Previous studies have demonstrated that various environmental toxicants, including phthalate and perfluorooctane sulfonate, may cause impairment of rat fetal Leydig cells and reduction of testosterone production (29,30). Although no direct evidence has indicated that acrolein impairs steroidogenic capacity, males treated with high doses of CP, the precursor of acrolein, for sarcoma during childhood had abnormally elevated gonadotrophin-releasing hormone-stimulated luteinizing hormone levels, suggesting a degree of Leydig cell insufficiency (16). In the present study, a high dose of acrolein (5 mg/kg) significantly decreased fetal testicular testosterone concentration following prenatal exposure, whereas fetal testosterone was unaffected following treatment with low doses of acrolein (1 and 2 mg/kg). Exposure to pollutants, including toluene, during pregnancy is associated with an abnormal 3β-HSD immunoreactive area in fetal testes (23); the present study additionally demonstrated that prenatal acrolein treatment had similar effects. Furthermore, high doses of acrolein exposure (5 mg/kg) during pregnancy were revealed to lead to weight reduction in the male fetus and fetal testes.

The synthesis of testosterone in Leydig cells requires a series of steroidogenic enzymes, including SR-B1, StAR, P450scc, 3β-HSD, P450c17 and 17β-HSD (31). The mechanisms underlying reduced fetal testosterone levels following exposure to acrolein were investigated by assessing the mRNA expression levels of these steroidogenic enzymes. SR-B1 is responsible for the transport of high-density lipoprotein (HDL) cholesteryl esters into the cell; the present study demonstrated that the expression levels of SR-B1 were unaffected following exposure to acrolein. StAR is important for the delivery of cholesterol from the outer to the inner mitochondrial membrane in fetal testes (32). In the present study, the mRNA and protein expression levels of this cholesterol transport molecule were markedly decreased following treatment with 2 and 5 mg/kg acrolein. Additionally, previous studies have demonstrated that acrolein impairs cholesterol transport by modification of apolipoprotein A-I and HDL, and that cholesterol is essential for testosterone biosynthesis (33). P450scc is involved in catalyzing the conversion of cholesterol to pregnenolone, which is subsequently transported to the smooth endoplasmic reticulum in the cytoplasm, where 3β-HSD converts it to progesterone, following conversion to testosterone by P450c17 and 17β-HSD (34). In the present study, the mRNA expression levels of 3β-HSD were reduced by exposure to 5 mg/kg acrolein, while the mRNA expression levels of P450scc, P450c17 and 17β-HSD were not significantly altered, with the exception of a slight increase in 17β-HSD in the 2 mg/kg group. These results suggested that high doses of acrolein exposure impairs the steroidogenic capacity in testosterone synthesis by reducing StAR and 3β-HSD expression levels in fetal testes, and that the inhibitory effect on steroidogenesis appears to result from selective alterations of gene expression.

Insl3 is another important factor secreted by fetal Leydig cells, and specifically binds to the leucine-rich repeat-containing G protein-coupled receptor 8 in the gubernaculums to induce scrotal descent of the testes (35). Therefore, interference with the expression of Insl3 may lead to cryptorchidism. The present data suggested that prenatal acrolein exposure does not affect the mRNA expression levels of Insl3. In addition, fetal testes were not histologically damaged following maternal acrolein exposure. Previous studies have demonstrated that acrolein impairs the sertoli cytoskeleton and induces germ cell apoptosis by induction of oxidative stress in vitro (24,25), and that it negatively regulates meiosis in a yeast gametogenesis model by inhibiting premeiotic DNA synthesis (14). The present results revealed that prenatal acrolein in vivo does not lead to an evident morphological alteration, which is consistent with a study that demonstrated that the mating pattern and fertility of rats were unaffected following acrolein treatment (36). Additionally, Kuwada et al (37) revealed that neonatal endocrine disruptors exposure decreases weight and steroidogenesis of juvenile testes, whereas spermatogenesis was restored during puberty. However, the effects of prenatal acrolein exposure on the function of sertoli and germ cells remain to be fully elucidated. Taken together, these studies indicated that maternal acrolein exposure during pregnancy does not cause a distinct pathological impairment in fetal testes, with the exception of reduced steroidogenic capacity at a dose of 5 mg/kg acrolein.

Exposure to environmental pollutants often generates excessive levels of reactive oxygen species (ROS) and induces oxidative stress responses in cells (38). ROS, including oxygen radicals, have been demonstrated to disrupt the balance of the endocrine system and inhibit testicular steroidogenesis (39,40). Acrolein, an unsaturatedα, β-aldehyde, reacts with and depletes cell antioxidants, including glutathione, and affects the cellular redox balance (25). 4-HNE is an aldehydic product of lipid peroxidation and has been considered an indicator of oxidative stress-induced cell death (41). Thus, the protein expression levels of 4-HNE in fetal testes were examined following maternal acrolein exposure. It was demonstrated that the protein expression levels of 4-HNE were increased in testes following fetal exposure to acrolein in a dose-dependent manner, indicating that acrolein-induced oxidative stress damage may be implicated in the etiology of fetal testicular pathological alterations.

In conclusion, the results of the present study indicated that prenatal exposure to high doses of acrolein significantly reduced fetal and testes weight and most notably, testicular testosterone production capacity. The abnormal expression of StAR and 3β-HSD, and oxidative stress damage, may contribute to the impairment of steroidogenesis. Consequently, these alterations may result in the maldevelopment of the testes and affect masculinization.

Acknowledgements

The present study was supported by the Peking University 985 Clinical Hospital Cooperation Program (grant no. B67463). The authors would like to thank all staff of the Key Laboratory of Assisted Reproduction (Peking University Third Hospital, Beijing, China) for their assistance.

References

1 

Skakkebaek NE, Rajpert-De Meyts E and Main KM: Testicular dysgenesis syndrome: An increasingly common developmental disorder with environmental aspects. Hum Reprod. 16:972–978. 2001. View Article : Google Scholar : PubMed/NCBI

2 

Schnack TH, Poulsen G, Myrup C, Wohlfahrt J and Melbye M: Familial coaggregation of cryptorchidism, hypospadias, and testicular germ cell cancer: A nationwide cohort study. J Natl Cancer Inst. 102:187–192. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Sharpe RM and Skakkebaek NE: Testicular dysgenesis syndrome: Mechanistic insights and potential new downstream effects. Fertil Steril. 89:(2 Suppl). e33–e38. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Macleod DJ, Sharpe RM, Welsh M, Fisken M, Scott HM, Hutchison GR, Drake AJ and van den Driesche S: Androgen action in the masculinization programming window and development of male reproductive organs. Int J Androl. 33:279–287. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Liu D, Shen L, Tao Y, Kuang Y, Cai L, Wang D, He M, Tong X, Zhou S, Sun J, et al: Alterations in gene expression during sexual differentiation in androgen receptor knockout mice induced by environmental endocrine disruptors. Int J Mol Med. 35:399–404. 2015.PubMed/NCBI

6 

Araki A, Mitsui T, Miyashita C, Nakajima T, Naito H, Ito S, Sasaki S, Cho K, Ikeno T, Nonomura K and Kishi R: Association between maternal exposure to di (2-ethylhexyl) phthalate and reproductive hormone levels in fetal blood: The Hokkaido study on environment and children's health. PLoS One. 9:e1090392014. View Article : Google Scholar : PubMed/NCBI

7 

Wilson VS, Lambright CR, Furr JR, Howdeshell KL and Gray Earl L Jr: The herbicide linuron reduces testosterone production from the fetal rat testis during both in utero and in vitro exposures. Toxicol Lett. 186:73–77. 2009. View Article : Google Scholar : PubMed/NCBI

8 

Stevens JF and Maier CS: Acrolein: Sources, metabolism, and biomolecular interactions relevant to human health and disease. Mol Nutr Food Res. 52:7–25. 2008. View Article : Google Scholar : PubMed/NCBI

9 

Cahill TM: Ambient acrolein concentrations in coastal, remote, and urban regions in California. Environ Sci Technol. 48:8507–8513. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Logue JM, Price PN, Sherman MH and Singer BC: A method to estimate the chronic health impact of air pollutants in U.S. residences. Environ Health Perspect. 120:216–222. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Moghe A, Ghare S, Lamoreau B, Mohammad M, Barve S, McClain C and Joshi-Barve S: Molecular mechanisms of acrolein toxicity: Relevance to human disease. Toxicol Sci. 143:242–255. 2015. View Article : Google Scholar : PubMed/NCBI

12 

DeJarnett N, Conklin DJ, Riggs DW, Myers JA, O'Toole TE, Hamzeh I, Wagner S, Chugh A, Ramos KS, Srivastava S, et al: Acrolein exposure is associated with increased cardiovascular disease risk. J Am Heart Assoc. 3:pii: e000934. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Lovell MA, Xie C and Markesbery WR: Acrolein is increased in Alzheimer's disease brain and is toxic to primary hippocampal cultures. Neurobiol Aging. 22:187–194. 2001. View Article : Google Scholar : PubMed/NCBI

14 

Golla U, Bandi G and Tomar RS: Molecular cytotoxicity mechanisms of allyl alcohol (acrolein) in budding yeast. Chem Res Toxicol. 28:1246–1264. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Slott VL and Hales BF: The embryolethality and teratogenicity of acrolein in cultured rat embryos. Teratology. 34:155–163. 1986. View Article : Google Scholar : PubMed/NCBI

16 

Kenney LB, Laufer MR, Grant FD, Grier H and Diller L: High risk of infertility and long term gonadal damage in males treated with high dose cyclophosphamide for sarcoma during childhood. Cancer. 91:613–621. 2001. View Article : Google Scholar : PubMed/NCBI

17 

Westlind A, Malmebo S, Johansson I, Otter C, Andersson TB, Ingelman-Sundberg M and Oscarson M: Cloning and tissue distribution of a novel human cytochrome p450 of the CYP3A subfamily, CYP3A43. Biochem Biophys Res Commun. 281:1349–1355. 2001. View Article : Google Scholar : PubMed/NCBI

18 

Ekhart C, Doodeman VD, Rodenhuis S, Smits PH, Beijnen JH and Huitema AD: Influence of polymorphisms of drug metabolizing enzymes (CYP2B6, CYP2C9, CYP2C19, CYP3A4, CYP3A5, GSTA1, GSTP1, ALDH1A1 and ALDH3A1) on the pharmacokinetics of cyclophosphamide and 4-hydroxycyclophosphamide. Pharmacogenet Genomics. 18:515–523. 2008. View Article : Google Scholar : PubMed/NCBI

19 

Ji YL, Wang H, Liu P, Zhao XF, Zhang Y, Wang Q, Zhang H, Zhang C, Duan ZH, Meng C and Xu DX: Effects of maternal cadmium exposure during late pregnant period on testicular steroidogenesis in male offspring. Toxicol Lett. 205:69–78. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Auerbach SS, Mahler J, Travlos GS and Irwin RD: A comparative 90-day toxicity study of allyl acetate, allyl alcohol and acrolein. Toxicology. 253:79–88. 2008. View Article : Google Scholar : PubMed/NCBI

21 

Rashedinia M, Lari P, Abnous K and Hosseinzadeh H: Proteomic analysis of rat cerebral cortex following subchronic acrolein toxicity. Toxicol Appl Pharmacol. 272:199–207. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

23 

Tsukahara S, Nakajima D, Kuroda Y, Hojo R, Kageyama S and Fujimaki H: Effects of maternal toluene exposure on testosterone levels in fetal rats. Toxicol Lett. 185:79–84. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Liu F, Li XL, Lin T, He DW, Wei GH, Liu JH and Li LS: The cyclophosphamide metabolite, acrolein, induces cytoskeletal changes and oxidative stress in Sertoli cells. Mol Biol Rep. 39:493–500. 2012. View Article : Google Scholar : PubMed/NCBI

25 

He X, Song W, Liu C, Chen S and Hua J: Rapamycin inhibits acrolein-induced apoptosis by alleviating ROS-driven mitochondrial dysfunction in male germ cells. Cell Prolif. 47:161–171. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Griswold SL and Behringer RR: Fetal Leydig cell origin and development. Sex Dev. 3:1–15. 2009. View Article : Google Scholar : PubMed/NCBI

27 

O'Shaughnessy PJ, Baker PJ and Johnston H: The foetal Leydig cell-differentiation, function and regulation. Int J Androl. 29:90–108. 2006. View Article : Google Scholar : PubMed/NCBI

28 

Habert R, Lejeune H and Saez JM: Origin, differentiation and regulation of fetal and adult Leydig cells. Mol Cell Endocrinol. 179:47–74. 2001. View Article : Google Scholar : PubMed/NCBI

29 

Zhao B, Li L, Liu J, Li H, Zhang C1, Han P, Zhang Y, Yuan X, Ge RS and Chu Y: Exposure to perfluorooctane sulfonate in utero reduces testosterone production in rat fetal Leydig cells. PLoS One. 9:e788882014. View Article : Google Scholar : PubMed/NCBI

30 

Lin H, Ge RS, Chen GR, Hu GX, Dong L, Lian QQ, Hardy DO, Sottas CM, Li XK and Hardy MP: Involvement of testicular growth factors in fetal Leydig cell aggregation after exposure to phthalate in utero. Proc Natl Acad Sci USA. 105:7218–7222. 2008. View Article : Google Scholar : PubMed/NCBI

31 

Payne AH and Hales DB: Overview of steroidogenic enzymes in the pathway from cholesterol to active steroid hormones. Endocr Rev. 25:947–970. 2004. View Article : Google Scholar : PubMed/NCBI

32 

Tyczewska M, Rucinski M, Ziolkowska A, Trejter M, Szyszka M and Malendowicz LK: Expression of selected genes involved in steroidogenesis in the course of enucleation-induced rat adrenal regeneration. Int J Mol Med. 33:613–623. 2014.PubMed/NCBI

33 

Chadwick AC, Holme RL, Chen Y, Thomas MJ, Sorci-Thomas MG, Silverstein RL, Pritchard KA Jr and Sahoo D: Acrolein impairs the cholesterol transport functions of high density lipoproteins. PLoS One. 10:e01231382015. View Article : Google Scholar : PubMed/NCBI

34 

Luu-The V: Assessment of steroidogenesis and steroidogenic enzyme functions. J Steroid Biochem Mol Biol. 137:176–182. 2013. View Article : Google Scholar : PubMed/NCBI

35 

Ivell R and Bathgate RA: Reproductive biology of the relaxin-like factor (RLF/INSL3). Biol Reprod. 67:699–705. 2002. View Article : Google Scholar : PubMed/NCBI

36 

Parent RA, Caravello HE and Hoberman AM: Reproductive study of acrolein on two generations of rats. Fundam Appl Toxicol. 19:228–237. 1992. View Article : Google Scholar : PubMed/NCBI

37 

Kuwada M, Kawashima R, Nakamura K, Kojima H, Hasumi H, Maki J and Sugano S: Neonatal exposure to endocrine disruptors suppresses juvenile testis weight and steroidogenesis but spermatogenesis is considerably restored during puberty. Biochem Biophys Res Commun. 295:193–197. 2002. View Article : Google Scholar : PubMed/NCBI

38 

Monroe RK and Halvorsen SW: Environmental toxicants inhibit neuronal Jak tyrosine kinase by mitochondrial disruption. Neurotoxicology. 30:589–598. 2009. View Article : Google Scholar : PubMed/NCBI

39 

Shi Z, Feng Y, Wang J, Zhang H, Ding L and Dai J: Perfluorododecanoic acid-induced steroidogenic inhibition is associated with steroidogenic acute regulatory protein and reactive oxygen species in cAMP-stimulated Leydig cells. Toxicol Sci. 114:285–294. 2010. View Article : Google Scholar : PubMed/NCBI

40 

Zhou L, Beattie MC, Lin CY, Liu J, Traore K, Papadopoulos V, Zirkin BR and Chen H: Oxidative stress and phthalate-induced down-regulation of steroidogenesis in MA-10 Leydig cells. Reprod Toxicol. 42:95–101. 2013. View Article : Google Scholar : PubMed/NCBI

41 

Ayala A, Muñoz MF and Argüelles S: Lipid peroxidation: Production, metabolism, and signaling mechanisms of malondialdehyde and 4-hydroxy-2-nonenal. Oxid Med Cell Longev. 2014:3604382014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yang Y, Zhang Z, Zhang H, Hong K, Tang W, Zhao L, Lin H, Liu D, Mao J, Wu H, Wu H, et al: Effects of maternal acrolein exposure during pregnancy on testicular testosterone production in fetal rats. Mol Med Rep 16: 491-498, 2017.
APA
Yang, Y., Zhang, Z., Zhang, H., Hong, K., Tang, W., Zhao, L. ... Jiang, H. (2017). Effects of maternal acrolein exposure during pregnancy on testicular testosterone production in fetal rats. Molecular Medicine Reports, 16, 491-498. https://doi.org/10.3892/mmr.2017.6624
MLA
Yang, Y., Zhang, Z., Zhang, H., Hong, K., Tang, W., Zhao, L., Lin, H., Liu, D., Mao, J., Wu, H., Jiang, H."Effects of maternal acrolein exposure during pregnancy on testicular testosterone production in fetal rats". Molecular Medicine Reports 16.1 (2017): 491-498.
Chicago
Yang, Y., Zhang, Z., Zhang, H., Hong, K., Tang, W., Zhao, L., Lin, H., Liu, D., Mao, J., Wu, H., Jiang, H."Effects of maternal acrolein exposure during pregnancy on testicular testosterone production in fetal rats". Molecular Medicine Reports 16, no. 1 (2017): 491-498. https://doi.org/10.3892/mmr.2017.6624
Copy and paste a formatted citation
x
Spandidos Publications style
Yang Y, Zhang Z, Zhang H, Hong K, Tang W, Zhao L, Lin H, Liu D, Mao J, Wu H, Wu H, et al: Effects of maternal acrolein exposure during pregnancy on testicular testosterone production in fetal rats. Mol Med Rep 16: 491-498, 2017.
APA
Yang, Y., Zhang, Z., Zhang, H., Hong, K., Tang, W., Zhao, L. ... Jiang, H. (2017). Effects of maternal acrolein exposure during pregnancy on testicular testosterone production in fetal rats. Molecular Medicine Reports, 16, 491-498. https://doi.org/10.3892/mmr.2017.6624
MLA
Yang, Y., Zhang, Z., Zhang, H., Hong, K., Tang, W., Zhao, L., Lin, H., Liu, D., Mao, J., Wu, H., Jiang, H."Effects of maternal acrolein exposure during pregnancy on testicular testosterone production in fetal rats". Molecular Medicine Reports 16.1 (2017): 491-498.
Chicago
Yang, Y., Zhang, Z., Zhang, H., Hong, K., Tang, W., Zhao, L., Lin, H., Liu, D., Mao, J., Wu, H., Jiang, H."Effects of maternal acrolein exposure during pregnancy on testicular testosterone production in fetal rats". Molecular Medicine Reports 16, no. 1 (2017): 491-498. https://doi.org/10.3892/mmr.2017.6624
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team