Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
September-2017 Volume 16 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2017 Volume 16 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Correlation between secreted protein acidic and rich in cysteine protein expression and the prognosis of postoperative patients exhibiting esophageal squamous cell carcinoma

  • Authors:
    • Jian Wu
    • Jin‑Rong Zhang
    • Xue‑Qiu Jiang
    • Xu‑Guang Cao
  • View Affiliations / Copyright

    Affiliations: Department of Laboratory Medicine, The First People's Hospital of Yancheng, Yancheng, Jiangsu 224005, P.R. China, Department of Laboratory Medicine, The People's Hospital of Dafeng, Yancheng, Jiangsu 224100, P.R. China
  • Pages: 3401-3406
    |
    Published online on: July 12, 2017
       https://doi.org/10.3892/mmr.2017.6959
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The aim of the present study was to investigate the association between the expression level of secreted protein acidic and rich in cysteine (SPARC) and the prognosis of postoperative patients with esophageal squamous cell carcinoma (ESCC). The expression level of SPARC was detected in the 89 ESCC tissue cases and 100 healthy esophageal mucosa cases, which served as the controls. Immunohistochemistry and reverse transcription‑polymerase chain reaction (RT‑PCR) were employed to evaluate the SPARC expression in cases with ESCC. RT‑PCR demonstrated that the positive rates of SPARC mRNA expression in ESCC were 71.91% (64/89). The positive rates of normal esophageal mucosa mRNA expression were 15.00% (15/100), which were significantly lower than that in the ESCC tissue samples. The difference was statistically significant (P<0.001). Immunohistochemical staining indicated that the positive expression rate of SPARC protein in the ESCC tissue samples was significantly higher than that in the esophageal mucosa tissue samples (65.17 vs. 8.00%; P<0.001). The expression of SPARC protein was negatively correlated with lymph node metastasis (P<0.05), which was not associated with the pathologic gross morphology, tumor differentiation degree or other clinical features. The survival of patients with ESCC was not associated with the expression level of SPARC protein (P>0.05), but was associated with the tumor location (P<0.05), differentiation (P<0.001) and staging (P<0.05). Thus, SPARC mRNA and protein were highly expressed in ESCC, and negatively correlated with lymph node metastasis, which was not associated with postoperative survival of ESCC patients. Thus, detection of SPARC mRNA and protein expression levels may facilitate early diagnosis and prognosis assessment of ESCC.

Introduction

Esophageal cancer is a common type of digestive tract cancer, and the province of Jiangsu is a high incidence area (1–3). Esophageal squamous cell carcinoma (ESCC), esophageal adenocarcinoma (EA) and small cell carcinoma of the esophagus are the most common pathological types of esophageal cancer. The high incidence of ESCC in China is significantly different from that of the European and American countries (4,5). Surgical resection is the first choice of treatment for patients with early esophageal cancer, but the majority of patients experience recurrence or metastasis following surgery; therefore, it is of great significance to investigate the relevant factors that affect the prognosis of postoperative survival (6–8).

Secreted protein acidic and rich in cysteine (SPARC) is a small protein rich in cysteine, which is also known as basement-membrane protein 40 (9–11). As a non structural matrix glycoprotein its function is very complex, and it is involved in many physiological and pathological processes (12,13). In addition, it is significant in the microenvironment of tumor cell activity and tumor growth (14). It was observed that the SPARC protein was highly expressed in the fibrous cells and endothelial cells associated with invasive malignant tumors. The expression level of SPARC was closely associated with the occurrence, development and prognosis of tumors (13,15,16).

To investigate the association between the expression of SPARC and the prognosis of postoperative patients with ESCC, immunohistochemistry and reverse transcription-polymerase chain reaction (RT-PCR) were employed to measure SPARC protein expression levels in cases with ESCC, and in healthy esophageal mucosa samples, which served as the control. In addition, the underlying mechanism of the formation of ESCC was evaluated in an attempt to establish a novel method for its early diagnosis.

Patients and methods

From January 2013 to January 2016, samples of ESCC were collected from 89 patients who underwent surgical resection at the First People's Hospital of Yancheng City (Yancheng, China) who had been diagnosed by clinical pathology. Each case had detailed clinical and pathological data and none had received preoperative chemotherapy or radiotherapy. The ESCC patients included 45 males and 44 females (aged 36–73 years; mean age, 53.9±11.6 years). A total of 100 cases with heathy esophageal mucosa were selected from the First People's Hospital of Yancheng City (Yancheng, China) and served as a control group. These included 55 males and 45 females (aged 35–69 years; mean age, 49.5±10.4 years).

No statistically significant differences were detected in age between the ESCC group and the healthy esophageal mucosa group. All specimens were obtained following receipt of informed consent with approval by the Ethics Committee of the First People's Hospital of Yancheng City (Yancheng, China) [ID no. HMU (Ethics) 20131103].

Immunohistochemical staining techniques

The immunohistochemical staining method from Agilent Technologies, Inc. (Santa Clara, CA, USA) was used to detect the distribution of SPARC. Immunohistochemical procedures were performed in strict accordance with the manufacturer's instructions. The EnVision and DAB chromogenic reagent kit (Agilent Technologies, Inc., Santa Clara, CA, USA) were used for immunohistochemical staining. All staining was performed under the same conditions; the tissue samples were sliced to a thickness of 2–3 µm, dehydrated in 80, 90, 95 and 100% ethanol, dewaxed and antigen repair was performed using 0.01 mol/l citric acid (pH 6.0). Normal goat serum (Toyobo Co., Ltd., Osaka, China) was dropped onto the slide and incubated for 10 min at room temperature. Subsequently, the corresponding specific antibody (mouse anti-osteonectin/SPARC; (1:1,000; catalog no. 5420; Cell Signaling Technologies Inc., Danvers, MA, USA) was added to the slide and incubated for 1.5 h at room temperature. The slides were washed with phosphate-buffered saline (PBS) for 3 min three times. The secondary antibody (1:1,000; catalog no. 341200; Cell Signaling Technologies Inc.) was added and incubated for 30 min at room temperature. The slide was stained with DAB, and the nucleus was stained with hematoxylin, dehydrated using a gradient of ethanol, cleared with xylene and sealed using natural gum. SPARC (mouse anti-osteonectin/SPARC; (1:1,000; catalog no. 5420; Cell Signaling Technologies Inc., Danvers, MA, USA) immunoreactivity in the blood vessel walls of ESCC tissues served as a positive control, and the specific antibodies were replaced with PBS to serve as the negative control.

The immunohistochemical results were determined by three pathologists, who observed the positive granule-stained cells in the esophageal cancer tissue samples and the adjacent healthy esophageal mucosa using a BH-2 light microscope (Olympus Corporation, Tokyo, Japcan). The staining score criteria were as follows: 0, 0–15%; 1, >15–30%; 2, >30–45%; 3, >45%. According to the staining intensity for semi-quantitative determination, colorless was 0 and 3 (strong staining) was brown. The final staining score of a sample was determined as the product of the positive cell percentage score and the staining intensity score. Staining score <2, negative (−); staining score 2–4 points, weakly positive (+); staining score, 4–6 points, positive (+ +); staining score ≥6 points, strong positive (+ + +). For the convenience of statistical analysis of the data, the (−) group was defined as the negative expression group (−), and the (+), (+ +) and (+ + +) groups were designated as the positive expression group (+).

Detecting the expression level of SPARC mRNA using RT-PCR

Total RNA was isolated from the tissue samples using TRIzol (Sangon Biotech Co., Ltd., Shanghai, China) and quantified using a Nandrop spectrophotometer. RNA (2 ug) was reverse transcribed to cDNA according to the Titanium® One-Step RT-PCR kit (Takara Biotechnology Co., Ltd., Dalian, China), and was amplified by semi-quantitative PCR with β-actin serving as the reference. The primer sequences (Sangon Biotech Co., Ltd.) are presented in Table I. The thermal cycling conditions were as follows: Predenaturation at 94°C for 4 min; 30 cycles of 94°C for 10 sec, 55°C for 30 sec and 72°C for 60 sec.

Table I.

Primer sequences for reverse transcription-polymerase chain reaction analysis.

Table I.

Primer sequences for reverse transcription-polymerase chain reaction analysis.

PrimerPrimer sensePrimer sequences 5′-3′Product size (bp)
Secreted protein acidic and rich in cysteineForward CTGCTGGCAGACAACAGGTA344
Reverse CTGTTTGCTGCTGTGGAAAA
β-actinForward TGACGTGGACATCCGCAAAG231
Reverse CTGGAAGGTGGACAGCGAGG

Amplification of SPARC by PCR was examined by agarose gel electrophoresis and analyzed using Quantity One version 3 software (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The absorbance value of the belt and the reference were read, and the results were expressed as a ratio (sample value/reference value). When the ratio of the ESCC value and reference value was greater than the β-actin reference value, it was expressed positively. Otherwise, it was considered to be negative.

Statistical analysis

SPSS 13.0 statistical software (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis. The χ2 test was performed to compare the distribution of SPARC expression levels between the healthy and ESCC tissue samples. Kaplan-Meier survival analysis with the log-rank test was performed to analyze the association between the protein expression levels in the cancer tissue samples, and multi factor survival stage and independent factor survival stage were used for the other clinicopathologic characteristics and the survival rate of the patients. The hazard ratios were determined using SPSS software version 13.0 (SPSS, Inc., Chicago, IL, USA) and the 95% confidence intervals (CI) were computed. P<0.05 was considered to indicate a statistically significant difference.

Results

Association between the expression level of SPARC and the overall survival of postoperative patients with ESCC

The overall survival of patients who were positive for the SPARC protein was 60.92±3.45 months, after a median follow-up time of 61.5 months (6.1–77.3 months). The overall survival of SPARC protein-negative patients was 55.68±5.65 months. Kaplan-Meier survival analysis indicated that there was no significant difference between SPARC-positive and SPARC-negative patients (P>0.05). Multi factor survival stage indicated that the tumor location (upper, middle and lower segment), tumor differentiation (high, moderate and poor) and tumor stage (I, II and III) were independent factors affecting the overall survival of the postoperative patients. Additionally, adjuvant therapy, gender, age, gross morphology, tumor invasion depth and lymph node metastasis were not identified as independent factors affecting the overall survival of postoperative patients (Fig. 1).

Figure 1.

Postoperative survival analysis of esophageal squamous cell carcinoma patients. CI, confidence interval.

SPARC mRNA expression in ESCC and healthy esophageal mucosa tissue samples

RT-PCR demonstrated the expression level of SPARC mRNA in ESCC and healthy esophageal mucosa tissue samples. The positive rate of SPARC mRNA in ESCC was 71.91% (64/89), which was significantly higher than that in the healthy esophageal mucosa 15.00% (15/100; P<0.05) (Fig. 2).

Figure 2.

Staining result of immunohistochemistry for SPARC in ESCC and healthy esophageal mucosa tissue samples (magnification, ×200). (A) Strongly positive staining of SPARC in the ESCC tissue samples. (B) Weakly positive and (C) negative staining of SPARC in healthy esophageal mucosa tissue samples. SPARC, secreted protein acidic and rich in cysteine; ESCC, esophageal squamous cell carcinoma.

Expression levels of SPARC protein in ESCC and healthy esophageal mucosa tissue samples

The positive expression rate of SPARC protein in ESCC was 65.17% (58/89) and the positive rate was 8% (8/100) in the normal esophageal mucosa. The expression level of SPARC protein in the ESCC tissue samples was significantly higher than that in the healthy esophageal mucosa samples (P<0.05; Fig. 3).

Figure 3.

Secreted protein acidic and rich in cysteine mRNA expression levels in the ESCC and healthy esophageal mucosa tissue samples. (A) Negative control group; (B) normal esophageal mucosa group; (C) ESCC samples without lymph node metastasis; (D) ESCC samples exhibiting lymph node metastasis. ESCC, esophageal squamous cell carcinoma.

Association between the expression levels of SPARC mRNA and protein in different pathological types of ESCC

The expression levels of SPARC mRNA and protein in ESCC were consistent. SPARC was highly expressed in ESCC tissue samples, and was not associated with sex, age, tumor size, pathologic type or the degree of tumor differentiation, but was associated with staging and metastasis (Table II).

Table II.

Correlation of SPARC mRNA and protein expression levels with clinicopathological features in osteosarcoma.

Table II.

Correlation of SPARC mRNA and protein expression levels with clinicopathological features in osteosarcoma.

CharacteristicnSPARC protein positive rate, n (%)χ2P-valueSPARC mRNA positive rate, n (%)χ2P-value
Gender
  Male4530 (66.7)0.1900.66333 (73.3)0.0080.927
  Female4428 (63.6) 31 (70.5)
Age (years)
  <404631 (67.4)0.1210.72834 (73.9)0.0050.945
  ≥404327 (62.8) 30 (70.0)
Tumor diameter (cm)
  ≥103523 (65.7)0.3510.55326 (74.3)0.0720.789
  <105435 (64.8) 38 (70.4)
Lymph node metastasis
  Yes3733 (89.2)7.6010.00635 (94.6)7.4110.008
  No5225 (48.1) 29 (55.8)
Pathologic type
  Ulcer5232 (61.54)0.3230.12537 (71.15)0.3320.119
  Medullary1913 (68.42) 14 (73.68)
  Mushroom11  8 (72.72)   8 (72.72)
  Coarctation  7  5 (71.43)   5 (71.43)
Degree of tumor differentiation
  High1911 (57.89)0.2340.51213 (68.42)0.2760.565
  Moderate4429 (65.91) 32 (72.73)
  Poor2618 (69.23) 19 (73.08)
Tumor stage
  I4333 (76.74)7.2310.00538 (88.37)7.0120.002
  II2816 (57.14) 16 (57.14)
  III18  9 (50.00) 10 (55.56)

A total of 89 cases of patients with ESCC (according to the pathological morphology) were divided into 52 cases of ulcer type, 19 cases of medullary type, mushroom type in 11 cases and 7 cases of coarctation. The positive expression rates of SPARC protein were as follows: Ulcer type, 61.54% (32/52); medullary type, 68.42% (13/19); mushroom type, 72.72% (8/11); and coarctation type, 71.43% (5/7). Although the results showed that the positive rate of mushroom type was highest, the difference was not statistically significant (P>0.05).

The positive expression rates of SPARC mRNA were as follows: Ulcer type, 71.15% (37/52); medullary type, 73.68% (14/19); mushroom type, 72.72% (8/11); and coarctation type, 71.43% (5/7). Although the results showed that the positive rate of mushroom type was highest, the difference was not statistically significant (P>0.05).

According to the degree of tumor differentiation, the 89 cases of ESCC were divided into 19 cases of high, 44 cases of moderate and 26 cases of poor differentiation. The positive expression rate of SPARC protein was not statistically significant between differentiated samples (P>0.05): High differentiation, 57.89% (11/19); moderate differentiation, 65.91% (29/44); and poor differentiation, 69.23% (18/26).

The positive expression rate of SPARC mRNA was not statistically significant (P>0.05): High differentiation, 68.42% (13/19); moderate differentiation, 72.73% (32/44); and poor differentiation, 73.08% (19/26).

Single factor analysis indicate that tumor stage and lymph node metastasis were negatively associate with SPARC protein and SPARC mRNA expression levels (P<0.05). The SPARC protein and SPARC mRNA expression levels were relatively large in patients with early stage of tumors and no lymph node metastasis. Multi-factor analysis indicated that only lymph node metastasis was negatively correlated with SPARC protein and SPARC mRNA expression levels (P<0.05).

Discussion

Recent studies have demonstrated the particularly complicated processes involved in the occurrence and development of tumors (17,18). It may be caused by the regulation of cell growth and proliferation (19). In addition, abnormal expression of tumor-associated genes and aberrant activation of cell signal transduction may also be involved (20–21). Cell growth and proliferation in the human body are affected and controlled by numerous factors (22,23). Notably, cell signaling proteins, growth factors and their receptors, apoptotic proteins and transcription factors, and the changes of these factors are closely associated with the occurrence and development of tumors (24).

Previous studies have reported high expression levels of SPARC protein in ESCC (25). Tumor cells that express SPARC in the nucleus are associated with a higher degree of malignancy (26). The present study demonstrated that the SPARC protein was localized in the tumor stroma, which is consistent with the high expression levels of the SPARC protein in fibroblasts and endothelial cells during tissue repair and in aggressive malignant tumors.

The SPARC protein is an important molecule in locally advanced esophageal carcinoma; however, its association with the clinical prognosis of esophageal cancer invasion remains unclear (27,28). The results of the present study indicated that SPARC protein expression in the tumor stroma aided the development of esophageal cancer. A study revealed that SPARC protein expression was not associated with tumor differentiation and the depth of invasion, but was positively correlated with lymph node metastasis, and is associated with poor prognosis (29). Porte et al (30) and other studies (31) revealed that the SPARC protein was not associated with tumor size, lymph node status, tumor adjacent tissue invasion, disease recurrence and overall survival. The current study demonstrated that SPARC protein expression in ESCC was not associated with the degree of differentiation and invasion depth, and was not linked to tumor location, gross morphology, sex and age. In contrast to other studies, the current study identified that the SPARC protein was associated with lymph node metastasis and tumor stage in patients with ESCC, but it was negatively correlated. Expression of the SPARC protein in early stage ESCC is highly expressed, and is not associated with lymph node metastasis. This inconsistent result reflects the heterogeneity of patients with ESCC and reveals the complex role of the SPARC protein in the development of ESCC.

Studies have identified that the high expression level of SPARC protein in melanoma and prostate cancer promotes tumor growth and metastasis (32). However, the SPARC protein may act as an antitumor factor in pancreatic and colorectal cancer, resulting in anti-angiogenesis, apoptosis, inhibition of cell proliferation and cell cycle arrest, thus inhibiting tumor growth (33). In the present study, SPARC protein expression in patients with ESCC was associated with the survival prognosis, and the clinical features of the tumor were significantly associated with survival, differentiation and staging.

A limitation of the current study was the relatively small sample size. However, this is one of the larger studies addressing SPARC protein expression in ESCC. The results of the current study demonstrated that the expression levels of SPARC in ESCC tissue samples were significantly higher than those in healthy esophageal mucosa tissue samples, which may indicate the association between the occurrence and development of tumors, and the high expression of SPARC.

In conclusion, the results indicate the potential role of SPARC in the progression of ESCC. Further research on SPARC is required to aid the development of novel therapeutic strategies for ESCC.

Acknowledgements

The present study was supported by the Jiangsu Pharmaceutical Association (grant no. 201542) and the Science and Technology commission of Yancheng City (grant no. YK2015002) and the Youth Medical Talent of Jiangsu Province (grant no. QNRC2016475).

References

1 

Tustumi F, Takeda FR, Kimura CM, Sallum RA, Ribeiro U Junior and Cecconello I: Esophageal carcinoma: Is squamous cell carcinoma different disease compared to adenocarcinoma? A transversal study in a quaternary high volume hospital in Brazil. Arq Gastroenterol. 53:44–48. 2016. View Article : Google Scholar : PubMed/NCBI

2 

Zhu YM, Zhang H, Ni S, Wang J, Li DZ and Liu SY: Multi-disciplinary treatment increases the survival rate of late stage pharyngeal, laryngeal or cervical esophageal cancers treated by free jejunal flap reconstruction after cancer resection. Zhonghua Zhong Liu Za Zhi. 38:389–394. 2016.(In Chinese). PubMed/NCBI

3 

Huang XE, Wang L, Ji ZQ, Liu MY, Qian T and Li L: Safety of lienal polypeptide injection combined with chemotherapy in treating patients with advanced cancer. Asian Pac J Cancer Prev. 16:7837–7841. 2015. View Article : Google Scholar : PubMed/NCBI

4 

Jia X, Liu P, Zhang M, Feng T, Tang H, Tang Z, Zhao H and Jin T: Genetic variants at 6p21, 10q23, 16q21 and 22q12 are associated with esophageal cancer risk in a Chinese Han population. Int J Clin Exp Med. 8:19381–19387. 2015.PubMed/NCBI

5 

Zhang J, Jiang Y, Wu C, Cai S, Wang R, Zhen Y, Chen S, Zhao K, Huang Y, Luketich J and Chen H: Comparison of clinicopathologic features and survival between eastern and western population with esophageal squamous cell carcinoma. J Thorac Dis. 7:1780–1786. 2015.PubMed/NCBI

6 

Nakamura R, Omori T, Takeuchi H, Kawakubo H, Takahashi T, Wada N, Saikawa Y and Kitagawa Y: Salvage endoscopic resection as a treatment for locoregional failure or recurrence following chemoradiotherapy or radiotherapy for esophageal cancer. Oncol Lett. 11:3631–3636. 2016.PubMed/NCBI

7 

Gamboa AM, Kim S, Force SD, Staley CA, Woods KE, Kooby DA, Maithel SK, Luke JA, Shaffer KM, Dacha S, et al: Treatment allocation in patients with early-stage esophageal adenocarcinoma: Prevalence and predictors of lymph node involvement. Cancer. 122:2150–2157. 2016. View Article : Google Scholar : PubMed/NCBI

8 

Cho JW: The role of endosonography in the staging of gastrointestinal cancers. Clin Endosc. 48:297–301. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Anandarajah EM, Ditgen D, Hansmann J, Erttmann KD, Liebau E and Brattig NW: SPARC (secreted protein acidic and rich in cysteine) of the intestinal nematode Strongyloides ratti is involved in mucosa-associated parasite-host interaction. Mol Biochem Parasitol. 207:75–83. 2016. View Article : Google Scholar : PubMed/NCBI

10 

Shi D, Jiang K, Fu Y, Fang R, Liu XI and Chen J: Overexpression of SPARC correlates with poor prognosis in patients with cervical carcinoma and regulates cancer cell epithelial-mesenchymal transition. Oncol Lett. 11:3251–3258. 2016.PubMed/NCBI

11 

Rossi MK, Gnanamony M and Gondi CS: The ‘SPARC’ of life: Analysis of the role of osteonectin/SPARC in pancreatic cancer (Review). Int J Oncol. 48:1765–7871. 2016.PubMed/NCBI

12 

Rosset EM and Bradshaw AD: SPARC/osteonectin in mineralized tissue. Matrix Biol. 52–54:78–87. 2016. View Article : Google Scholar

13 

Notaro A, Sabella S, Pellerito O, Vento R, Calvaruso G and Giuliano M: The secreted protein acidic and rich in cysteine is a critical mediator of cell death program induced by WIN/TRAIL combined treatment in osteosarcoma cells. Int J Oncol. 48:1039–1044. 2016.PubMed/NCBI

14 

Tseng C and Kolonin MG: Proteolytic Isoforms of SPARC induce adipose stromal cell mobilization in obesity. Stem Cells. 34:174–190. 2016. View Article : Google Scholar : PubMed/NCBI

15 

Kim H, Samuel S, Lopez-Casas P, Grizzle W, Hidalgo M, Kovar J, Oelschlager D, Zinn K, Warram J and Buchsbaum D: SPARC-independent delivery of Nab-Paclitaxel without depleting tumor stroma in patient-derived pancreatic cancer xenografts. Mol Cancer Ther. 15:680–688. 2016. View Article : Google Scholar : PubMed/NCBI

16 

Vaz J, Ansari D, Sasor A and Andersson R: SPARC: A potential prognostic and therapeutic target in pancreatic cancer. Pancreas. 44:1024–1035. 2015. View Article : Google Scholar : PubMed/NCBI

17 

Mattina J, MacKinnon N, Henderson VC, Fergusson D and Kimmelman J: Design and reporting of targeted anticancer preclinical studies: A meta-analysis of animal studies investigating sorafenib antitumor efficacy. Cancer Res. 76:4627–4636. 2016. View Article : Google Scholar : PubMed/NCBI

18 

Huo Y, Su T, Cai Q and Macara IG: An in vivo gain-of-function screen identifies the Williams-Beuren Syndrome Gene GTF2IRD1 as a mammary tumor promoter. Cell Rep. 15:2089–2096. 2016. View Article : Google Scholar : PubMed/NCBI

19 

Lee J, Katzenmaier EM, Kopitz J and Gebert J: Reconstitution of TGFBR2 in HCT116 colorectal cancer cells causes increased LFNG expression and enhanced N-acetyl-d-glucosamine incorporation into Notch1. Cell Signal. 28:1105–1113. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Gao R, Ma LQ, Du X, Zhang TT, Zhao L, Liu L, Liu JC, Guo F, Cheng Z and Huang H: Rnf25/AO7 positively regulates wnt signaling via disrupting Nkd1-Axin inhibitory complex independent of its ubiquitin ligase activity. Oncotarget. 7:23850–23859. 2016. View Article : Google Scholar : PubMed/NCBI

21 

Fang M, Yuan J, Peng C and Li Y: Collagen as a double-edged sword in tumor progression. Tumour Biol. 35:2871–2882. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Bai J, Zhang X, Hu K, Liu B, Wang H, Li A, Lin F, Zhang L, Sun X, Du Z and Song J: Silencing DNA methyltransferase 1 (DNMT1) inhibits proliferation, metastasis and invasion in ESCC by suppressing methylation of RASSF1A and DAPK. Oncotarget. 7:44129–44141. 2016. View Article : Google Scholar : PubMed/NCBI

23 

Liu JY, Lu JB and Xu Y: MicroRNA-153 inhibits the proliferation and invasion of human laryngeal squamous cell carcinoma by targeting KLF5. Exp Ther Med. 11:2503–2508. 2016.PubMed/NCBI

24 

Lin W, Zhong M, Yin H, Chen Y, Cao Q, Wang C and Ling C: Emodin induces hepatocellular carcinoma cell apoptosis through MAPK and PI3K/AKT signaling pathways in vitro and in vivo. Oncol Rep. 36:961–967. 2016.PubMed/NCBI

25 

Che Y, Luo A, Wang H, Qi J, Guo J and Liu Z: The differential expression of SPARC in esophageal squamous cell carcinoma. Int J Mol Med. 17:1027–1033. 2006.PubMed/NCBI

26 

Xue LY, Zou SM, Zheng S, Liu XY, Wen P, Yuan YL, Lin DM and Lu N: Expressions of the γ2 chain of laminin-5 and secreted protein acidic and rich in cysteine in esophageal squamous cell carcinoma and their relation to prognosis. Chin J Cancer. 30:69–78. 2011. View Article : Google Scholar : PubMed/NCBI

27 

Nagaraju GP and Sharma D: Anti-cancer role of SPARC, an inhibitor of adipogenesis. Cancer Treat Rev. 37:559–566. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Zinovyeva MV, Monastyrskaya GS, Kopantzev EP, Vinogradova TV, Kostina MB, Sass AV, Filyukova OB, Uspenskaya NY, Sukhikh GT and Sverdlov ED: Identification of some human genes oppositely regulated during esophageal squamous cell carcinoma formation and human embryonic esophagus development. Dis Esophagus. 23:260–270. 2010. View Article : Google Scholar : PubMed/NCBI

29 

Jakharia A, Borkakoty B and Singh S: Expression of SPARC like protein 1 (SPARCL1), extracellular matrix-associated protein is down regulated in gastric adenocarcinoma. J Gastrointest Oncol. 7:278–283. 2016.PubMed/NCBI

30 

Porte H, Triboulet JP, Kotelevets L, Carrat F, Prévot S, Nordlinger B, DiGioia Y, Wurtz A, Comoglio P, Gespach C and Chastre E: Overexpression of stromelysin-3, BM-40/SPARC, and MET genes in human esophageal carcinoma: Implications for prognosis. Clin Cancer Res. 4:1375–1382. 1998.PubMed/NCBI

31 

Hong Y, Zhang J, Zhang H, Li X, Qu J, Zhai J, Zhang L, Chen F and Li T: Heterozygous PTCH1 mutations impact the bone metabolism in patients with nevoid basal cell carcinoma syndrome likely by regulating SPARC expression. J Bone Miner Res. 31:1413–1428. 2016. View Article : Google Scholar : PubMed/NCBI

32 

Kao SC, Kirschner MB, Cooper WA, Tran T, Burgers S, Wright C, Korse T, van den Broek D, Edelman J, Vallely M, et al: A proteomics-based approach identifies secreted protein acidic and rich in cysteine as a prognostic biomarker in malignant pleural mesothelioma. Br J Cancer. 114:524–531. 2016. View Article : Google Scholar : PubMed/NCBI

33 

Slusser-Nore A, Larson-Casey JL, Zhang R, Zhou XD, Somji S, Garrett SH, Sens DA and Dunlevy JR: SPARC expression is selectively suppressed in tumor initiating urospheres isolated from As+3- and Cd+2-transformed human urothelial cells (UROtsa) stably transfected with SPARC. PLoS One. 11:e01473622016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wu J, Zhang JR, Jiang XQ and Cao XG: Correlation between secreted protein acidic and rich in cysteine protein expression and the prognosis of postoperative patients exhibiting esophageal squamous cell carcinoma. Mol Med Rep 16: 3401-3406, 2017.
APA
Wu, J., Zhang, J., Jiang, X., & Cao, X. (2017). Correlation between secreted protein acidic and rich in cysteine protein expression and the prognosis of postoperative patients exhibiting esophageal squamous cell carcinoma. Molecular Medicine Reports, 16, 3401-3406. https://doi.org/10.3892/mmr.2017.6959
MLA
Wu, J., Zhang, J., Jiang, X., Cao, X."Correlation between secreted protein acidic and rich in cysteine protein expression and the prognosis of postoperative patients exhibiting esophageal squamous cell carcinoma". Molecular Medicine Reports 16.3 (2017): 3401-3406.
Chicago
Wu, J., Zhang, J., Jiang, X., Cao, X."Correlation between secreted protein acidic and rich in cysteine protein expression and the prognosis of postoperative patients exhibiting esophageal squamous cell carcinoma". Molecular Medicine Reports 16, no. 3 (2017): 3401-3406. https://doi.org/10.3892/mmr.2017.6959
Copy and paste a formatted citation
x
Spandidos Publications style
Wu J, Zhang JR, Jiang XQ and Cao XG: Correlation between secreted protein acidic and rich in cysteine protein expression and the prognosis of postoperative patients exhibiting esophageal squamous cell carcinoma. Mol Med Rep 16: 3401-3406, 2017.
APA
Wu, J., Zhang, J., Jiang, X., & Cao, X. (2017). Correlation between secreted protein acidic and rich in cysteine protein expression and the prognosis of postoperative patients exhibiting esophageal squamous cell carcinoma. Molecular Medicine Reports, 16, 3401-3406. https://doi.org/10.3892/mmr.2017.6959
MLA
Wu, J., Zhang, J., Jiang, X., Cao, X."Correlation between secreted protein acidic and rich in cysteine protein expression and the prognosis of postoperative patients exhibiting esophageal squamous cell carcinoma". Molecular Medicine Reports 16.3 (2017): 3401-3406.
Chicago
Wu, J., Zhang, J., Jiang, X., Cao, X."Correlation between secreted protein acidic and rich in cysteine protein expression and the prognosis of postoperative patients exhibiting esophageal squamous cell carcinoma". Molecular Medicine Reports 16, no. 3 (2017): 3401-3406. https://doi.org/10.3892/mmr.2017.6959
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team