Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
December-2017 Volume 16 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2017 Volume 16 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

High incidence of coding gene mutations in mitochondrial DNA in esophageal cancer

  • Authors:
    • Zong‑Wen Liu
    • Zhen‑Jiang Guo
    • A‑Lan Chu
    • Yan Zhang
    • Bing Liang
    • Xing Guo
    • Ting Chai
    • Rui Song
    • Ge Hou
    • Jin‑Jin Yuan
  • View Affiliations / Copyright

    Affiliations: Department of Radiotherapy, The Second Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan 450014, P.R. China, Department of Pharmacology, School of Basic Medicine of Zhengzhou University, Zhengzhou, Henan 450001, P.R. China, Department of Oncology, The Second Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan 450014, P.R. China
  • Pages: 8537-8541
    |
    Published online on: September 29, 2017
       https://doi.org/10.3892/mmr.2017.7663
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The aim of the present study was to detect mutations in the coding genes of mitochondrial DNA (mtDNA) in three esophageal cancer cell lines and in tumor tissues obtained from 30 patients with esophageal cancer, to investigate the relationship between protein‑ and RNA‑coding gene mutations and esophageal cancer. mtDNA was extracted and the coding genes were sequenced and analyzed by comparing the sequencing results with the complete mitochondrial genome of Homo sapiens. The results revealed 39 mutations in the three esophageal cancer cell lines; the genes with the highest mutation frequencies included mitochondrially encoded cytochrome B (MT‑CYTB), NADH dehydrogenase 5 (MT‑ND5) and MT‑ND4 gene. A total of 216 mutations were identified in the 30 esophageal cancer tissues, including 182 protein‑coding mutations, of which MT‑CYTB and MT‑ND5 genes exhibited higher mutation frequencies. The results of the present study indicated that mutations in the coding genes of mtDNA in esophageal cancer cells may be related to the occurrence of esophageal cancer.

Introduction

Tumor development is a multifactorial process involving several steps. It is currently considered that the biological characteristics of a tumor not only depend on the nuclear genetic material, but also have a certain relationship with extranuclear genetic material from mitochondrial DNA (mtDNA) (1). As studies on mitochondria increase in number, it has been revealed that the DNA in the mitochondrial basilar membrane is a unique genetic material that only exists outside the nucleus (2). Mitochondria are cellular organelles that are required for oxidative respiration for the production of energy and are the center of aerobic metabolism; therefore, large amounts of oxygen free radicals are produced during oxidative phosphorylation in the mitochondria, which exposes mtDNA to higher concentrations of reactive oxygen species (ROS) (3). Coinciding with this is an imperfect mtDNA damage repair system and a lack of protection of mtDNA against histone and DNA-binding proteins (4–6). Therefore, mtDNA is more susceptible to attacks by carcinogens, leading to damage and mutation with the mutation rate being 10–20 times higher than that of nDNA (7–10). mtDNA is divided into the non-coding displacement (D)-loop region and the coding region. The majority of previous studies concentrated on the D-loop region of the mtDNA. The D-loop region is of great interest in the area of mtDNA mutations in many tumor tissues, and in non-neoplastic diseases and normal tissues; the D-loop region is also of great interest in the area of mtDNA mutations, indicating that a high rate of mutations in the D-loop region is not specific to tumors. Currently, there are few reports on the relationship between coding gene mutations in mtDNA and tumorigenesis. The present study uses 3 esophageal cancer cell lines and 30 tissue samples from patients with esophageal cancer to investigate the presence of mutations in coding sequences in the mtDNA. The mtDNA genes were sequenced to determine the relationship between the mutations and the occurrence of esophageal cancer.

Materials and methods

Esophageal carcinoma cell lines

The EC9706 cell line was a gift from The Key Laboratory of State Molecular Oncology, Chinese Academy of Medical Sciences (Beijing, China). The TE-1 and Eca109 cell lines were gifts from The School of Pharmacy, Zhengzhou University (Zhengzhou, Henan, China).

Cell culture

The Ec9706, TE-1 and Eca109 cells were seeded in separate culture flasks with RPMI-1640 medium containing 10% fetal bovine serum (both Beijing Solarbio Science & Technology Co., Ltd., Beijing, China), which were then placed in an incubator at 37°C and 5% CO2. The culture medium was replaced every two days and cells were grown to ~90% confluency.

Esophageal cancer tissues

A total of 30 tumor samples were obtained from patients diagnosed with esophageal cancer, who underwent surgery in The First Affiliated Hospital of Zhengzhou University and in The Second Affiliated Hospital of Zhengzhou University (Zhengzhou, China). None of the patients in this study received preoperative treatments, such as chemotherapy or radiotherapy. This study was approved by the Ethics Review Committee of The Second Affiliated Hospital of Zhengzhou University, and all patients provided signed written informed consent. Tumor tissue samples were collected within 30 min following surgical removal and were stored at −80°C until all samples were collected for combined submission for mtDNA sequencing.

Extraction of mtDNA from cells and tissues

For mitochondrial extraction, ~5×107 cells from each cell line were required and ~100 mg of each tissue was used. All of the mitochondrial extract was then used to extract mtDNA. Mitochondria were extracted using a Mitochondria Isolation kit (Beijing Solarbio Science & Technology Co., Ltd.) and the mtDNA was isolated using a Mitochondrial DNA Extraction kit (Shanghai Jiemei Gene Pharmaceutical Technology Co., Ltd., Shanghai, China) according to the manufacturer's protocol. The concentration and purity of mtDNA sample were determined by at least three spectrophotometric measurements, with distilled water used as a blank control. The A260/A280 ratio of pure mtDNA samples was 1.8; a ratio >1.9 indicated RNA contamination, and <1.6 indicated contamination with proteins, phenol or other agents.

Coding gene sequencing of mtDNA in esophageal cell lines and tissues

The complete mtDNA sequence was 16,569 bp in length. The mtDNA sequence was pieced together from 15 fragments resulting from the polymerase chain reaction (PCR) method; the primer sequences, the length of the 15 sections and their corresponding locations along the mtDNA are provided in Table I. All primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The 2X Taq PCR MasterMix (Beijing Biomed Gene Technology Co., Ltd, Beijing, China) containing the Taq DNA polymerase and dNTPs was used. The 25 µl PCR reaction system contained 1 µl of mtDNA, 1 µl of forward primer, 1 µl of reverse primer, 12.5 µl of PCR Master Mix (2X) and 9.5 µl of nuclease-free water (Thermo Scientific). The PCR amplification conditions were as follows: Initial denaturation at 95°C for 3 min, followed by 35 cycles of denaturation at 94°C for 30 sec, annealing at 55–60°C for 35 sec, and extension at 72°C for 50 sec, and a final extension at 72°C for 8 min. A total of 5 µl PCR product was mixed with 6X Loading buffer (Beyotime Institute of Biotechnology, Shanghai, China) were checked by electrophoresis on 1% agarose gel. A 10,000 bp DNA marker was used to determine the size of the amplified fragments; electrophoresis was performed with 0.5X Tris-borate-EDTA buffer with a constant of 150 V for 20 min. The gel was visualized with ethidium bromide and imaged by a gel image analyzer. PCR products were excised from the gel and purified using the UNIQ-10 Spin Column DNA Gel Extraction kit (Sangon Biotech Co., Ltd.) according to the manufacturer's instructions. The purified PCR products were sent to Sangon Biotech Co., Ltd. for sequencing.

Table I.

List of primers used to obtain full-length human mitochondrial DNA sequence.

Table I.

List of primers used to obtain full-length human mitochondrial DNA sequence.

Primer namePrimer sequence (5′→3′)Fragment size (bp)Starting and ending sites
NO1F: AAACAAAGAACCCTAACACCAGC1,443359–1,801
R: TCATCTTTCCCTTGCGGTACTA
NO2F: CCCACTCCACCTTACTACCAG1,4141,689–3,102
R: ATAGAAACCGACCTGGATTACT
NO3F: ACCAACGGAACAAGTTACCC1,4792,910–4,388
R: TGATAGGTGGCACGGAGAA
NO4F: CCTACCACTCACCCTAGCATTACT1,4554,185–5,639
R: TAAAGTGGCTGATTTGCGTTC
NO5F: AAACAATAGCCTCATCATCCC1,3745,285–6,658
R: CCGAAGCCTGGTAGGATAAG
NO6F: CAATACCAAACGCCCCTCT1,2906,435–7,724
R: TGAGTGTTAGGAAAAGGGCATA
NO7F: GTTTCAAGCCAACCCCATG1,3317,479–8,809
R: TTGGTGTAAATGAGTGAGGCAG
NO8F: CCCCACCTCCAAATATCTCA1,2548,619–9,872
R: TTGGCGGATGAAGCAGATA
NO9F: CAGGCATCACCCCGCTAA1,3769,562–10,937
R: GGTCGGAGGAAAAGGTTGG
NO10F: CACATATGGCCTAGACTACGTACA1,21410,718–11,931
R: ATATTTGATCAGGAGAACGTGGT
NO11F: CCACGGGCTTACATCCTCA1,34011,713–13,052
R: CCTTCTATGGCTGAGGGGAG
NO12F: ACAGCAGCCATTCAAGCAA1,45012,832–14,281
R: GTCAGGGTTGATTCGGGAG
NO13F: TCTTACGAGCCAAAACCTGC1,31013,962–15,271
R: GAGGGTGGGACTGTCTACTGAG
NO14F: ACATCGGCATTATCCTCCTG1,27115,087–16,357
R: AAGGGATTTGACTGTAATGTGCT
NO15F: ACACCAGTCTTGTAAACCGGA1,38115,909–16,569; 1–720
R: ACTCACTGGAACGGGGATG

[i] F, forward; NO, number; R, reverse.

mtDNA mutation analysis

To analyze the collected data, ABACUS algorithm based software (Auto-analysis with GeneMapper 4.0) was provided by Sangon Biotech Co., Ltd. Sequence data were analyzed with Sequencing Analysis Software version 5.2 (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA), Sequence Scanner v1.0 (Applied Biosystems; Thermo Fisher Scientific, Inc.), ChromasPro v2.1.5 (Technelysium Pty., Ltd., South Brisbane, Australia) and EditSeq Lasergene v7.1 (DNASTAR, Inc., Madison, WI, USA). To define the mutation, a revised Cambridge Reference Sequence [rCRS; National Center for Biotechnology Information (NCBI) GenBank accession NC_012920.1; www.ncbi.nlm.nih.gov/nuccore/251831106] was used as the reference sequences.

Results

mtDNA sequencing analysis of three esophageal cancer cell lines

Following sequencing of the mtDNA coding region in the TE-1, EC9706 and Eca109 cell lines, the sequences were compared with the complete mitochondrial genome of Homo sapiens (NCBI reference sequence NC_012920.1). The sequencing results identified 39 mutations in the 3 cell lines, 38 of which were base substitutions. The majority of the mutations were A→G or C→T substitutions; 10 of the identified mutations occurred within all three cell lines, including A750G, A1438G, A2706G, A4769G, C7028T, A8860G, G11719A, C12705T, C14766T and A15326G (Table II). There were three mutations identified that led to an amino acid replacement, including A8860G (Thr→Ala) in the mitochondrially encoded ATP synthase 6 (MT-ATP6) gene, and C14766T (Thr→Ile) and A15326G (Thr→Ala) in the cytochrome B (MT-CYTB) gene. A total of 31 protein-coding and 8 RNA-coding mutations were identified (Table III). The mutation frequencies were also assessed by calculating the percentage of the total mutations identified in the 3 cell lines that were also observed in CYTB: Mutation frequency (%) = number of mutations in CYTB / 39. Among the 31 protein-coding mutations, MT-CYTB, MT-ND5 and MT-ND4 exhibited the highest mutation frequencies of 15.4% (6/39), 12.8% (5/39) and 12.8% (5/39), respectively.

Table II.

Top 10 common mutations in the three esophageal cancer cell lines.

Table II.

Top 10 common mutations in the three esophageal cancer cell lines.

LocusNucleotide positionNucleotide changeAmino acid change
MT-RNR1750A→GNoncoding
MT-RNR11,438A→GNoncoding
MT-RNR22,706A→GNoncoding
MT-ND24,769A→GMet→Met
MT-COX17,028C→TAla→Ala
MT-ATP68,860A→GThr→Ala
MT-ND411,719G→AGly→Gly
MT-ND512,705C→TIle→Ile
MT-CYTB14,766C→TThr→Ile
MT-CYTB15,326A→GThr→Ala

[i] ATP6, ATP synthase 6; CYTB, cytochrome B; COX1, cytochrome C oxidase 1; MT, mitochondrially encoded; ND, NADH dehydrogenase; RNR1, 12S RNA; RNR2, 16S RNA.

Table III.

Summary of the identified mitochondrial DNA mutations in 3 esophageal cancer cell lines and 30 esophageal cancer tissues.

Table III.

Summary of the identified mitochondrial DNA mutations in 3 esophageal cancer cell lines and 30 esophageal cancer tissues.

SourceMutations in protein-coding genesMutations in RNA genes
Cells  31  8
Tissues18234
mtDNA sequencing analysis of 30 esophageal cancer tissues

Similar to the cell lines, the sequences obtained from the 30 tissue samples were compared with the H. sapiens mitochondrial genome NC_012920.1. A total of 216 mutations were identified, including 214 point mutations, one single-nucleotide insertion and one single-nucleotide deletion. A majority of the mutations were A→G and C→T substitutions. Among the identified 216 identified mutations, 84.2% (182/216) occurred in genes involved in mitochondrial respiratory complexes (Table III). MT-ND5, MT-CYTB and MT-ND2 exhibited the highest mutation frequencies at 12.5% (27/216), 11.1% (24/216) and 10.2% (22/216), respectively. In all 30 tissue samples analyzed, the A750G, A4769G, A8860G, G11719A, C14766T and A15326G mutation sites were observed. In addition, the two mutations, A1438G and A2706G, were identified in 29 tissue samples, the C7028T mutation occurred in 26 tissue samples and the C12705T mutation was observed in 22 tissue samples (Table IV).

Table IV.

Top 10 common mutations in esophageal cancer tissues.

Table IV.

Top 10 common mutations in esophageal cancer tissues.

LocusNucleotide positionNucleotide changeAmino acid changeNumber of mutated tissues
MT-RNR1750A→GNoncoding30
MT-RNR11,438A→GNoncoding29
MT-RNR22,706A→GNoncoding29
MT-ND24,769A→GMet→Met30
MT-COX17,028C→TAla→Ala26
MT-ATP68,860A→GThr→Ala30
MT-ND411,719G→AGly→Gly30
MT-ND512,705C→TIle→Ile22
MT-CYTB14,766C→TThr→Ile30
MT-CYTB15,326A→GThr→Ala30

[i] MT, mitochondrially encoded; RNR1, 12S RNA; RNR2, 16S RNA; ATP6, ND, NADH dehydrogenase; COX1, cytochrome C oxidase 1; ATP synthase 6; CYTB, cytochrome B.

Discussion

mtDNA mutations occur in a variety of human malignancies, and it has been demonstrated that mutations in mtDNA are closely related to the occurrence and development of malignant tumors (11). In 1998, Polyak et al (12) reported for the first time the presence of mtDNA mutations in 7 out of 10 colon cancer cell lines. In that study, 11 of the identified mutations were single-base substitutions and 1 was an insertion; there were 12 somatic mutations and >10 times more mtDNA mutations than nDNA mutations. Another study detected 14 mutations through sequencing of the mitochondrial genome of 15 breast cancer tissues and distant normal tissues, of which 5 were located in the ND genes (2 mutations in ND2, 2 mutations in ND5 and 1 mutation in ND4), 2 were located in MT-COX genes, 4 were located in mtRNA, 2 were located in MT-tRNA genes and 1 was located in MT-CYTB (13). One previous study reported that the mutation frequency of mtDNA in lung cancer was approximately 100 times greater than that of normal tissue (14). Among these mutations, two, located within MT-ATP6 and MT-ND3, were significantly associated with the risk of lung cancer.

In the present study, the mtDNA coding regions of esophageal cancer cell lines and tissues were sequenced and compared with the rCRS, NC_012920.1. The sequencing results demonstrated that the majority of mutations in both the cancer cell lines and the cancer tissues were base substitutions between A and G or C and T. Recently, two large-scale studies used DNA sequencing technology to compare >30 tumor types, along with normal tissues collected from >2,000 patients, to map the mutations of the mitochondrial genome (15,16). They found that many somatic cells exhibited dramatic replicative strand bias, predominantly C→T and A→G on the mitochondrial heavy strand. Similar results were observed in another study (17).

A total of 10 mutations were identified as similar between the 3 esophageal cancer cell lines, all of which were base substitution and 3 of the mutations led to amino acid replacement. A previous report identified the same three sites of amino acid changes in a study on the relationship between human life and mtDNA polymorphisms (18). Another study reported that the A8860 G transition existed in hypertrophic cardiomyopathy (HCM), and it was hypothesized that this rare polymorphism may be associated with HCM (19). The A8860G polymorphism was previously reported to reduce the rate of mitochondrial ATP production in yeasts and cultured human cells (20,21). Reanalysis of the CRS was performed by resequencing the original placental mtDNA sample from Andrews et al (22). The results of this resequencing confirmed that there are rare polymorphisms in the CRS; 750A, 1438A, 4769A, 8860A and 15326A all represent rare polymorphic alleles (22). Due to its widespread use, it has been recommended that in the CRS for human mtDNA, the rare polymorphic alleles should be retained so that the rCRS is a true reference sequence and not a consensus sequence (22).

In the present study, both esophageal cancer cell lines and tissues exhibited the same phenomenon, MT-ND5 and MT-CYTB had higher mutation frequencies compared with the other identified mutations. A previous study demonstrated that the MT-CYTB mutation may serve a significant role in the oxidation process in mitochondria (23).

The present results indicated that mtDNA mutations may serve a particular role in the occurrence of esophageal cancer. Mutations in mtDNA may be associated with abnormal enzyme functions in the mitochondrial respiratory chain (24). Gene mutations may alter the quality and quantity of the expression products of mitochondria, which may result in changes to the structure of the electron transport chain, leading to defects in mitochondrial function, a decline in oxidative phosphorylation function, a reduction in ATP generation and a significant increase in the number of oxygen free radicals, thereby contributing to the incidence and development of esophageal cancer. A previous study evaluated the roles of the mtDNA mutations identified in cancer cell lines using transmitochondrial cybrids to reveal that individual mtDNA mutations may be responsible for mitochondrial dysfunction (25). Our future research aims to use transmitochondrial cybrids to demonstrate individual mtDNA mutations of esophageal cancer.

Acknowledgements

This study was supported by The First Batch of Science and Technology Plan Projects of Zhengzhou in 2013 (grant no. 131PCXTD628), The Foundation and Advanced Technology Research Project of Henan Province (grant no. 132300410409) and the Medical Science and Technology Plan Program Grant of Henan Province (grant no. 201401009).

References

1 

Larman TC, DePalma SR, Hadjipanayis AG; Cancer Genome Atlas Research Network, ; Protopopov A, Zhang J, Gabriel SB, Chin L, Seidman CE, Kucherlapati R and Seidman JG: Spectrum of somatic mitochondrial mutations in five cancers. Proc Natl Acad Sci USA. 109:pp. 14087–14091. 2012; View Article : Google Scholar : PubMed/NCBI

2 

Eaton JS, Lin ZP, Sartorelli AC, Bonawitz ND and Shadel GS: Ataxia-telangiectasia mutated kinase regulates ribonucleotide reductase and mitochondrial homeostasis. J Clin Invest. 117:2723–2734. 2007. View Article : Google Scholar : PubMed/NCBI

3 

Ishikawa K, Takenaga K, Akimoto M, Koshikawa N, Yamaguchi A, Imanishi H, Nakada K, Honma Y and Hayashi J: ROS-generating mitochondrial DNA mutations can regulate tumor cell metastasis. Science. 320:661–664. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Dali-Youcef N, Mataki C, Coste A, Messaddeq N, Giroud S, Blanc S, Koehl C, Champy MF, Chambon P, Fajas L, et al: Adipose tissue-specific inactivation of the retinoblastoma protein protects against diabesity because of increased energy expenditure. Proc Natl Acad Sci USA. 104:pp. 10703–10708. 2007; View Article : Google Scholar : PubMed/NCBI

5 

Gasparre G, Porcelli AM, Bonora E, Pennisi LF, Toller M, Iommarini L, Ghelli A, Moretti M, Betts CM, Martinelli GN, et al: Disruptive mitochondrial DNA mutations in complex I subunits are markers of oncocytic phenotype in thyroid tumors. Proc Natl Acad Sci USA. 104:pp. 9001–9006. 2007; View Article : Google Scholar : PubMed/NCBI

6 

Maynard S, Schurman SH, Harboe C, de Souza-Pinto NC and Bohr VA: Base excision repair of oxidative DNA damage and association with cancer and aging. Carcinogenesis. 30:2–10. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Liu SA, Jiang RS, Wang WY and Lin JC: Somatic mutations in the D-loop of mitochondrial DNA in head and neck squamous cell carcinoma. Head Neck. 37:878–883. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Kawasaki M, Anzawa K, Tanabe H, Mochizuki T, Ishizaki H and Nishimura K: Intra-species variation of genotypes of Exophiala jeanselmei isolated from patients in Japan. Nippon Ishinkin Gakkai Zasshi. 46:261–265. 2005. View Article : Google Scholar

9 

Kong WJ, Wang Y, Wang Q, Han YC and Hu YJ: Comparison of three methods for isolation of nucleic acids from membranate inner ear tissue of rats. Chin Med J (Engl). 119:986–990. 2006.PubMed/NCBI

10 

Zheng W, Khrapko K, Coller HA, Thilly WG and Copeland WC: Origins of human mitochondrial point mutations as DNA polymerase gamma-mediated errors. Mutat Res. 599:11–20. 2006. View Article : Google Scholar : PubMed/NCBI

11 

Lee HC, Chang CM and Chi CW: Somatic mutations of mitochondrial DNA in aging and cancer progression. Ageing Res Rev. 9 Suppl 1:S47–S58. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Polyak K, Li Y, Zhu H, Lengauer C, Willson JK, Markowitz SD, Trush MA, Kinzler KW and Vogelstein B: Somatic mutations of mitochondrial genome in human colorectal tumours. Nat Genet. 20:291–293. 1998. View Article : Google Scholar : PubMed/NCBI

13 

Fendt L, Niederstätter H, Huber G, Zelger B, Dünser M, Seifarth C, Röck A, Schäfer G, Klocker H and Parson W: Accumulation of mutations over the entire mitochondrial genome of breast cancer cell obtained by tissue microdissection. Breast Cancer Res Treat. 128:327–336. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Choi SJ, Kim SH, Kang HY, Lee J, Bhak JH, Sohn I, Jung SH, Choi YS, Kim HK, Han J, et al: Mutational hotspots in the mitochondrial genome of lung cancer. Biochem Biophys Res Commun. 407:23–27. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Ju YS, Alexandrov LB, Gerstung M, Martincorena I, Nik-Zainal S, Ramakrishna M, Davies HR, Papaemmanuil E, Gundem G, Shlien A, et al: Origins and functional consequences of somatic mitochondrial DNA mutations in human cancer. Elife. 3:2014. View Article : Google Scholar

16 

Stewart JB, Alaei-Mahabadi B, Sabarinathan R, Samuelsson T, Gorodkin J, Gustafsson CM and Larsson E: Simultaneous DNA and RNA Mapping of Somatic Mitochondrial Mutations across Diverse Human Cancers. PLoS Genet. 11:e10053332015. View Article : Google Scholar : PubMed/NCBI

17 

Yu Y, Lv F, Lin H, Qian G, Jiang YS, Pang LX, Wang YP, Wang XF, Kang YM, Li CB, et al: Mitochondrial ND3 G10398A mutation: A biomarker for breast cancer. Genet Mol Res. 14:17426–17431. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Yang X, Wang X, Yao H, Deng J, Jiang Q, Guo Y, Lan G, Liao DJ and Jiang H: Mitochondrial DNA polymorphisms are associated with the longevity in the Guangxi Bama population of China. Mol Biol Rep. 39:9123–9131. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Houshmand M, Montazeri M, Kuchekian N, Noohi F, Nozar G and Zamani A: Is 8860 variation a rare polymorphism or associated as a secondary effect in HCM disease? Arch Med Sci. 7:242–246. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Kucharczyk R, Salin B and di Rago JP: Introducing the human Leigh syndrome mutation T9176G into Saccharomyces cerevisiae mitochondrial DNA leads to severe defects in the incorporation of Atp6p into the ATP synthase and in the mitochondrial morphology. Hum Mol Genet. 18:2889–2898. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Carrozzo R, Tessa A, Vázquez-Memije ME, Piemonte F, Patrono C, Malandrini A, Dionisi-Vici C, Vilarinho L, Villanova M, Schägger H, et al: The T9176G mtDNA mutation severely affects ATP production and results in Leigh syndrome. Neurology. 56:687–690. 2001. View Article : Google Scholar : PubMed/NCBI

22 

Andrews RM, Kubacka I, Chinnery PF, Lightowlers RN, Turnbull DM and Howell N: Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat Genet. 23:1471999. View Article : Google Scholar : PubMed/NCBI

23 

Diroma MA, Calabrese C, Simone D, Santorsola M, Calabrese FM, Gasparre G and Attimonelli M: Extraction and annotation of human mitochondrial genomes from 1000 Genomes Whole Exome Sequencing data. BMC Genomics. 15 Suppl 3:S22014. View Article : Google Scholar : PubMed/NCBI

24 

Putignani L, Raffa S, Pescosolido R, Rizza T, Del Chierico F, Leone L, Aimati L, Signore F, Carrozzo R, Callea F, et al: Preliminary evidences on mitochondrial injury and impaired oxidative metabolism in breast cancer. Mitochondrion. 12:363–369. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Kulawiec M, Owens KM and Singh KK: Cancer cell mitochondria confer apoptosis resistance and promote metastasis. Cancer Biol Ther. 8:1378–1385. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu ZW, Guo ZJ, Chu AL, Zhang Y, Liang B, Guo X, Chai T, Song R, Hou G, Yuan JJ, Yuan JJ, et al: High incidence of coding gene mutations in mitochondrial DNA in esophageal cancer. Mol Med Rep 16: 8537-8541, 2017.
APA
Liu, Z., Guo, Z., Chu, A., Zhang, Y., Liang, B., Guo, X. ... Yuan, J. (2017). High incidence of coding gene mutations in mitochondrial DNA in esophageal cancer. Molecular Medicine Reports, 16, 8537-8541. https://doi.org/10.3892/mmr.2017.7663
MLA
Liu, Z., Guo, Z., Chu, A., Zhang, Y., Liang, B., Guo, X., Chai, T., Song, R., Hou, G., Yuan, J."High incidence of coding gene mutations in mitochondrial DNA in esophageal cancer". Molecular Medicine Reports 16.6 (2017): 8537-8541.
Chicago
Liu, Z., Guo, Z., Chu, A., Zhang, Y., Liang, B., Guo, X., Chai, T., Song, R., Hou, G., Yuan, J."High incidence of coding gene mutations in mitochondrial DNA in esophageal cancer". Molecular Medicine Reports 16, no. 6 (2017): 8537-8541. https://doi.org/10.3892/mmr.2017.7663
Copy and paste a formatted citation
x
Spandidos Publications style
Liu ZW, Guo ZJ, Chu AL, Zhang Y, Liang B, Guo X, Chai T, Song R, Hou G, Yuan JJ, Yuan JJ, et al: High incidence of coding gene mutations in mitochondrial DNA in esophageal cancer. Mol Med Rep 16: 8537-8541, 2017.
APA
Liu, Z., Guo, Z., Chu, A., Zhang, Y., Liang, B., Guo, X. ... Yuan, J. (2017). High incidence of coding gene mutations in mitochondrial DNA in esophageal cancer. Molecular Medicine Reports, 16, 8537-8541. https://doi.org/10.3892/mmr.2017.7663
MLA
Liu, Z., Guo, Z., Chu, A., Zhang, Y., Liang, B., Guo, X., Chai, T., Song, R., Hou, G., Yuan, J."High incidence of coding gene mutations in mitochondrial DNA in esophageal cancer". Molecular Medicine Reports 16.6 (2017): 8537-8541.
Chicago
Liu, Z., Guo, Z., Chu, A., Zhang, Y., Liang, B., Guo, X., Chai, T., Song, R., Hou, G., Yuan, J."High incidence of coding gene mutations in mitochondrial DNA in esophageal cancer". Molecular Medicine Reports 16, no. 6 (2017): 8537-8541. https://doi.org/10.3892/mmr.2017.7663
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team