Leucine and glycine dipeptides of porcine placenta ameliorate physical fatigue through enhancing dopaminergic systems
- Authors:
- Published online on: December 20, 2017 https://doi.org/10.3892/mmr.2017.8335
- Pages: 4120-4130
Abstract
Introduction
Fatigue induced by vigorous exercise results from peripheral alterations in muscles and alterations in the central nervous system (1). Central fatigue has an important role in fatigue during exercise (2). The activation of central dopaminergic systems influences exercise performance (3) and central depletion of dopamine, which is a neurotransmitter, has been previously associated with physical fatigue (4). It is established that dopamine functions as an important regulator of the immune system, behavior and movement (5). Brain-derived neurotrophic factor (BDNF) levels alter with exercise and physical activity (6), and mediate the trophic effect of dopamine receptor activation (7). It has been reported that depletion of BDNF expression leads to stress in fatigue (8). Therefore, BDNF is considered to be an attractive therapeutic target for the treatment of chronic fatigue (9).
High intensity exercise increases the expression of proinflammatory cytokines in the muscle and blood (10), and these increases lead to alterations in behavior and in basal ganglia dopamine function (11). Various biochemical parameters, including lactate, lactate dehydrogenase (LDH), creatine kinase (CK) and blood urea nitrogen (BUN), are altered during fatigue (12). In addition, oxidative stress induces fatigue with an increase in nitrite levels (13), and alteration of mitochondrial functions by exposure to reactive oxygen species induces muscular fatigue (14). Furthermore, catalase activity is diminished in fatigue (15) and superoxide dismutase (SOD) protects against superoxide radicals and represents a first-line defense against oxidative stress (16).
Fatigue has been associated with an increased risk of malnutrition (17). The authors' previous study reported that protein-energy malnutrition increases fatigue-associated parameters in a fatigue model (18), and protein supplementation was reported to improve muscle protein synthesis following exercise (19). Also, our previous report demonstrated that fermented placenta, which contains biologically active compounds such as proteins and peptides, ameliorates physical fatigue (20). Leucine has important biochemical functions in the brain, such as the synthesis of dopamine, which is derived from aromatic amino acids, and leucine supplementation limits the development of fatigue (6). In addition, glycine-rich sea cucumber peptides were reported to exhibit an anti-fatigue activity (21). Therefore, the present study investigated the anti-fatigue effects of Danish porcine placenta (DPP) and its dipeptides, leucine-glycine (LG) and glycine-leucine (GL), in mouse models of exercise-induced fatigue using a treadmill test and a forced swimming test (FST), which are useful for screening anti-fatigue drugs (22,23). In addition, the regulatory mechanisms of DPP, LG and GL on inflammatory responses were investigated in splenocytes.
Materials and methods
Animals
A total of 40 Male ICR mice (4-weeks-old; weight, 20–25 g) were obtained from Dae-Han Experimental Animal Center (Dajeon, Korea) and were acclimatized to a controlled room for one week prior to experiments. The animals were kept at 22±1°C with a relative humidity of 55±10% with a light/dark cycle of 12-h and ad libitum food and water availability. All experimental procedures were conducted in accordance with the ethical regulations of and approved by the Animal Care and Use Committee of Kyung Hee University [approval no. KHUASP (SE)-15-080].
Preparation of DPP
DPP was obtained in powder form from BIOFAC A/S (Kastrup, Denmark) and dissolved in distilled water (DW). LG (cat. no. G-2495; Bachem AG, Bubendorf, Switzerland) and GL (cat. no. M1460; Bachem AG) were dissolved in DW. Liquid chromatography/mass spectrometry/mass spectrometry demonstrated that 1 g DPP contains 240 µg LG, 1,463 µg GL, 6.05 mg leucine and 7.29 mg glycine (data not shown). Administered doses of DPP, LG and GL were determined as described in our previous report (20).
Treadmill exercise test
A treadmill exercise test was performed as previously described (20,24). Briefly, all mice were familiarized with the treadmill one week prior to the treadmill test. All mice ran on the treadmill at 10 m/min for 10 min, followed by 16 m/min for 10 min and 21 m/min for 10 min once a week for three weeks. The time to exhaustion for exercise (10 m/min for 5 min, followed by 16, 18, 21, 24, 26, 29, 32, 34 and 37 m/min for 3 min each, and 40 m/min until exhaustion) was determined on the 21st day. The time to exhaustion during treadmill running was defined as the time between the commencement and the first failure to maintain treadmill exercise for >3 min (24). Mice were assigned to one of four groups (n=5/group), including the control, DPP, LG and GL groups, according to previous reports (24,25). Mice were orally administered DW as a control group, DPP (0.1, 1 and 10 mg/kg), LG (1 and 10 mg/kg) or GL (1 and 10 mg/kg) for 21 consecutive days, as previously described (20,26).
Fatigue-associated parameter analysis
Following the treadmill exercise test mice were sacrificed and brains, muscle, liver and blood were obtained. A total of 800 µl blood was taken and serum was prepared by centrifugation at 1,900 × g at 4°C for 10 min. Dopamine levels in the brain were determined using an ELISA kit (cat. no. MBS732020; MyBioSource, Inc., San Diego, CA, USA). The levels of LDH, lactate, CK, glycogen, catalase, SOD and glucose were determined using each kit (cat. nos. ab102526, ab65331, ab155901, ab65620, ab83464, ab65354 and ab65333, respectively; Abcam, Cambridge, UK). Cortisol (cat. no. ADI-900-071; Enzo Life Sciences, Inc., Farmingdale, NY, USA), BUN (cat. no. K024-H1; Arbor Assays, Inc., Ann Arbor, MI, USA), alanine transaminase (ALT; cat. no. MAK052; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) and aspartate transaminase (AST; cat. no. MAK055; Sigma-Aldrich; Merck KGaA) levels in the serum were also determined using commercial kits.
Isolation of splenocytes
Splenocytes were isolated from spleen of male ICR mice (n=6). The spleen dissected and then placed into the cell strainer with RPMI-1640 medium at room temperature. The homogenized cell solution was centrifuged at room temperature, 480 × g for 5 min to obtain a single cell suspension with RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.; cat. no. 31800022) supplemented with 100 unit/ml penicillin, 100 µg/ml streptomycin and 10% heat-inactivated fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) at 37°C 5% CO2 and 95% humidity. Splenocytes (2×105) were treated with DPP (0.1, 1 and 10 µg/ml), LG (0.1, 1 and 10 µg/ml) or GL (0.1, 1 and 10 µg/ml) for 24 h at 37°C, and subsequently stimulated with immobilized anti-CD3 and soluble anti-CD28 antibodies (CD3 cat. no. 553057; 2 µg/ml; CD28 cat. no. 553294; 4 µg/ml, respectively; BD Pharmingen; BD Biosciences, Franklin Lakes, NJ, USA). Control cells were treated with distilled water.
Nuclear and cytosolic protein extraction
Splenocytes (3×105) were lysed with 400 µl ice-cold hypotonic buffer comprised of EDTA (0.1 mM), MgCl2 (2 mM), Hepes/KOH (10 mM), PMSF (0.5 mM), DTT (1 mM) and KCl (10 mM) at (pH 7.9). Following centrifugation at 4°C, 4 min, 600 × g, supernatant aliquots were analyzed for cytoplasmic proteins. Pelleted nuclei were lysed with 50 µl ice-cold saline buffer comprised of EDTA (0.1 mM), HEPES/KOH (50 mM), PMSF (0.5 mM), DTT (1 mM), KCl (50 mM), NaCl (300 mM) and glycerol (10%) at (pH 7.9). Following centrifugation at 4°C for 15 min at 16,000 × g supernatant aliquots were analyzed for nuclear proteins. Protein levels were measured using a bicinchoninic acid protein assay (Sigma-Aldrich; Merck KGaA).
Western blot analysis
The protein expression of BDNF and phosphorylated-extracellular signal-regulated kinase (pERK) in the whole brain of mice, and the expression of caspase-1, nuclear factor (NF)-κB, phosphorylated-NF-κB inhibitor α (pIκBα), α-tubulin, and poly (ADP-ribose) polymerase (PARP) in splenocytes was determined by western blot analysis, as previously described (27). A total of 20 µl/ug protein separated per lane. Primary antibodies (all 1:500 dilution with PBST; pERK, cat. no. sc-7383; ERK, cat. no. sc-94; BDNF, cat. no. sc-546; GAPDH, cat. no. sc-32233; caspase-1, cat. no. sc-56036; α-tubulin, cat. no. sc-8035; NF-κB, cat. no. sc-8008; PARP, cat. no. sc-8007; pIκBα, cat. no. sc-8404; all purchased from Santa Cruz Biotechnology, Dallas, TX, USA) were incubated at room temperature for 2 h. Secondary antibodies [all 1:5,000 with PBST; mouse anti-rabbit immunoglobulin (Ig)G-horseradish peroxidase (HRP); cat. no. sc-2357; Santa Cruz Biotechnology, Dallas, TX, USA; bovine anti-mouse IgG-HRP; cat. no. sc-2371] were incubated with membranes at room temperature for 2 h. Enhanced chemiluminescence was used for visualization with the ECL EZ-WESTERN Lumi Pico kit (DoGenBio Co., Ltd., Seoul, Korea). The densitometric software used to quantify protein expression was NIH ImageJ software 1.50i (National Institutes of Health, Bethesda, MD, USA).
Measurement of caspase-1, pIκBα and NF-κB levels
Splenocytes (3×105) were treated with DPP, LG and GL and stimulated with CD3 and CD28 antibodies for 45 min at 37°C. The cytosolic expression of caspase-1 and pIκBα was determined, while nuclear levels of NF-κB were measured with western blotting as described above.
Caspase-1 activity assay
Splenocytes (3×105) were treated with DPP, LG and GL and stimulated with CD3 and CD28 antibodies for 45 min at 37°C. The caspase-1 activity in cytoplasm was measured using a caspase-1 kit according to the manufacturer's protocol (cat. no. K110-100; R&D Systems, Minneapolis, Minnesota, USA).
Cytokine levels
Cytokines levels in the serum and spleen following the treadmill exercise test at day 21, and cytokine production by splenocytes (2×105) treated with DPP, LG and GL and stimulated with CD3 and CD28 antibodies for 24 h at 37°C, were measured by ELISA [kits used: IL-1β, mouse IL-1β antibody (cat. no. MAB401; R&D Systems, Inc.), mouse IL-1β biotinylated antibody (cat. no. BAF401; R&D Systems, Inc.), TNF-α-purified rat anti-mouse/rat TNF (cat. no. 551225; BD Pharmingen), biotin rat anti-mouse TNF (cat. no. 554415; BD Pharmingen) IL-6-purified rat anti-mouse IL-6 (cat. no. 554400; BD Pharmingen), biotin rat anti-mouse IL-6 (cat. no. 554402; BD Pharmingen), IL-4-purified rat anti-mouse IL-4 (cat. no. 554387; BD Pharmingen), biotin rat anti-mouse (cat. no. 554390, BD Pharmingen) IFN-γ-purified rat anti-mouse IFN-γ (cat. no. 551216; BD Pharmingen) and biotin rat anti-mouse (cat. no. IFN-γ 554410; BD Pharmingen)], as previously described (27).
Nitric oxide assay
Following the treadmill exercise test at day 21, nitric oxide levels in the serum of mice were measured using the Griess method (27).
L6 cell culture
L6 cells, originally derived from rat skeletal muscle, have been previously employed in studies concerning muscle in animal models (28). In the present study, L6 cells were obtained from the Korean Cell Line Bank (Seoul, Korea). Cells were cultured in Dulbecco's modified Eagle medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% FBS, 100 U/ml penicillin and 100 µg/ml streptomycin at 37°C in 5% CO2/95% air and 95% humidity.
MTT assay
L6 cells (1×104) or splenocytes (2×105) were treated with DPP (0.1, 1 and 10 µg/ml), LG (0.1, 1 and 10 µg/ml) or GL (0.1, 1 and 10 µg/ml) for 24 h, followed by incubation with MTT solution (5 mg/ml; Sigma-Aldrich; Merck KGaA) for 4 h at 37°C in a 5% CO2 atmosphere. Following dissolving formazan with dimethyl sulfoxide, cell viability was measured at 540 nm using an ELISA reader.
Proliferation assay
Splenocytes (2×105) were treated with DPP, LG and GL and stimulated with CD3 and CD28 antibodies for 48 h at 37°C. Splenocyte proliferation was determined by measuring bromodeoxyuridine (BrdU) incorporation into cellular DNA during cell proliferation using a Cell Proliferation ELISA, BrdU (colorimetric; cat. no. 11647229001; Roche Diagnostics GmbH, Mannheim, Germany), which was performed according to the manufacturer's protocol.
Quantitative polymerase chain reaction (qPCR)
Total RNA from splenocytes was isolated using an easy-BLUE™ RNA extraction kit (Intron Biotechnology, Inc., Sungnam, Korea). Total RNA concentrations were evaluated using a NanoDrop spectrophotometer (NanoDrop Technologies; Thermo Fisher Scientific, Inc., Wilmington, DE, USA). AccuPower® RT-PCR PreMix from Bioneer (Daejeon, Republic of Korea) was used for RT at 42°C for 1 h. qPCR was performed on an ABI StepOne Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.) using SYBR-Green master mix (Applied Biosystems, cat. no. 4368577) for the detection of marker of proliferation Ki-67 (Ki-67) mRNA following synthesis of cDNA. The following PCR primers were used: Mouse Ki-67 forward, 5′CTTCACTCTTACTTTCCACA'3 and reverse, 5′AACACCTACAAAATGACTTC'3; and mouse GAPDH forward, 5′TCGACAGTCAGCCGCATCTTCTTT'3 and reverse, 5′ACCAAATCCGTTGACTCCGACCTT'3. Cycling parameters were 95°C for 2 min, following by 40 cycles of 95°C for 30 sec, 60°C for 20 sec, and 72°C for 20 sec. The ratio of Ki-67 mRNA to GAPDH mRNA was calculated. Data were analyzed using the 2−ΔΔCq method (29). This experiment was repeated three times.
Forced swim test (FST)
A total of 35 male ICR mice were familiarized with forced swimming prior to administration of each sample, such as DPP, LG, and GL. When mice were placed into the cylinders for the first time, the mice swam around vigorously. Following 2–3 min, the mice cease the vigorous activity and exhibit a characteristic immobility in which the mouse moves only to maintain its head above water. The mice with the shortest and longest immobility times were excluded. Mice were assigned to one of seven groups (n=5/group), including the control, DPP (1 and 10 mg/kg), LG (1 and 10 mg/kg), and GL (1 and 10 mg/kg) groups based on the first recorded immobility times in pre-FST that performed prior to administration of each sample. Mice were orally administered DW as a control group, DPP (1 and 10 mg/kg), LG (1 and 10 mg/kg) or GL (1 and 10 mg/kg) for 21 consecutive days, and FST immobility times were determined for 6 min on the 21st day. The immobility times were calculated by measuring the duration of the period of vigorous activity during which the mice try to escape. This is an indication of physical immobility in FST (30). The FST immobility times were considered to indicate the degree of fatigue on the 21st day (23).
Statistical analysis
Sample size (n=5 mice per group, power 95%) was determined in a pilot study using two independent sample t-tests and a power analysis. In vivo data are presented as the mean ± standard error of the mean (SEM; n=5 per group). In vitro data are presented as the mean ± SEM of at least three independent experiments performed in duplicate or triplicate. Data normality was checked using the Shapiro-Wilk test and statistical analysis was performed by one-way analysis of variance with Fisher's least significant difference post-hoc test using SPSS statistical software 23 (IBM Corp., Armonk, NY, USA). P<0.05 was considered to indicate a statistically significant difference.
Results
DPP, LG and GL ameliorate fatigue following treadmill exercise
To determine the anti-fatigue effects following treadmill exercise, dopamine levels in the brain were measured following treadmill exercise. As demonstrated in Fig. 1A, DPP (10 mg/kg), LG (1 and 10 mg/kg) and GL (1 and 10 mg/kg) significantly increased the dopamine levels in the brain, compared with the control group (P<0.05). In addition, DPP (1 and 10 mg/kg), LG (1 and 10 mg/kg) and GL (1 and 10 mg/kg) significantly increased the protein expression of BDNF and pERK in the brain following treadmill exercise, compared with the control group (P<0.05; Fig. 1B and C). Furthermore, the time to exhaustion in response to treadmill running was significantly extended by treatment with DPP (10 mg/kg), LG (1 mg/kg) and GL (10 mg/kg), compared with the control group (P<0.05; Fig. 1D). However, DPP (0.1 and 1 mg/kg), LG (10 mg/kg), and GL (1 mg/kg) did not significantly extend the time to exhaustion in treadmill running, compared with the control group.
DPP, LG and GL reduce inflammatory responses following treadmill exercise
As dopamine has been reported to control inflammatory responses in fatigue (31,32), the present study investigated whether DPP, LG and GL regulates levels of proinflammatory cytokines in the serum and spleen following treadmill exercise. As demonstrated in Table I, DPP, LG and GL significantly inhibited treadmill exercise-induced serum IL-1β, TNF-α, IL-6 and IL-4 levels, compared with the control group (P<0.05). In addition, DPP, LG and GL also significantly suppressed the IL-1β, TNF-α, IL-6 and IL-4 levels in the spleen compared with the control group (P<0.05; Table I). However, compared with the control group, IFN-γ levels in the serum and spleen were significantly increased by DPP, LG and GL treatment (P<0.05; Table I).
DPP, LG and GL regulate fatigue-associated muscle biochemical parameters following treadmill exercise
The present study also investigated whether DPP, LG and GL regulates muscle fatigue-associated biochemical parameters following treadmill exercise. The results demonstrated that DPP, LG and GL significantly reduced muscle LDH, lactate and CK levels, and significantly increased muscular glycogen levels, compared with the control group (P<0.05; Fig. 2A-D). Subsequently, the present study investigated whether DPP, LG and GL may regulate muscle damage in an in vitro model using L6 cells. The results of the MTT assay demonstrated that DPP, LG and GL significantly increased L6 cell viability compared with the control group (P<0.05; Fig. 2E). In addition, DPP, LG and GL significantly increased liver glycogen and catalase levels, compared with the control group (P<0.05; Fig. 2F and G).
DPP, LG and GL reduce fatigue-associated biochemical parameters in the serum following treadmill exercise
As fatigue results from LDH or lactate increases in the serum following exercise, serum LDH and lactate levels were also measured in DPP, LG and GL-treated mice following treadmill exercise. As demonstrated in Fig. 3A and B, DPP, LG and GL significantly inhibited serum LDH and lactate levels compared with the control group (P<0.05). In addition, DPP, LG and GL significantly reduced serum nitric oxide levels and increased serum SOD levels, compared with the control group (P<0.05; Fig. 3C and D). Furthermore, DPP, LG and GL significantly inhibited serum BUN, ALT and AST levels (P<0.05; Table II), while only DPP significantly inhibited serum cortisol levels (P<0.05; Table II), compared with the control group. In addition, DPP, LG and GL significantly reduced serum glucose levels compared with the control group (P<0.05; Table II).
Table II.DPP, LG and GL regulate fatigue-associated biochemical parameters following treadmill exercise. |
DPP, LG and GL increase splenocyte proliferation
To assess the regulatory effects of DPP, LG and GL on splenocyte proliferation, splenocytes were stimulated with anti-CD3 and anti-CD28 antibodies, and BrdU incorporation and Ki-67 mRNA expression was subsequently determined. The results demonstrated that treatment with DPP, LG and GL significantly promoted BrdU incorporation and increased Ki-67 mRNA expression in activated splenocytes, compared with control splenocytes that were stimulated with CD3 and CD28 antibodies (P<0.05; Fig. 4A and B). MTT assay results demonstrated that DPP, LG and GL exhibited no cytotoxic effect on activated splenocytes (Fig. 4C).
DPP, LG and GL regulate fatigue-associated cytokine levels in splenocytes
Based on the observations that DPP, LG and GL reduced proinflammatory cytokine levels in the serum and spleen of mice following treadmill exercise, the present study further investigated the anti-inflammatory effects of DPP, LG and GL in activated splenocytes. The results of ELISA demonstrated that all three treatments significantly inhibited the production of IL-1β, TNF-α, IL-6 and IL-4 by activated splenocytes (P<0.05; Fig. 5A-D). In addition, the current study also investigated whether DPP, LG and GL regulates the expression of upstream regulators of proinflammatory cytokines. The results demonstrated that DPP, LG and GL significantly suppressed caspase-1 activity and the protein expression of caspase-1 in activated splenocytes (P<0.05; Fig. 5E-G), and also inhibited the nuclear translocation of NF-κB and reduced the levels of pIκBα in the cytoplasm (P<0.05; Fig. 5H and I).
DPP, LG and GL regulate fatigue following FST
To further define the anti-fatigue activity of DPP, LG and GL, another fatigue model, FST, was employed. As demonstrated in Fig. 6A, the immobility times during the FST were significantly reduced by treatment with DPP, LG and GL during the FST, compared with the control group (P<0.05). Furthermore, DPP significantly attenuated serum lactate levels following the FST, while LG and GL exhibited no significant effect, compared with the control group (P<0.05; Fig. 6B).
Discussion
In the present study, DPP, LG and GL improved treadmill exercise-induced exhaustive time through enhancing dopamine, BDNF and pERK levels in the brain, and decreasing LDH, lactate, CK, BUN, ALT and AST levels in the muscles or serum. Furthermore, DPP, LG and GL enhanced glycogen levels in the muscles, glycogen levels and catalase activity in the liver, and SOD activity in serum, and inhibited proinflammatory cytokine levels in the serum and spleen. The results indicated that DPP, LG and GL may inhibit proinflammatory cytokine production by reducing the activation of caspase-1 and NF-κB in activated splenocytes. Additionally, DPP, LG and GL also reduced immobility time during the FST.
Endurance exercise induces neurochemical alterations, which include disruption of dopamine function in the brain (33). Fatigue during prolonged exercise in rats was reported to be associated with reduced dopamine levels in the brain (34), and increased dopamine levels improved endurance treadmill exercise performance in animals (35), while reduced dopamine levels in the brain impaired treadmill running time to exhaustion in animals (36). BDNF is reported to be involved in the maintenance and maturation of peripheral and central neurons in the developing nervous system (37). It was demonstrated that dopamine-secreting neurons involved in movement generation express BDNF (38). Furthermore, BDNF levels were depressed in chronic fatigue syndrome (37). A previous study demonstrated that BDNF levels may be associated with the activation of the ERK signaling pathway (39), and ERK becomes activated by phosphorylation in response to various neurotransmitters, including dopamine (40). It was previously demonstrated that enhancing dopamine levels by dopaminergic medication reduced fatigue in patients with chronic fatigue syndrome (41). Additional studies reported that creatine supplement increased brain dopamine synthesis during exercise and diminished central fatigue, with reduced accumulation of lactate in humans (42,43). Furthermore, rutin attenuated physical fatigue by upregulating the expression of pERK (44). In the present study, DPP, LG and GL enhanced dopamine, BDNF and pERK levels in the brain following treadmill exercise-induced fatigue. These findings indicate that DPP, LG and GL may exhibit anti-physical fatigue activity through regulation of central dopaminergic systems. However, the time to exhaustion did not change in parallel with dopamine levels in the present study. Thus, further investigation is required to clarify specific functions of DPP, LG and GL on dopaminergic systems of fatigue. Additionally, further experiments at lower doses of LG and GL are required as the dopamine levels were enhanced in mice that were treated with 1 and 10 mg/kg of LG and GL.
The effects of proinflammatory cytokines on ganglia dopamine are particularly relevant to fatigue (31). In patients with psychological stress, proinflammatory cytokine expression was associated with fatigue (32). In addition, proinflammatory cytokines were reported to lead to a significant reduction of BDNF expression (45). The low levels of dopamine observed in the brains of patients with chronic fatigue were reported to be associated with inflammatory responses or oxidative stress (46), and oxidative stress induced by excessive exercise was associated with the production of nitric oxide metabolites (47). Antioxidant enzymes, including SOD and catalase, remove free radicals and constitute an intracellular defense system (48); Wu et al (49) reported that an antioxidant regulated fatigue-associated factors and functioned as an anti-fatigue agent. In the present study, DPP, LG and GL inhibited IL-1β, TNF-α, IL-6, IL-4 and nitric oxide levels in the serum and/or spleen of fatigued mice, and enhanced SOD and catalase levels. In addition, proinflammatory cytokine production has been previously reported to occur via the activation of caspase-1 and the NF-κB/IκBα pathway in splenocytes (50). In the present study, DPP, LG and GL reduced the production of IL-1β, TNF-α, IL-6 and IL-4, and the activation of caspase-1 and NF-κB nuclear translocation, in activated splenocytes. Therefore, the results of the present study demonstrate that DPP, LG and GL may prevent inflammatory responses and oxidative stress through blocking caspase-1/NF-κB signaling and regulating dopaminergic systems, subsequently moderating fatigue-associated factors.
The association between physical exercise and fatigue may be investigated by examining muscle metabolites. Lactate is considered to be an active metabolite that has a primary role in the induction of muscle fatigue (51). In addition, physical fatigue-associated biomarkers, including serum lactate, BUN and glucose, and tissue damage markers, such as AST, ALT and CK, have been previously investigated in fatigue models (52). Glutamine supplementation attenuated increases in prolonged exercise-induced CK levels and inflammatory markers levels (53). In addition, curcumin supplementation decreased lactate, BUN, AST and ALT levels following physical challenge, improved exercise performance and prevented fatigue (54). In the present study, DPP, LG and GL reduced LDH, lactate, CK, BUN, ALT and AST levels in the serum and/or muscle following treadmill exercise, and reduced lactate levels and immobility time following intensive swimming, which indicates that DPP, LG and GL may exhibit anti-fatigue effects. In addition, DPP, LG and GL enhanced L6 viability in the current study, indicating the potential amelioration of muscle damage.
CD28 molecule and CD3 T-cell receptors trigger T-lymphocyte proliferation and amplify antigen-specific immune responses (55). Arginine was reported to promote splenocyte proliferation and improve immunity in a mouse model (56). Serum IFN-γ levels and blood CD4-positive T-cell counts were lower in fatigued athletes compared with healthy controls, indicating a potential T-cell deficiency (57). Furthermore, INF-γ null mice exhibited impaired muscle healing associated with muscle fibrosis (58). In the present study, DPP, LG and GL enhanced CD3 and CD28 antibody-induced splenocyte proliferation without any cytotoxic effect. In addition, in vivo experiments demonstrated that DPP, LG and GL enhanced IFN-γ levels in the serum and spleen of fatigued mice. These results indicate that DPP, LG and GL may exert beneficial effects on the immune system by increasing T-lymphocyte proliferation and IFN-γ levels, subsequently ameliorating physical fatigue.
Nutritional deficiencies have been reported to induce alterations in brain neurochemistry in conjunction with various psychological disorders or fatigue (59), which highlights the role of nutrition in fatigue induced by exercise (60). Leucine supplementation reduced inflammatory reactions and muscle pain following intensive exercise (61) and a supplement that included glycine improved exercise performance and reduced oxidative stress (62). In addition, peptides from Pseudosciaena crocea prolonged exhaustive swimming time in mice and exhibited notable anti-fatigue effects (23). The peptide glutamine is considered to be an essential nutrient for the prevention of fatigue in athletes (63). Therefore, oral intake of LG, GL and DPP may be considered promising treatment strategies for fatigue. An effective dose of DPP as a health food for fatigue prevention may be 10 mg/kg based on the present study. However, further investigation is required to determine the clinical applications of DPP in humans.
DPP contains various compounds, including active and inactive compounds. LG and GL are active compounds, and the doses of LG and GL used in the present study were higher than those that are present within DPP, as demonstrated by the results; overall, in the present study, the DPP group did not exhibit an increased effect compared with the LG or GL groups at the same dose, which may be explained by the difference between the amount of LG and GL present within DPP and the doses of LG and GL used in the present study.
In conclusion, the present study investigated the regulatory effects of DPP, LG and GL on fatigue-associated factors using treadmill exercise-induced and forced swimming-induced models of fatigue, in addition to the inhibitory effects of DPP, LG and GL on fatigue-associated inflammatory factors in splenocytes. Overall, the results of the present study demonstrated that DPP, LG and GL may prevent physical fatigue by inhibiting inflammatory responses through increasing dopaminergic systems following intensive exercise, indicating that DPP may be considered a potential treatment for fatigue.
References
Gandevia SC: Spinal and supraspinal factors in human muscle fatigue. Physiol Rev. 81:1725–1789. 2001. View Article : Google Scholar : PubMed/NCBI | |
Meeusen R and Watson P: Amino acids and the brain: Do they play a role in ‘central fatigue’? Int J Sport Nutr Exerc Metab. 17 Suppl:S37–S46. 2007. View Article : Google Scholar : PubMed/NCBI | |
Balthazar CH, Leite LH, Rodrigues AG and Coimbra CC: Performance-enhancing and thermoregulatory effects of intracerebroventricular dopamine in running rats. Pharmacol Biochem Behav. 93:465–469. 2009. View Article : Google Scholar : PubMed/NCBI | |
Chaouloff F: Physical exercise and brain monoamines: A review. Acta Physiol Scand. 137:1–13. 1989. View Article : Google Scholar : PubMed/NCBI | |
Basu S and Dasgupta PS: Dopamine, a neurotransmitter, influences the immune system. J Neuroimmunol. 102:113–124. 2000. View Article : Google Scholar : PubMed/NCBI | |
Meeusen R: Exercise, nutrition and the brain. Sports Med. 44 Suppl 1:S47–S56. 2014. View Article : Google Scholar : PubMed/NCBI | |
Razgado-Hernandez LF, Espadas-Alvarez AJ, Reyna-Velazquez P, Sierra-Sanchez A, Anaya-Martinez V, Jimenez-Estrada I, Bannon MJ, Martinez-Fong D and Aceves-Ruiz J: The transfection of BDNF to dopamine neurons potentiates the effect of dopamine D3 receptor agonist recovering the striatal innervation, dendritic spines and motor behavior in an aged rat model of Parkinson's disease. PLoS One. 10:e01173912015. View Article : Google Scholar : PubMed/NCBI | |
Schmidt HD and Duman RS: The role of neurotrophic factors in adult hippocampal neurogenesis, antidepressant treatments and animal models of depressive-like behavior. Behav Pharmacol. 18:391–418. 2007. View Article : Google Scholar : PubMed/NCBI | |
Saligan LN, Lukkahatai N, Holder G, Walitt B and Machado-Vieira R: Lower brain-derived neurotrophic factor levels associated with worsening fatigue in prostate cancer patients during repeated stress from radiation therapy. World J Biol Psychiatry. 27:608–614. 2016. | |
Liburt NR, Adams AA, Betancourt A, Horohov DW and McKeever KH: Exercise-induced increases in inflammatory cytokines in muscle and blood of horses. Equine Vet J Suppl. 38:280–288. 2010. View Article : Google Scholar | |
Felger JC and Miller AH: Cytokine effects on the basal ganglia and dopamine function: The subcortical source of inflammatory malaise. Front Neuroendocrinol. 33:315–327. 2012. View Article : Google Scholar : PubMed/NCBI | |
Koo HN, Lee JK, Hong SH and Kim HM: Herbkines increases physical stamina in mice. Biol Pharm Bull. 27:117–119. 2004. View Article : Google Scholar : PubMed/NCBI | |
Pall ML: Elevated, sustained peroxynitrite levels as the cause of chronic fatigue syndrome. Med Hypotheses. 54:115–125. 2000. View Article : Google Scholar : PubMed/NCBI | |
Coombes JS, Rowell B, Dodd SL, Demirel HA, Naito H, Shanely RA and Powers SK: Effects of vitamin E deficiency on fatigue and muscle contractile properties. Eur J Appl Physiol. 87:272–277. 2002. View Article : Google Scholar : PubMed/NCBI | |
Borah M, Sarma P and Das S: A study of the protective effect of triticum aestivum L. in an experimental animal model of chronic fatigue syndrome. Pharmacognosy Res. 6:285–291. 2014. View Article : Google Scholar : PubMed/NCBI | |
Finaud J, Lac G and Filaire E: Oxidative stress: Relationship with exercise and training. Sports Med. 36:327–358. 2006. View Article : Google Scholar : PubMed/NCBI | |
Tennant KF, Takacs SE, Gau JT, Clark BC and Russ DW: A preliminary study of symptomatic fatigue in rural older adults. Aging Clin Exp Res. 24:324–330. 2012.PubMed/NCBI | |
Han NR, Kim KY, Kim MJ, Kim MH, Kim HM and Jeong HJ: Porcine placenta mitigates protein-energy malnutrition-induced fatigue. Nutrition. 29:1381–1387. 2013. View Article : Google Scholar : PubMed/NCBI | |
Wolfe RR: Protein supplements and exercise. Am J Clin Nutr. 72 2 Suppl:551S–557S. 2000.PubMed/NCBI | |
Kim HY, Han NR, Kim NR, Lee M, Kim J, Kim CJ, Jeong HJ and Kim HM: Effect of fermented porcine placenta on physical fatigue in mice. Exp Biol Med (Maywood). 241:1985–1996. 2016. View Article : Google Scholar : PubMed/NCBI | |
Ye J, Shen C, Huang Y, Zhang X and Xiao M: Anti-fatigue activity of sea cucumber peptides prepared from Stichopus japonicus in an endurance swimming rat model. J Sci Food Agric. 97:4548–4556. 2017. View Article : Google Scholar : PubMed/NCBI | |
van Buel EM, Sigrist H, Seifritz E, Fikse L, Bosker FJ, Schoevers RA, Klein HC, Pryce CR and Eisel UL: Mouse repeated electroconvulsive seizure (ECS) does not reverse social stress effects but does induce behavioral and hippocampal changes relevant to electroconvulsive therapy (ECT) side-effects in the treatment of depression. PLoS One. 12:e01846032017. View Article : Google Scholar : PubMed/NCBI | |
Zhao YQ, Zeng L, Yang ZS, Huang FF, Ding GF and Wang B: Anti-fatigue effect by peptide fraction from protein hydrolysate of croceine croaker (pseudosciaena crocea) swim bladder through inhibiting the oxidative reactions including DNA damage. Mar Drugs. 14:pii: E2212016. View Article : Google Scholar | |
Seo JH, Sung YH, Kim KJ, Shin MS, Lee EK and Kim CJ: Effects of Phellinus linteus administration on serotonin synthesis in the brain and expression of monocarboxylate transporters in the muscle during exhaustive exercise in rats. J Nutr Sci Vitaminol (Tokyo). 57:95–103. 2011. View Article : Google Scholar : PubMed/NCBI | |
Kumar V, Aneesh KA, Kshemada K, Ajith KGS, Binil RSS, Deora N, Sanjay G, Jaleel A, Muraleedharan TS, Anandan EM, et al: Amalaki rasayana, a traditional Indian drug enhances cardiac mitochondrial and contractile functions and improves cardiac function in rats with hypertrophy. Sci Rep. 7:85882017. View Article : Google Scholar : PubMed/NCBI | |
Motaghinejad M, Motevalian M, Asadi-Ghalehni M and Motaghinejad O: Attenuation of morphine withdrawal signs, blood cortisol and glucose level with forced exercise in comparison with clonidine. Adv Biomed Res. 3:1712014. View Article : Google Scholar : PubMed/NCBI | |
Rim HK, Kim KY and Moon PD: Evidence of hydrolyzed traditional Korean red ginseng by malted barley on activation of receptor interacting proteins 2 and IkappaB kinase-beta in mouse peritoneal macrophages. TANG. 2:e372015. | |
Jung HY, Lee AN, Song TJ, An HS, Kim YH, Kim KD, Kim IB, Kim KS, Han BS, Kim CH, et al: Korean mistletoe (Viscum album coloratum) extract improves endurance capacity in mice by stimulating mitochondrial activity. J Med Food. 15:621–628. 2012. View Article : Google Scholar : PubMed/NCBI | |
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C (T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI | |
Teng YS and Wu D: Anti-fatigue effect of green tea polyphenols (−)-Epigallocatechin-3-Gallate (EGCG). Pharmacogn Mag. 13:326–331. 2017. View Article : Google Scholar : PubMed/NCBI | |
Azzinnari D, Sigrist H, Staehli S, Palme R, Hildebrandt T, Leparc G, Hengerer B, Seifritz E and Pryce CR: Mouse social stress induces increased fear conditioning, helplessness and fatigue to physical challenge together with markers of altered immune and dopamine function. Neuropharmacology. 85:328–341. 2014. View Article : Google Scholar : PubMed/NCBI | |
Flachenecker P, Bihler I, Weber F, Gottschalk M, Toyka KV and Rieckmann P: Cytokine mRNA expression in patients with multiple sclerosis and fatigue. Mult Scler. 10:165–169. 2004. View Article : Google Scholar : PubMed/NCBI | |
Marin H and Menza MA: Specific treatment of residual fatigue in depressed patients. Psychiatry (Edgmont). 1:12–18. 2004.PubMed/NCBI | |
Bailey SP, Davis JM and Ahlborn EN: Neuroendocrine and substrate responses to altered brain 5-HT activity during prolonged exercise to fatigue. J Appl Physiol (1985). 74:3006–3012. 1993. View Article : Google Scholar : PubMed/NCBI | |
Gerald MC: Effects of (+)-amphetamine on the treadmill endurance performance of rats. Neuropharmacology. 17:703–704. 1978. View Article : Google Scholar : PubMed/NCBI | |
Heyes MP, Garnett ES and Coates G: Nigrostriatal dopaminergic activity is increased during exhaustive exercise stress in rats. Life Sci. 42:1537–1542. 1988. View Article : Google Scholar : PubMed/NCBI | |
Sorenson M, Jason L, Peterson J, Herrington J and Mathews H: Brain derived neurotrophic factor is decreased in chronic fatigue syndrome and multiple sclerosis. J Neurol Neurophysiol. 12 Suppl:S2–S13. 2014. | |
Foley TE and Fleshner M: Neuroplasticity of dopamine circuits after exercise: Implications for central fatigue. Neuromolecular Med. 10:67–80. 2008. View Article : Google Scholar : PubMed/NCBI | |
Shen X, Li A, Zhang Y, Dong X, Shan T, Wu Y, Jia J and Hu Y: The effect of different intensities of treadmill exercise on cognitive function deficit following a severe controlled cortical impact in rats. Int J Mol Sci. 14:21598–21612. 2013. View Article : Google Scholar : PubMed/NCBI | |
Feng P, Guan Z, Yang X and Fang J: Impairments of ERK signal transduction in the brain in a rat model of depression induced by neonatal exposure of clomipramine. Brain Res. 991:195–205. 2003. View Article : Google Scholar : PubMed/NCBI | |
Dobryakova E, Genova HM, DeLuca J and Wylie GR: The dopamine imbalance hypothesis of fatigue in multiple sclerosis and other neurological disorders. Front Neurol. 6:522015. View Article : Google Scholar : PubMed/NCBI | |
Rahimi E, Moghadasi M, Mahani MN, Torkfar A and Yadolazadeh A: Central and peripheral fatigue factors after an exhaustive aerobic exercise following creatine supplementation. Ann Biol Res. 3:4209–4214. 2012. | |
Watanabe A, Kato N and Kato T: Effects of creatine on mental fatigue and cerebral hemoglobin oxygenation. Neurosci Res. 42:279–285. 2002. View Article : Google Scholar : PubMed/NCBI | |
Su KY, Yu CY, Chen YW, Huang YT, Chen CT, Wu HF and Chen YL: Rutin, a flavonoid and principal component of saussurea involucrata, attenuates physical fatigue in a forced swimming mouse model. Int J Med Sci. 11:528–537. 2014. View Article : Google Scholar : PubMed/NCBI | |
Calabrese F, Rossetti AC, Racagni G, Gass P, Riva MA and Molteni R: Brain-derived neurotrophic factor: A bridge between inflammation and neuroplasticity. Front Cell Neurosci. 8:4302014. View Article : Google Scholar : PubMed/NCBI | |
Jason LA, Porter N, Herrington J, Sorenson M and Kubow S: Kindling and oxidative stress as contributors to myalgic encephalomyelitis/chronic fatigue syndrome. J Behav Neurosci Res. 7:1–17. 2009.PubMed/NCBI | |
Suárez A, Guillamó E, Roig T, Blázquez A, Alegre J, Bermúdez J, Ventura JL, García-Quintana AM, Comella A, Segura R and Javierre C: Nitric oxide metabolite production during exercise in chronic fatigue syndrome: A case-control study. J Womens Health (Larchmt). 19:1073–1077. 2010. View Article : Google Scholar : PubMed/NCBI | |
Liu J, Yeo HC, Overvik-Douki E, Hagen T, Doniger SJ, Chu DW, Brooks GA and Ames BN: Chronically and acutely exercised rats: Biomarkers of oxidative stress and endogenous antioxidants. J Appl Physiol (1985). 89:21–28. 2000. View Article : Google Scholar : PubMed/NCBI | |
Wu C, Chen R, Wang XS, Shen B, Yue W and Wu Q: Antioxidant and anti-fatigue activities of phenolic extract from the seed coat of Euryale ferox Salisb. and identification of three phenolic compounds by LC-ESI-MS/MS. Molecules. 18:11003–11021. 2013. View Article : Google Scholar : PubMed/NCBI | |
Lamkanfi M, Sarkar A, Vande Walle L, Vitari AC, Amer AO, Wewers MD, Tracey KJ, Kanneganti TD and Dixit VM: Inflammasome-dependent release of the alarmin HMGB1 in endotoxemia. J Immunol. 185:4385–4392. 2010. View Article : Google Scholar : PubMed/NCBI | |
Sola-Penna M: Metabolic regulation by lactate. IUBMB Life. 60:605–608. 2008. View Article : Google Scholar : PubMed/NCBI | |
Huang CC, Lin TJ, Lu YF, Chen CC, Huang CY and Lin WT: Protective effects of L-arginine supplementation against exhaustive exercise-induced oxidative stress in young rat tissues. Chin J Physiol. 52:306–315. 2009. View Article : Google Scholar : PubMed/NCBI | |
Cruzat VF, Rogero MM and Tirapegui J: Effects of supplementation with free glutamine and the dipeptide alanyl-glutamine on parameters of muscle damage and inflammation in rats submitted to prolonged exercise. Cell Biochem Funct. 28:24–30. 2010. View Article : Google Scholar : PubMed/NCBI | |
Huang WC, Chiu WC, Chuang HL, Tang DW, Lee ZM, Wei L, Chen FA and Huang CC: Effect of curcumin supplementation on physiological fatigue and physical performance in mice. Nutrients. 7:905–921. 2015. View Article : Google Scholar : PubMed/NCBI | |
June CH, Ledbetter JA, Gillespie MM, Lindsten T and Thompson CB: T-cell proliferation involving the CD28 pathway is associated with cyclosporine-resistant interleukin 2 gene expression. Mol Cell Biol. 7:4472–4481. 1987. View Article : Google Scholar : PubMed/NCBI | |
Suarez Butler MF, Langkamp-Henken B, Herrlinger-Garcia KA, Klash AE, Szczepanik ME, Nieves C Jr, Cottey RJ and Bender BS: Arginine supplementation enhances mitogen-induced splenocyte proliferation but does not affect in vivo indicators of antigen-specific immunity in mice. J Nutr. 135:1146–1150. 2005. View Article : Google Scholar : PubMed/NCBI | |
Clancy RL, Gleeson M, Cox A, Callister R, Dorrington M, D'Este C, Pang G, Pyne D, Fricker P and Henriksson A: Reversal in fatigued athletes of a defect in interferon gamma secretion after administration of Lactobacillus acidophilus. Br J Sports Med. 40:351–354. 2006. View Article : Google Scholar : PubMed/NCBI | |
Cheng M, Nguyen MH, Fantuzzi G and Koh TJ: Endogenous interferon-gamma is required for efficient skeletal muscle regeneration. Am J Phys Cell Phys. 294:C1183–C1191. 2008. View Article : Google Scholar | |
Fernstrom JD: Dietary amino acids and brain function. J Am Diet Assoc. 94:71–77. 1994. View Article : Google Scholar : PubMed/NCBI | |
Davis JM, Alderson NL and Welsh RS: Serotonin and central nervous system fatigue: Nutritional considerations. Am J Clin Nutr. 72 2 Suppl:573S–578S. 2000.PubMed/NCBI | |
Cruzat VF, Krause M and Newsholme P: Amino acid supplementation and impact on immune function in the context of exercise. J Int Soc Sports Nutr. 11:612014. View Article : Google Scholar : PubMed/NCBI | |
Smith WA, Fry AC, Tschume LC and Bloomer RJ: Effect of glycine propionyl-L-carnitine on aerobic and anaerobic exercise performance. Int J Sport Nutr Exerc Metab. 18:19–36. 2008. View Article : Google Scholar : PubMed/NCBI | |
Favano A, Santos-Silva PR, Nakano EY, Pedrinelli A, Hernandez AJ and Greve JM: Peptide glutamine supplementation for tolerance of intermittent exercise in soccer players. Clinics (Sao Paulo). 63:27–32. 2008. View Article : Google Scholar : PubMed/NCBI |