This article is mentioned in:

Introduction

Osteoblasts are the differentiated cell types responsible for bone formation, originating from resident bone marrow-derived mesenchymal stem cells (BMSCs) or bone marrow stromal cells (1,2). Regulation of osteoblast differentiation and activity has been hypothesized as a prospective therapy of bone injury and loss. In order to develop such therapies, novel molecular targets that regulate osteoblast differentiation and activity need to be identified.

Casein kinase 2-interacting protein 1 (CKIP-1) is a negative regulator for bone formation under physiological conditions. In CKIP-1 knockout mice, bone mineral density and mass increased markedly, as did the activity of osteoblasts (3). CKIP-1 interacts with mothers against decapentaplegic homolog ubiquitination regulatory factor 1 to induce negative regulation in bone formation (4). In addition, as a result of inhibition of CKIP-1 expression in osteoblasts, bone mass increased markedly and the rate of bone formation accelerated (5,6).

MicroRNAs (miRs), classified as small noncoding RNAs, regulate gene expression by targeting the 3′-untranslated region (UTR) of mRNA (7,8). MiRs serve a role in cell development and growth processes, including cell proliferation, apoptosis and differentiation (9,10). Previous studies have identified miRNAs that regulate osteoblast differentiation (11,12). CKIP-1 is a negative regulator for osteoblast differentiation and therefore, an miR targeting CKIP-1 may improve osteoblast differentiation.

The authors of the present study previously demonstrated that CKIP-1 is a putative target gene of miR-98-5p using bioinformatics analysis (unpublished data). It has been hypothesized that miR-98-5p may be involved in osteoblast differentiation through regulation of CKIP-1 expression. In the present study, mouse MC3T3-E1 pre-osteoblasts were used to investigate the potential role and underlying mechanism of miR-98-5p-mediated regulation of osteoblast differentiation.

Materials and methods

Cell culture

Mouse pre-osteoblast cell line, MC3T3-E1 (Institute of Basic Medicine of Peking Union Medical College, Beijing, China), was cultured with α-minimal essential medium (α-MEM; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and 1% penicillin (Thermo Fisher Scientific, Inc.) at 37°C in a humidified atmosphere containing 5% CO2. For all experiments, MC3T3-E1 cells were seeded at the density of 2.5×104 cells/cm2 in cell culture dishes and cultivated until 80% confluence was reached. To induce osteoblast differentiation, confluent cells were cultured at 37°C in a humidified atmosphere containing 5% CO2, in an osteoinductive medium supplemented with 10% FBS, 50 µg/ml ascorbic acid, 5 mM sodium b-glycerophosphate and 2 mM/l glutamine, which was replaced once every three days (13).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Cultured cells were lysed by TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and total RNA was isolated according to the manufacturer's protocol. cDNA was synthesized using the TIANScript II RT kit (Tiangen Biotech Co., Ltd., Beijing, China). For miRNA expression analysis, cDNA synthesis was performed using the TaqMan MicroRNA reverse transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.). qPCR was performed to detect mRNA levels of osteocalcin (OCN), collagen type I (Col I) and GAPDH or miR-98-5p levels using SYBR Green I PCR Mix (Beijing CoWin Biotech Co., Ltd., Beijing, China) according to the manufacturer's protocol. Primer sequences are listed in Table I and the primers for miR-98-5p (miRBase accession no. MIMAT0000545) were provided by Guangzhou RiboBio Co., Ltd. (Guangzhou, China). The following thermocycling conditions were used for the PCR: Initial denaturation at 94°C for 180 sec; 40 cycles of 94°C for 15 sec, annealing at 60°C for 30 sec, and extension at 72°C for 30 sec. Relative expression was normalized to mRNA levels of GAPDH using the 2−ΔΔCq method (14).

Table I. Primer sequences for quantitative polymerase chain reactions.

Table I.

Primer sequences for quantitative polymerase chain reactions.

		Primer sequence
Gene name	Length (base pairs)	Forward (5′→3′)	Reverse (3′→5′)
CKIP-1	116	AACCGCTATGTGGTGCTGAA	CAGGGTGAACTTGCTGATTT
Col-I	184	CACATGCGTGCAGAACGGCG	CGCGTCTTCGGGGCAGACAG
OCN	134	AGTCTGACAAAGCCTTCA	AAGCAGGGTTAAGCTCACA
GAPDH	118	CAACTCCCTCAAGATTGTCAGCAA	GGCATGGACTGTGGTCATGA

[i] CKIP-1, casein kinase 2-interacting protein 1; Col-I, collagen type I; OCN, osteocalcin.

Detection of osteoblast differentiation

To investigate the role of miR-98-5p expression on osteoblast differentiation, confluent MC3T3-E1 cells were pre-treated with 100 nM miR-98-5p agomir, antagomir, agomir control or antagomir control (Guangzhou RiboBio Co., Ltd.) for 24 h at 37°C in α-MEM culture medium. Control MC3T3-E1 cells were cultured in α-MEM culture medium only, without pre-treatment. Cells were subsequently cultured in osteoinductive medium for 3, 5, 7 and 14 days, as described above. Cells were harvested, washed with a PBS and lysed with a lysis buffer (10 mmol/l 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, 250 mmol/l sucrose, 5 mmol/l Tris-HCl, 0.1%TritonX-100, pH 7.5). Alkaline phosphatase (ALP) activity of lysates was measured using the ALP Activity Assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) at 25°C using the p-nitrophenyl phosphate method according to manufacturer's protocol. Matrix mineralization was detected with Alizarin red S staining. Briefly, cells were fixed with 70% ethanol for 30 min at room temperature and washed with PBS. Subsequently, cells were stained with Alizarin red S solution (40 mM) for 15 min at room temperature. Excessive stain was washed off with PBS. Alizarin red S-stained mineral deposits were extracted and dissolved in 0.1 N NaOH and the absorbance was measured at a wavelength of 540 nm using an ELISA reader (Multiskan GO 1510; Thermo Fisher Scientific, Inc.).

Western blot analysis

Following washing twice with PBS, cells were lysed in ice-cold radioimmunoprecipitation assay lysis buffer (Beyotime Institute of Biotechnology, Nanjing, China). Protein concentration was quantified using bicinchoninic acid method. Equal amounts of protein (20 µg/lane) were separated on 10% SDS-PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes (EMD Millipore, Billerica, MA, USA). PVDF membranes were blocked with 3% skimmed milk for 1 h at 37°C and incubated overnight at 4°C with the following primary antibodies: Anti-CKIP-1 (cat. no. sc-376355; 1:500), anti-runt-related transcription factor 2 (Runx 2; cat. no. sc-390351; 1:500), anti-osteopontin (OPN; cat. no. sc-21742; 1:500) and anti-GAPDH (cat. no. sc-59540; 1:1,000), all purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA) at 4°C. Membranes were washed with PBS with Tween-20 (PBST) and incubated with horseradish peroxidase conjugated secondary antibodies (cat. no. sc-2371; 1:2,000, BIOSS, Beijing, China) for 1 h at room temperature. Following washing with PBST, bands were detected with an enhanced chemiluminescence reagent (Wuhan Boster Biological Technology, Ltd., Wuhan, China). Band intensities were quantified using Image-Pro Plus software (version 6.0; Media Cybernetics, Inc., Rockville, MD, USA). The data were presented following normalization with the control group.

Target prediction of miR-98-5p

The target mRNA of miR-98-5p was predicted by searching the online databases TargetScan (http://www.targetscan.org/) and miRDB (http://www.mirdb.org/). mRNAs with a 3′-untranslated region (3′-UTR) that matched the 2–7 base of the miR-98-5p 5′-terminal region with high thermodynamic stability were selected. Subsequently, CKIP-1 was predicted as a target mRNA of miR-98-5p.

Dual-luciferase reporter assay

The 3′-UTR region of CKIP-1, containing the binding site of miR-98-5p, was amplified and subcloned into a pmiR-RB-REPORT plasmid (Guangzhou RiboBio Co., Ltd., Guangzhou, China), according to the manufacturer's protocol. The corresponding mutated 3′UTR of CKIP-1 was also amplified and subcloned into the plasmid. Human 293 cells (the 293 cells in the present study were only used for the luciferase assay) were seeded into 6-well cell culture plates at 1×105 cells/well and subsequently transfected with miR-98-5p mimics (sequence, UGAGGUAGUAAGUUGUAUUGUU) or miR-98NC (sequence, UCACAACCUCCUAGAAAGAGUAGA; Guangzhou RiboBio Co., Ltd.) at a final concentration of 50 nM for 24 h. Subsequently, the pmiR-RB CKIP-1 3′-UTR plasmid was transfected into 293 cells at concentration of 1 ng/µl using a Lipofectamine® 2000 transfection reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. A total of 2 days following transfection, the luciferase activity of the cells was determined using a dual-luciferase reporter assay kit (Promega Corporation, Madison, WI, USA) and was normalized to Renilla luciferase activity, according to the manufacturer's protocol.

Statistical analysis

All data are presented as the mean ± standard deviation from three separate experiments (n=3). Data was tested for normal distribution using Shapiro-Wild test and differences between groups were analyzed using one-way analysis of variance and determined by Duncan's multiple range test. Statistical analysis was performed using SPSS software (version 18; SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

MiR-98-5p promotes osteoblast differentiation

In order to determine whether miR-98-5p is involved in regulation of osteoblast differentiation, the expression of miR-98-5p in MC3T3-E1 cells following osteoblast differentiation was detected by RT-qPCR. In the present study, following culture of MC3T3-E1 cells in osteoinductive medium, alkaline phosphatase activity and matrix mineralization of cells was elevated at each time point (Fig. 1A and B), indicating that MC3T3-E1 cells differentiated into osteoblasts. The expression level of miR-98-5a was also significantly elevated at each time point following osteoblast differentiation (all P<0.01; Fig. 1C), which suggested that miR-98-5p may serve a role in osteoblast differentiation.

Figure 1. Levels of osteoblast differentiation markers and relative expression of miR-98-5p following culture of MC3T3-E1 cells in osteoinductive medium for 0, 3, 7 and 14 days. (A) Alkaline phosphatase activity. (B) Matrix mineralization levels. (C) Relative expression of miR-98-5p at different time points and (D) following treatment with miR-98-5p agomir, antagomir and the respective controls for 24 h. Data are presented as the mean ± standard deviation. *P<0.05 and **P<0.01. miR, micro RNA.

To confirm the role of miR-98-5p in the regulation of osteoblast differentiation, MC3T3-E1 cells were treated with miR-98-5p agomir or miR-98-5p antagomir and the treatments increased and decreased the miR-98-5p expressions levels in MC3T3-E1 cells, respectively (Fig. 1D). Furthermore, the present study demonstrated that miR-98-5p agomir markedly increased ALP activity (Fig. 2A) and matrix mineralization (Fig. 2B), at each time point compared with the respective control groups. Elevated mRNA expressions of Col I and OCN (Fig. 3), and increased protein levels of Runx2 and OPN (Fig. 4) were observed in cells following treatment with miR-98-5p, at each time point compared with the respective control groups. Conversely, miR-98-5p antagomir significantly inhibited ALP activity and matrix mineralization, and decreased expression levels of OCN, Col I, Runx2 and OPN (Figs. 2–4).

Figure 2. Alkaline phosphatase activity and matrix mineralization following pretreatment with miR-98-5p agomir or miR-98-5p antagomir and culture in osteoinductive medium for 3, 7 and 14 days. (A) Alkaline phosphatase activity. (B) Matrix mineralization. Data are presented as the mean ± standard deviation. **P<0.01. miR, micro RNA.

Figure 3. Col I and OCN mRNA expression levels following pretreatment with miR-98-5p agomir or miR-98-5p antagomir and culture in osteoinductive medium for 5, 7 and 14 days. Expression levels of (A) Col I and (B) OCN. Data are presented as the mean ± standard deviation. **P<0.01. miR, micro RNA; Col I, collagen I; OCN, osteocalcin.

Figure 4. Following pretreatment with miR-98-5p agomir or antagomir, MC3T3-E1 cells were cultured in an osteoinductive medium for 14 days and protein levels of Runx 2 and OPN were detected. Protein expression levels of (A) Runx 2 and (B) OPN, were demonstrated by (C) western blotting. Data are presented as the mean ± standard deviation. **P<0.01. miR, micro RNA; Runx 2, runt-related transcription factor 2; OPN, osteopontin.

CKIP-1 is a target gene of miR-98-5p

Subsequently, the expression of the target gene of miR-98-5p that contributed to the regulation of osteoblast differentiation was investigated and CKIP-1. To validate the interaction between miR-98-5p and CKIP-1, a dual-luciferase reporter assay was performed in the present study. The results demonstrated that overexpression of miR-98-5p significantly decreased the luciferase activity in cells transfected with pmiR-RB CKIP-1 3′-UTR, whereas it demonstrated no effect on pmiR-RB-mut CKIP-1 3′-UTR (Fig. 5B).

Figure 5. Verification that CKIP-1 is a target gene of miR-98-5p. (A) Schematic diagram of miR-98-5p target site in the 3′-UTR of CKIP-1 mRNA. (B) Dual-luciferase reporter assay to detect the interaction between miR-98-5p and the 3′-UTR of CKIP-1. CKIP-1 (C) mRNA and (D) protein expression levels. Data are presented as the mean ± standard deviation. **P<0.01. UTR, untranslated region; CKIP-1, casein kinase 2-interacting protein 1; mmu, Mus musculus; Mut, mutant.

Following treatment with miR-98-5p agomir or miR-98-5p antagomir, qPCR and western blot analysis demonstrated that miR-98-5p overexpression decreased mRNA and protein levels of CKIP-1, whereas inhibition of miR-98-5p increased mRNA and protein expression of CKIP-1 (Fig. 5C). The aforementioned results indicate that CKIP-1 is the target gene of miR-98-5p.

miR-98-5p regulates osteoblast differentiation by targeting CKIP-1

The present study investigated the mechanism underlying miR-98-5p-mediated regulation of osteoblast differentiation. The association between overexpression and inhibition of miR-98-5p and osteoblast differentiation was investigated. In the present study, following treatment with miR-98-5p agomir, osteoblast differentiation-associated markers, including ALP, matrix mineralization, OCN, Col I, Runx2 and OPN were markedly elevated in MC3T3-E1 cells (Figs. 2–4). Conversely, treatment with miR-98-5p antagomir decreased the levels of osteoblast differentiation-associated markers (Figs. 2–4).

Discussion

ALP, OPN, Runx 2, OCN and matrix mineralization are markers of osteogenic differentiation and therefore they have been previously assayed to evaluate osteoblast differentiation (15–19). Col I, a collagen identified in bone matrices, is also a maker of osteogenesis (20). Therefore, in the present study, ALP, OPN, Runx 2, OCN, Col I and matrix mineralization were selected as indices of osteoblast differentiation.

In the present study, miR-98-5p served the role of regulator of osteoblast differentiation by downregulating the expression of CKIP-1, a negative regulator of osteoblast differentiation. The results of the present study indicated that the expression of miR-98-5p was increased during osteoblast differentiation and miR-98-5p overexpression significantly promoted osteoblast differentiation of MC3T3-E1 cells. Downregulated expression of miR-98-5p negatively regulated osteoblast differentiation. Using a dual-luciferase reporter assay, a direct interaction between miR-98-5p and the 3′-UTR region of CKIP-1 was verified. In the present study, miR-98-5p negatively regulated mRNA and protein expression levels of CKIP-1 in MC3T3-E1 cells. Transfection with miR-98-5p agomir or antagomir disrupted the interaction between CKIP-1 and osteoblast differentiation. The present study demonstrated that miR-98-5p regulates CKIP-1 expression.

The role of miR-98 in different cellular processes in various cell types has been previously investigated. miR-98 repressed the expression of cytokine-inducible Src homology 2-containing protein in cholangiocytes and was involved in responses to microbial challenge and inflammation (21). MiR-98 also negatively regulated interleukin-10 production and endotoxin tolerance in macrophages following stimulation with lipopolysaccharide (22). miR-98 is a tumor suppressive miRNA, knockdown of which leads to a reduction of 1,25-vitamin D anti-growth effect of prostate cancer and overexpression of miR-98 suppressed prostate cancer cell growth (23). miR-98 inhibits human ovarian cancer stem cell proliferation via retinoblastoma-associated protein-E2F transcription factor pathway and suppresses hepatocellular carcinoma by targeting Sal-like protein 4 and collagen triple helix repeat containing 1 (24–26). Currently, a limited amount of data is available regarding miR-98-mediated regulation of osteoblast differentiation.

In the present study, miR-98-5p was involved in the regulation of osteoblast differentiation through targeting and regulating CKIP-1 expression. The results of the present study indicated that CKIP-1 was a target gene of miR-98-5p, through which miR-98-5p regulated osteoblast differentiation in MC3T3-E1 cells.

CKIP-1 regulates a number of processes, including cell proliferation, differentiation and apoptosis. CKIP-1 also serves a role in numerous types of cancer, including colon and breast cancers, and human osteosarcoma. Knockdown of CKIP-1 promotes proliferation of NHL cells by altering the interaction with RAC-alpha serine/threonine-protein kinase (Akt) (27). CKIP-1 inhibits macrophage proliferation through activation of Akt (28). Furthermore, CKIP-1 is a negative regulator of bone formation. In a mouse model, CKIP-1 knockout counteracted osteoporosis induced by stimulation with microgravity (29). CKIP-1 silencing with small interfering RNA promotes bone formation in a rat model, inhibits apoptosis, however promotes osteogenic differentiation of cultured BMSCs (30).

In conclusion, the present study demonstrated that inhibition of CKIP-1 by miR-98-5p overexpression significantly promoted osteoblast differentiation. Overexpression of CKIP-1 induced by inhibition of miR-98-5p suppressed osteoblast differentiation. The results of the present study indicated that miR-98-5p regulated osteoblast differentiation in MC3T3-E1 cells by targeting CKIP-1.

Acknowledgements

The present study was supported by grants from the National Nature Science Foundation of China (grant nos. 11372351, 31660261 and 31370942) and the Natural Science Foundation of Guangxi (grant no. 2016GXNSFAA380322).

References