Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
April-2018 Volume 17 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2018 Volume 17 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

IL-22 inactivates hepatic stellate cells via downregulation of the TGF-β1/Notch signaling pathway

  • Authors:
    • Enran Chen
    • Yu Cen
    • Donghong Lu
    • Wei Luo
    • Haixing Jiang
  • View Affiliations / Copyright

    Affiliations: Department of Gastroenterology, The First Affiliated Hospital of Guangxi Medical University, Nanning, Guangxi 530021, P.R. China
  • Pages: 5449-5453
    |
    Published online on: January 29, 2018
       https://doi.org/10.3892/mmr.2018.8516
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Interleukin-22 (IL-22) inhibits liver fibrosis by inducing hepatic stellate cell (HSC) senescence, primarily through the activation of signal transducer and activator of transcription 3 signaling. However, whether other signaling pathways are involved remains unknown. The present study assessed the regulatory mechanism between IL‑22 and the Notch signaling pathway in vitro. The results revealed that IL‑22 had anti‑proliferative effects on HSC‑T6 cells, and cellular inactivation was reflected by simultaneous inhibition of α‑smooth muscle actin, transforming growth factor-β1 (TGF‑β1), tumor necrosis factor-α and intercellular adhesion molecule 1. Treatment with TGF‑β1 resulted in significant Notch3 upregulation and activation of its downstream effectors Hes family basic helix‑loop‑helix (bHLH) transcription factor (Hes)-1, Hes‑5 and Hes related family BHLH transcription factor with YRPW motif 1. Furthermore, this effect was markedly reversed by further treatment with IL‑22, indicating there may be regulatory cascades of IL‑22/TGF‑β1/Notch signaling in HSC‑T6 cells. The results of the present study demonstrated an inhibitory function of IL‑22 towards Notch signaling in hepatic cells, providing evidence that Notch may serve as a novel target for liver fibrosis.

Introduction

Hepatic fibrosis (HF) is a leading cause of varices, ascites, and liver failure, and results in death in millions of patients (1). HF is usually associated with chronic liver diseases caused by infection, drugs, metabolic disorders, or autoimmune ailments (2). Liver fibrosis is characterized by the activation and proliferation of hepatic stellate cells (HSCs) (3). Tremendous progress has been achieved regarding the roles of inflammatory cells, growth factors, cytokines, and chemokines in the control of HSC activation during liver fibrogenesis (4,5); however, the underlying mechanism remains unclear and needs further investigation.

It is well-established that interleukin (IL)-22 has hepatoprotective and antifibrotic functions in acute liver injury models. IL-22 is a member of the IL-10 cytokine family, and is produced primarily by Th22, Th17, and Th1 cells (6,7). IL-22 effects epithelial cells, hepatocytes, and pancreatic cells, and induces innate immune responses as well as tissue protection and repair (8). In the liver, IL-22 protects the tissues from damage, and mediates tissue repair through multiple mechanisms in hepatocytes (9,10). Accumulating evidence suggests that IL-22 induces HSC senescence through crosstalk with other signaling pathways such as JAK/STAT3, SOCS3 and p53 pathways, thereby inhibiting liver fibrosis (11).

The Notch pathway represents a highly conserved signaling network with essential roles in the regulation of key cellular processes and functions, many of which are critical for development (12–14). Furthermore, emerging evidence indicates that it is also essential for fibrosis, thus affecting the pathogenesis of chronic fibro proliferative diseases in diverse organs and tissues (15,16). Bansal et al (16) demonstrated the functional effects of Notch signaling on HSC activation and M1/M2 polarization of macrophages in liver fibrosis, although the molecular mechanism remains elusive. Although the Notch signaling pathway is involved in human fibrotic diseases affecting the lung, kidney, and peritoneum (12,13), the interaction between IL-22 and Notch signaling in HSCs remains elusive. The evidence currently available, suggests that IL-22 may downregulate Notch3 (17–19); therefore, we concentrated on this member of the Notch family. In this study, we confirmed that IL-22 inhibited HSC activation through TGF-β-mediated downregulation of the Notch pathway. Therefore, selective inhibition of Notch signaling may be a novel anti-fibrotic strategy for liver fibrosis treatment.

Materials and methods

Cell lines and reagents

HSC-T6 cells were purchased from the Chinese Academy of Sciences (Beijing, China), and cultured in Dulbecco's modified Eagle's medium (DMEM) (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Gemini, Australia). Cells were maintained at 37°C in a humidified atmosphere containing 5% CO2. IL-22 was purchased from R&D Systems (Minneapolis, MN, USA) and TGF-β1 from Cusabio Biotech Co., Ltd. (Wuhan, China).

Cell viability assay

The effects of IL-22 on HSC-T6 cell viability were evaluated with the Cell Counting Kit-8 (CCK-8) (Dojindo Molecular Technologies, Inc., Kumamoto, Japan) cell proliferation assay. Cells were seeded in 96-well plates at a density of 1×104 cells/well. After overnight growth, the cells were incubated with various concentrations of IL-22 (0–1,000 pg/ml) (R&D Systems). After cell treatment for 24 h, 10 µl CCK-8 solution was added into each well. Absorbance was measured at 450 nm with background at 655 nm, using a micro plate reader (Bio-Rad Laboratories, Hercules, CA, USA). All experiments were repeated three times.

Cell apoptosis assay

Apoptosis was assessed, after 24 h of treatment with IL-22, with the APC Annexin V Apoptosis Detection kit and PE Active Caspase-3 Apoptosis kit (both from BD Pharmingen, San Diego, CA, USA) according to the manufacturers' instructions. Briefly, HSC-T6 cells were treated with IL-22, followed by staining in fluorescence activated cell sorter (FACS) buffer (PBS, 2% bovine serum albumin, 0.1% sodium azide) for 10 min at 4°C. Finally, cells were washed and assessed on BD FACSCalibur Flow Cytometer (BD Pharmingen). Data were analyzed with the FlowJo software (Tree Star, Ashland, OR, USA).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

RNA was extracted from cells using TRIzol (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instructions. Reverse transcription was performed with a cDNA Reverse Transcription kit (Takara Bio, Inc., Otsu, Japan). RT-qPCR was performed with a SYBR-Green Master Mix kit (Takara Bio, Inc.). Relative mRNA levels were normalized to GAPDH mRNA expression, and calculated by the 2−∆∆Cq method. The primer sequences are summarized in Table I.

Table I.

Primers used for reverse transcription-quantitative polymerase chain reaction.

Table I.

Primers used for reverse transcription-quantitative polymerase chain reaction.

GenePrimer (5′-3′)Base pairs (bp)
GAPDHForward: CAGCTTTTGAAGGGGAACGC182
Reverse: TCATGCTCAGAAGTGGCTGG
Hes-1Forward: TCAACACGACACCGGACAA120
Reverse: GTGCTTCACTGTCATTTCCAGA
Hes-5Forward: AGCCGGTGGTGGAGAAGAT100
Reverse: AGTTTGGAGTTGGGCTGGTG
Hey-1Forward: AGCTGAGATCTTGCAGATGACTGTG109
Reverse: AGCCAGGCATTCCCGAAAC
TGF-βForward: ATTCCTGGCGTTACCTTGG120
Reverse: AGCCCTGTATTCCGTCTCCT
TNF-αForward: CAGGTTCCGTCCCTCTCATA100
Reverse: TGCCAGTTCCACATCTCG
ICAM-1Forward: ATGGACGCTCACCTTTAGCA109
Reverse: TCTCCCAGGCATTCTCTTTG

[i] TGF-β, transforming growth factor-β; TNF-α, tumor necrosis factor-α; ICAM-1, intercellular adhesion molecule-1; Hes-1, Hes family basic helix-loop-helix transcription factor-1; Hey-1, Hes related family basic helix-loop-helix transcription factor with YRPW motif 1; IL, interleukin.

Immunoblot

Samples were homogenized in lysis buffer containing Tris-HCl, NP-40, NaCl, ethylene diamine-tetra acetic acid, NaN3, phenylmethylsulfonyl fluoride, aprotinin, and leupeptin (pH 7.5), and centrifuged at 16,000 rpm at 4°C for 10 min. Protein concentration was determined by BCA (Pierce Biotechnology, Inc., Rockford, IL, USA). Equal amounts of total protein (30 µg) were separated by 10–15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto PVDF membranes. Antibodies against SMA were obtained from Abcam (Cambridge, MA, USA). Anti-GAPDH was from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA). Anti-Notch3 was manufactured by Abcam (Cambridge, UK). Then membranes were incubated with various primary antibodies overnight at 4°C, followed by incubation with secondary antibodies and detection by enhanced chemiluminescence (ECL) (Odyssey; LI-COR Biosciences, Lincoln, NE, USA).

Statistical analysis

Data are mean ± standard deviation (SD) from three independent experiments. Statistical analysis was performed by unpaired Student's t-test, with two tailed P<0.05 considered statistically significant. Multiple groups were assessed by one-way analysis of variance and Dunnett's post hoc test. The SPSS 16.0 software (SPSS Inc., Chicago, IL, USA) was used for statistical analysis.

Results

IL-22 treatment inhibits HSC-T6 cells proliferation without inducing apoptosis

We first assessed the anti-proliferative effects of IL-22 on hepatic cells. Increasing concentrations of IL-22 were respectively applied to HSC-T6 cells, and cell proliferation was determined by CCK-8 assay. Cell viability was significantly decreased at high IL-22 amounts (Fig. 1A). However, IL-22 had no effect on apoptosis inHSC-T6 cells. As shown in Fig. 1B and C, there was no significant difference between IL-22 treatment and control groups. Taken together, these results indicated that IL-22 may exert anti-proliferative effects, independent of apoptosis.

Figure 1.

IL-22 inhibits the proliferation of HSC-T6 cells without affecting apoptosis. (A) The effects of IL-22 on HSC-T6 cell proliferation. (B) Flow cytometric analysis of HSC-T6 cells following IL-22 treatment. (C) Apoptosis rates post IL-22 treatment in HSC-T6 cells. IL, interleukin; PI, propidium iodide; OD, optical density.

IL-22 downregulates α-SMA and proinflammatory cytokines in HSC-T6 cells

Increased expression levels of α-SMA and collagen are commonly recognized as biomarkers of HSC activation (3). Next, we assessed the expression levels of α-SMA and multiple hepatocyte-associated proinflammatory cytokines to verify the inhibitory effects of IL-22 on HSC-T6 proliferation. Interestingly, application of IL-22 inhibited α-SMA expression in a dose-dependent manner (Fig. 2A). Furthermore, we assessed whether common pro-inflammatory cascades were inhibited by IL-22. TGF-β and tumor necrosis factor-α (TNF-α) are the most important mediators of inflammatory responses in HSCs, while ICAM-1 is an essential cell adhesion molecule (8,9). As shown in Fig. 2B-E, the mRNA levels of TGF-β, TNF-α, and ICAM-1 were simultaneously decreased by IL-22 treatment in HSC-T6 cells, suggesting that these effectors are downstream of IL-22. Collectively, HSC inactivation by IL-22 was confirmed by the downregulation of α-SMA and related-inflammatory cytokines.

Figure 2.

IL-22 decreases the expression levels of α-SMA and proinflammatory cytokines in HSC-T6 cells. (A) Immunoblot detection of the α-SMA protein. (B) Densitometric histogram representing the percentages of α-SMA protein expression. Gene mRNA expression levels of (C) TGF-β, (D) TNF-α and (E) ICAM-1 following IL-22 treatment. *P<0.05 vs. 0 pg/ml IL-22. SMA, smooth muscle actin; IL, interleukin; TGF-β, transforming growth factor-β; TNF-α, tumor necrosis factor-α; ICAM-1, intercellular adhesion molecule-1.

TGF-β1 activates the Notch pathway in HSC-T6 cells

We further explored the possible downstream effectors upon TGF-β stimulation. Several studies previously described a functional interaction between the TGF-β superfamily of proteins and Notch signaling in multiple biological processes (15,16). The results demonstrated that Notch3 levels were remarkably increased in HSC-T6 cells after TGF-β1 treatment, in a dose-dependent manner (Fig. 3A), in line with densitometry analysis (Fig. 3B). Furthermore, not only was the expression of Notch3 receptor increased by TGF-β1, but Notch pathway activation was confirmed, as indicated by substantial upregulation of the downstream effectors Hes family basic helix-loop-helix transcription factor-1 (Hes-1), Hes-5 and Hey-1 (Fig. 3C-E). Taken together, these results indicated that TGF-β is responsible for the activation of Notch signaling in HSC-T6 cells.

Figure 3.

Notch signaling in HSC-T6 cells is activated by TGF-β1 treatment. (A) Immunoblot detection of Notch3. (B) Relative Notch3 protein expression. (C) Hey-1, (D) Hes-1 and (E) Hes-5 mRNA expression levels following TGF-β1 treatment. *P<0.05 vs. 0 ng/ml TGF-β1. TGF-β1, transforming growth factor-β1; Hes-1, Hes family basic helix-loop-helix transcription factor-1; Hey-1, Hes related family basic helix-loop-helix transcription factor with YRPW motif 1; IL, interleukin.

IL-22 treatment inhibits the Notch pathway in HSC-T6 cells

As TGF-β1-induced Notch3 upregulation, we wondered if such regulation can be altered by IL-22. Intriguingly, Notch3 expression was reduced after incubation with IL-22 (Fig. 4A and B). Meanwhile, the effect of IL-22 on the TGF-β1-induced Notch3 increase was evaluated. The results showed that IL-22 decreased Notch3 expression in a dose dependent way in HSC-T6 cells (Fig. 4A and B), suggesting Notch3 to be a downstream signal transducer of IL-22-related TGF-β1 inhibition. These results further confirmed that both Notch3 expression and pathway activation were impaired by IL-22. Compared with the TGF-β1 group, combined treatment with IL-22 significantly decreased Hes-1, Hes-5 and Hey-1 mRNA levels (Fig. 4C-E). Taken together, these findings suggested that IL-22 plays a role in regulation of the Notch signaling pathway.

Figure 4.

IL-22 inhibits Notch signaling in HSC-T6 cells. (A) Immunoblot detection of the Notch3 protein. (B) Relative Notch3 protein expression. (C) Hes-1, (D) Hes-5 and (E) Hey-1 mRNA expression levels following IL-22 treatment. *P<0.05 vs. 0 pg/ml IL-22. TGF-β1, transforming growth factor-β1; Hes-1, Hes family basic helix-loop-helix transcription factor-1; Hey-1, Hes related family basic helix-loop-helix transcription factor with YRPW motif 1; IL, interleukin.

Discussion

The present study demonstrated that IL-22 reduces HSC-T6 activation through Notch3 inhibition, suggesting the protective role of IL-22 in liver fibrosis in vitro and revealing a potential target for liver fibrosis.

Liver fibrosis is a chronic, but reversible wound healing response characterized by a tight interplay between inflammatory and matrix-producing cellular pathways (5). During this process, various signaling pathways are involved in the activation of HSCs. Therefore, targeting a specific signaling pathway may be helpful in identifying effective treatment tools for liver fibrosis. To date, several signaling pathways have been found to be closely related to liver fibro-genesis. Notch signaling is considered a major signaling mechanism in liver biology as well as multiple pathological conditions, from liver damage to carcinogenesis (20). In addition, Notch3 and Jagged1 (mainly related to HSC activation) are upregulated in diseased human livers as well as mouse models (21,22). The activated Notch pathway is involved in some fibrotic diseases. Zhu et al (23) reported that Notch signaling is highly activated in rats with fibrotic peritoneum induced by peritoneal dialysis fluid; indeed, blocking Notch signaling significantly attenuates peritoneal fibrosis. Studies also showed that Notch signaling is involved in the activation of HSCs in vivo, with transient knockdown of Notch3 antagonizing TGF-β1-induced expression of α-SMA and collagen I in HSC-T6 cells (19). In the present study, TGF-β1 was used to activate HSCs, and Notch3, TGF-β, TNF-α, and ICAM-1 expression levels were significantly increased, indicating that the Notch pathway is involved in TGF-β1 induced activation of HSCs.

IL-22 inhibits HSCs through the signal transducer and activator of transcription 3 (STAT3) signaling pathway (10,24). Meanwhile, studies reported that Notch is regulated by TGF-β1 (15,16); however, whether TGF-β1 is involved in IL-22 induced inhibition of HSCs remains unclear. In the present study, TGF-β1 significantly increased the expression levels of Notch3, Hes-1, Hes-5 and Hey-1, which were significantly rescued by IL-22. Taken together, these findings suggested that IL-22 inhibits HSC activation may through the regulation of TGF-β1/Notch signaling. However, how IL-22 modulates TGF-β1/Notch signaling, and whether this is directly related to the expression of α-SMA, needs to be further investigated.

In conclusion, this study firstly revealed a biological interaction between the pro-inflammatory cytokine IL-22 and Notch signaling in preventing liver fibrosis, with TGF-β1 required for the regulatory process.

Glossary

Abbreviations

Abbreviations:

HSC

hepatic stellate cell

α-SMA

α-smooth muscle actin

TGF-β1

transforming growth factor-β1

TNF-α

tumor necrosis factor-α

ICAM-1

intercellular adhesion molecule-1

HF

hepatic fibrosis

DMEM

Dulbecco's modified Eagle's medium

SDS-PAGE

sodium dodecyl sulfate-polyacrylamide gel electrophoresis

ECL

electrochemiluminescence

SD

standard deviation

ANOVA

analysis of variance

References

1 

Ginès P, Càrdenas A, Arroyo V and Rodès J: Management of cirrhosis and ascites. N Engl J Med. 350:1646–1654. 2004. View Article : Google Scholar : PubMed/NCBI

2 

Pan CX, Tang J, Wang XY, Wu FR, Ge JF and Chen FH: Role of interleukin-22 in liver diseases. Inflamm Res. 63:519–525. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Puche JE, Saiman Y and Friedman SL: Hepatic stellate cells and liver fibrosis. Compr Physiol. 3:1473–1492. 2013. View Article : Google Scholar : PubMed/NCBI

4 

Lee UE and Friedman SL: Mechanisms of hepatic fibrogenesis. Best Pract Res Clin Gastroenterol. 25:195–206. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Hernandez-Gea V and Friedman SL: Pathogenesis of liver fibrosis. Annu Rev Pathol. 6:425–456. 2011. View Article : Google Scholar : PubMed/NCBI

6 

Sonnenberg GF, Fouser LA and Artis D: Border patrol: Regulation of immunity, inflammation and tissue homeostasis at barrier surfaces by IL-22. Nat Immunol. 12:383–390. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Zenewicz LA and Flavell RA: Recent advances in IL-22 biology. Int Immunol. 23:159–163. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Sertorio M, Hou X, Carmo RF, Dessein H, Cabantous S, Abdelwahed M, Romano A, Albuquerque F, Vasconcelos L, Carmo T, et al: IL-22 and IL-22 binding protein (IL-22BP) regulate fibrosis and cirrhosis in hepatitis C virus and schistosome infections. Hepatology. 61:1321–1331. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Carmo RF, Cavalcanti MS and Moura P: Role of interleukin-22 in chronic liver injury. Cytokine. 98:107–144. 2017. View Article : Google Scholar : PubMed/NCBI

10 

Zhang YM, Liu ZR, Cui ZL, Yang C, Yang L, Li Y and Shen ZY: Interleukin-22 contributes to liver regeneration in mice with concanavalin A-induced hepatitis after hepatectomy. World J Gastroenterol. 22:2081–2091. 2016. View Article : Google Scholar : PubMed/NCBI

11 

Kong X, Feng D, Wang H, Hong F, Bertola A, Wang FS and Gao B: Interleukin-22 induces hepatic stellate cell senescence and restricts liver fibrosis in mice. Hepatology. 56:1150–1159. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Bolòs V, Grego-Bessa J and de la Pompa JL: Notch signaling in development and cancer. Endocr Rev. 28:339–363. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Nichols AM, Pan Y, Herreman A, Hadland BK, De Strooper B, Kopan R and Huppert SS: Notch pathway is dispensable for adipocyte specification. Genesis. 40:40–44. 2004. View Article : Google Scholar : PubMed/NCBI

14 

Liu T, Hu B, Choi YY, Chung M, Ullenbruch M, Yu H, Lowe JB and Phan SH: Notch1 signaling in FIZZ1 induction of myofibroblast differentiation. Am J Pathol. 174:1745–1755. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Bielesz B, Sirin Y, Si H, Niranjan T, Gruenwald A, Ahn S, Kato H, Pullman J, Gessler M, Haase VH and Susztak K: Epithelial Notch signaling regulates interstitial fibrosis development in the kidneys of mice and humans. J Clin Invest. 120:4040–4054. 2010. View Article : Google Scholar : PubMed/NCBI

16 

Bansal R, van Baarlen J, Storm G and Prakash J: The interplay of the Notch signaling in hepatic stellate cells and macrophages determines the fate of liver fibrogenesis. Sci Rep. 5:182722015. View Article : Google Scholar : PubMed/NCBI

17 

Trehanpati N, Shrivastav S, Shivakumar B, Khosla R, Bhardwaj S, Chaturvedi J, Sukriti, Kumar B, Bose S, Mani Tripathi D, et al: Analysis of Notch and TGF-β signaling expression in different stages of disease progression during hepatitis B virus infection. Clin Transl Gastroenterol. 3:e232012. View Article : Google Scholar : PubMed/NCBI

18 

Lu DH, Guo XY, Qin SY, Luo W, Huang XL, Chen M, Wang JX, Ma SJ, Yang XW and Jiang HX: Interleukin-22 ameliorates liver fibrogenesis by attenuating hepatic stellate cell activation and downregulating the levels of inflammatory cytokines. World J Gastroenterol. 21:1531–1545. 2015. View Article : Google Scholar : PubMed/NCBI

19 

Chen YX, Weng ZH and Zhang SL: Notch3 regulates the activation of hepatic stellate cells. World J Gastroenterol. 18:1397–1403. 2012. View Article : Google Scholar : PubMed/NCBI

20 

Geisler F and Strazzabosco M: Emerging roles of Notch signaling in liver disease. Hepatology. 61:382–392. 2015. View Article : Google Scholar : PubMed/NCBI

21 

Chen Y, Zheng S, Qi D, Zheng S, Guo J, Zhang S and Weng Z: Inhibition of Notch signaling by a γ-secretase inhibitor attenuates hepatic fibrosis in rats. PLoS One. 7:e465122012. View Article : Google Scholar : PubMed/NCBI

22 

Wei X, Wang JP, Hao CQ, Yang XF, Wang LX, Huang CX, Bai XF, Lian JQ and Zhang Y: Notch signaling contributes to liver inflammation by regulation of interleukin-22-producing cells in hepatitis B virus infection. Front Cell Infect Microbiol. 6:1322016. View Article : Google Scholar : PubMed/NCBI

23 

Zhu F, Li T, Qiu F, Fan J, Zhou Q, Ding X, Nie J and Yu X: Preventive effect of Notch signaling inhibition by a gamma-secretase inhibitor on peritoneal dialysis fluid-induced peritoneal fibrosis in rats. Am J Pathol. 176:650–659. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Mühl H: STAT3, a key parameter of cytokine-driven tissue protection during sterile inflammation-the case of experimental acetaminophen (Paracetamol)-induced liver damage. Front Immunol. 7:1632016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chen E, Cen Y, Lu D, Luo W and Jiang H: IL-22 inactivates hepatic stellate cells via downregulation of the TGF-β1/Notch signaling pathway. Mol Med Rep 17: 5449-5453, 2018.
APA
Chen, E., Cen, Y., Lu, D., Luo, W., & Jiang, H. (2018). IL-22 inactivates hepatic stellate cells via downregulation of the TGF-β1/Notch signaling pathway. Molecular Medicine Reports, 17, 5449-5453. https://doi.org/10.3892/mmr.2018.8516
MLA
Chen, E., Cen, Y., Lu, D., Luo, W., Jiang, H."IL-22 inactivates hepatic stellate cells via downregulation of the TGF-β1/Notch signaling pathway". Molecular Medicine Reports 17.4 (2018): 5449-5453.
Chicago
Chen, E., Cen, Y., Lu, D., Luo, W., Jiang, H."IL-22 inactivates hepatic stellate cells via downregulation of the TGF-β1/Notch signaling pathway". Molecular Medicine Reports 17, no. 4 (2018): 5449-5453. https://doi.org/10.3892/mmr.2018.8516
Copy and paste a formatted citation
x
Spandidos Publications style
Chen E, Cen Y, Lu D, Luo W and Jiang H: IL-22 inactivates hepatic stellate cells via downregulation of the TGF-β1/Notch signaling pathway. Mol Med Rep 17: 5449-5453, 2018.
APA
Chen, E., Cen, Y., Lu, D., Luo, W., & Jiang, H. (2018). IL-22 inactivates hepatic stellate cells via downregulation of the TGF-β1/Notch signaling pathway. Molecular Medicine Reports, 17, 5449-5453. https://doi.org/10.3892/mmr.2018.8516
MLA
Chen, E., Cen, Y., Lu, D., Luo, W., Jiang, H."IL-22 inactivates hepatic stellate cells via downregulation of the TGF-β1/Notch signaling pathway". Molecular Medicine Reports 17.4 (2018): 5449-5453.
Chicago
Chen, E., Cen, Y., Lu, D., Luo, W., Jiang, H."IL-22 inactivates hepatic stellate cells via downregulation of the TGF-β1/Notch signaling pathway". Molecular Medicine Reports 17, no. 4 (2018): 5449-5453. https://doi.org/10.3892/mmr.2018.8516
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team