Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
August-2018 Volume 18 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August-2018 Volume 18 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Induction of apoptosis by Bigelovii A through inhibition of NF‑κB activity

  • Authors:
    • Fuqin Guan
    • Yu Shan
    • Qizhi Wang
    • Ming Wang
    • Yu Chen
    • Min Yin
    • Fei Liu
    • Youyi Zhao
    • Jianhua Zhang
    • Xu Feng
  • View Affiliations / Copyright

    Affiliations: College of Life Science, Nanjing Agricultural University, Nanjing, Jiangsu 210095, P.R. China, The Jiangsu Provincial Platform for Conservation and Utilization of Agricultural Germplasm, Jiangsu Key Laboratory for The Research and Uti1ization of Plant Resources, Institute of Botany, Jiangsu Province and Chinese Academy of Sciences, Nanjing, Jiangsu 210014, P.R. China
    Copyright: © Guan et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 1600-1608
    |
    Published online on: May 30, 2018
       https://doi.org/10.3892/mmr.2018.9104
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Bigelovii A is a 30‑nortriterpenoid glycoside, isolated from Salicornia bigelovii Torr. Until now, the effect of Bigelovii A on breast cancer treatment was unknown. The present research indicated that Bigelovii A significantly inhibited the proliferation of human breast cancer cells (MCF‑7, MDA‑MB‑231 and MDA‑MB‑468) in a concentration‑dependent manner. It was particularly effective in MCF7 cells, with an IC50 value of 4.10±1.19 µM. The anti‑proliferative effect of Bigelovii A was ascribed to the induction of apoptosis, which was characterized by chromatin condensation, externalization of phosphatidylserine on the plasma membrane, hypodiploid DNA, activation of caspases and poly (ADP‑ribose) polymerase cleavage. Furthermore, Bigelovii A reduced B-cell lymphoma 2 (Bcl‑2) and B‑cell lymphoma‑extra large (Bcl‑xl) expression and caused disruption of mitochondrial membrane potential, which are indicative features of mitochondria‑dependent apoptotic signals. It was also identified that Bigelovii A downregulated the constitutive activation of nuclear factor (NF)‑κB, as indicated by the electrophoretic mobility gel shift assay and immunocytochemistry. Furthermore, Bigelovii A suppressed constitutive IκBα phosphorylation via inhibition of IκB kinase activity. In addition to the effects on Bcl‑2 and Bcl‑xl, Bigelovii A also downregulated the expression of the NF‑κB‑regulated gene products, Cyclin D1 and cyclooxygenase‑2. This led to the induction of apoptosis and arrest of cells at the G1 phase of the cell cycle.

Introduction

Breast cancer is the most common life-threatening cancer type among women worldwide (1). In spite of numerous improvements in early diagnosis, surgical treatment and endocrine therapy, ~30% of patients with breast cancer do not respond to these standard treatments (2). Depending on the subtype (2,3), the average survival time of these unresponsive patients is 1–4 years, which thus represents a significant unsolved medical challenge. The development of more effective therapeutic drugs is urgently needed. As a family of transcription factors, nuclear factor (NF)-κB plays critical roles in cell proliferation, differentiation and survival, and inflammation and immunity (4). The NF-κB subunits, including RelA (p65), RelB, c-Rel, NF-κB1, and NF-κB2, are held in the cytoplasm by the specific inhibitors IκBs (IκBα, IκBβ, and IκBγ). Inflammation in the tumor microenvironment can activate IκB kinases (IKKs), which phosphorylate and degrade IκB. As a result, NF-κB is released to the cell nucleus and may promote cancer invasion and metastasis. Many tumors, including breast cancer (5,6), have been observed to have aberrant NF-κB activation. Therefore, inhibition of the NF-κB pathway is expected to prevent and treat cancer.

As a traditional folk medicine, Salicornia plants have been used to treat hypertension, cephalalgia, scurvy and cancer (7). Bigelovii A is a 30-nortriterpenoid glycoside, isolated from Salicornia bigelovii Torr (8). Yan et al (9) reported that Bigelovii A could also mitigate LPS-induced acute lung injury by suppressing NF-κB and CCAAT/enhancer-binding protein δ pathways. Our previous studies indicated that Bigelovii A exhibited potential cytotoxicity against HL-60, MCF7, HepG2, A549, Lovo and LN229 cells (8,10,11). In particular in HL-60 cells, Bigelovii A decreased the expression of apoptosis regulator Bcl-2 (Bcl-2), activated caspase-3 and induced cell apoptosis (10). However, the anti-tumor mechanism of Bigelovii A in human breast cancer cells has not been examined. The current study initially compared the cytotoxicity of Bigelovii A in three human cancer cell types (MCF7, MDA-MB-231 and MDA-MB-468). Subsequently, the apoptotic effects mediated by IKK/NF-κB signaling pathways were investigated.

Materials and methods

Reagents

Bigelovii A (Fig. 1) was isolated from Salicornia bigelovii Torr. and dissolved in dimethyl sulfoxide (DMSO; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) to a 100 mM stock solution. The final DMSO concentration in the medium did not exceed 0.1% (v/v) throughout the study. Fetal bovine serum and modified Eagle's medium (MEM) were provided by Gibco™ (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Antibiotics, 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide (MTT) and RIPA lysis buffer were purchased from Nanjing Sunshine Biotechnology Co., Ltd. (Nanjing, China). An Annexin V-PE apoptosis kit was provided by BD Biosciences (Franklin Lakes, NJ, USA). Primary antibodies against NF-κB pathway sampler kit (cat. no. 9936), Cyclin D1 (cat. no. 2978), COX-2 (cat. no. 4482), p-Bcl-2 (cat. no. 2827), Bcl-2 (cat. no. 2870), B-cell lymphoma-extra large (Bcl-xl; cat. no. 2764), cleaved caspase-3 (cat. no. 9936), cleaved caspase-7 (cat. no. 8438), cleaved caspase-9 (cat. no. 9505), cleaved PARP (cat. no. 5625), cleaved caspase-8 (cat. no. 9496) and β-actin (cat. no. 4970), horseradish peroxidase (HRP)-conjugated secondary antibody and an enhanced chemiluminescence (ECL) kit were supplied by Cell Signaling Technology, Inc. (Danvers, MA, USA). NE-PER™ Nuclear and Cytoplasmic Extraction Reagents, Halt™ Protease Inhibitor Cocktail (EDTA-Free) and a LightShift Chemiluminescent EMSA kit were purchased from Thermo Fisher Scientific, Inc. Hoechst 33258 and a Cellular NF-κB Translocation kit were obtained from Beyotime Institute of Biotechnology (Haimen, China).

Figure 1.

Effects of Bigelovii A on cell viability of breast cancer cells. (A) Chemical structure of Bigelovii A. (B) MDA-MB-468, MDA-MB-231 and MCF7 were treated with Bigelovii A for 48 h. (C) MCF7 cells were treated with Bigelovii A for 24, 48 and 72 h. Then, cell viability was evaluated by MTT assay. (D) Following treatment with Bigelovii A for 24 h, morphological changes in MCF7 cells were visualized at ×100 magnification under a IX51 microscope. *P<0.05, **P<0.01 vs. 0 µM.

Cell culture

Three human breast cancer cell lines (MCF7, MDA-MB-231 and MDA-MB-468) were purchased from the Cell Bank of Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (Shanghai, China). They were propagated using the methods provided. MCF7 cells were cultured in MEM supplemented with 10% fetal bovine serum, 10 µg/ml insulin, 100 U/ml penicillin and 100 µg/ml streptomycin, while MDA-MB-231 and MDA-MB-468 cells were cultured without insulin.

Cell viability assays

The effect of Bigelovii A on cell viability was determined by MTT assay. Cells were seeded at a density of 1×104 cells/well in 96-well plates and treated with Bigelovii A at various concentrations. Following incubation for the indicated time, 5 mg/ml MTT was added to each well and incubated in the CO2 incubator for 4 h. The formazan crystals were dissolved in DMSO and absorbance was recorded on an ELISA reader (Tecan Group, Ltd., Mannedorf, Switzerland) at a test wavelength of 570 nm and a reference wavelength of 690 nm. Inhibition rate was calculated by the following formula: Inhibition rate (%)=(1-ODt/ODc)×100%. ODt and ODc denoted the average absorbance of treated groups and control groups, respectively. IC50 was considered to be the concentration that caused 50% inhibition rate.

Annexin V-PE/7-AAD analysis and Hoechst 33258 staining for cell apoptosis

MCF7 cells were plated at a density of 4×105 cells/well. Following treatment with 5, 10 or 20 µM Bigelovii A for 24 h, cells were washed twice with PBS, resuspended in binding buffer, then incubated with 7-AAD and Annexin V-PE in the dark for 15 min. The samples were analyzed using an Accuri C6 flow cytometer (BD Biosciences) for 1 h. Then, the apoptotic morphology was studied using the Hoechst 33258 dye. Cells (1×106/ml) were seeded on glass slides in 6-well tissue culture plates. After treatment with 20 µM Bigelovii A for 24 h, cells were fixed with 4% formaldehyde for 10 min, washed with PBS twice and stained with Hoechst 33258 dye for 5 min. Stained nuclei were observed at magnification, ×100 under an IX51 fluorescence microscope.

Propidium iodide (PI) staining for cell cycle analysis

MCF7 cells (1×106/well) were treated with different doses of Bigelovii A and incubated for 24 h. Floating and adherent cells were harvested and washed with cold PBS. The cell pellet was fixed in 70% ethanol overnight at 4°C, incubated with 100 µg/ml RNaseA for 30 min at 37°C and stained with PI (50 µg/ml) for 30 min at 4°C. Cell cycle distribution was analyzed in an Accuri C6 flow cytometer (BD Biosciences).

Mitochondrial membrane potential

Following treatment with Bigelovii A (0, 5, 10 and 20 µM) for 24 h, MCF7 cells were washed twice with cold PBS and incubated with Rh123 in a CO2 incubator for 30 min. The stained cells were collected by centrifugation, washed twice with PBS, then analyzed by flow cytometry.

Isolation of total cellular proteins, cytosolic and nuclear proteins

MCF7 cells were cultured to 80% confluence and treated with various concentrations of Bigelovii A for the indicated times. Total cellular proteins were isolated with RIPA lysis buffer, with the lysates centrifuged for 15 min at 12,000 × g and 4°C. Cytosolic and nuclear proteins were separated according to the manufacturer's recommended protocol. After washing, cells were trypsinized and centrifuged at 500 × g for 5 min. Cells were lysed with ice-cold CER I, vigorously vortexed on the highest setting for 15 sec, then incubated on ice for 10 min. Ice-cold CER II was added to the tube, then the tube was vortexed for 5 sec on the highest setting, and centrifuged for 5 min at 16,000 × g. The supernatants were saved as the cytoplasmic fractions and the nuclear pellets were resuspended in ice-cold NER. The tubes were vortexed on the highest setting for 15 sec, then placed on ice. Vortexing was continued for 15 sec every 10 min, for a total of 40 min. The tube was then centrifuged at 16,000 × g for 10 min and the nuclear supernatant was immediately transferred to a clean, pre-chilled tube.

Western blot analysis

The concentrations of total cellular proteins, cytosolic and nuclear proteins were measured by the Bradford assay. Equal amounts of proteins (50 µg) were fractionated on 10% SDS-PAGE gels and transferred to polyvinylidene difluoride membranes (EMD Millipore, Billerica, MA, USA). Following blocking with 5% milk, the blots were probed with specific primary antibodies at 4°C overnight, followed by HRP-labeled secondary antibody at 37°C for 1 h. Immunoreactive proteins were visualized with the enhanced chemiluminescence reagents. Anti-β-actin antibody was used to ascertain equal loading of proteins.

Electrophoretic mobility shift assay (EMSA)

EMSA was performed to investigate the inhibitory effect of Bigelovii A on NF-κB activation. The nuclear extracts, isolated as described above, were incubated with biotin-labeled oligonucleotide probes (5′-AGTTGAGGGGACTTTCCCAGGC-3′ and 3′-TCAACTCCCCTGAAAGGGTCCG-5′) for 20 min at room temperature. Unlabeled oligonucleotide was used to confirm the specificity of binding. The formed DNA-protein complex was electrophoresed on 6% non-denaturing polyacrylamide gel, transferred onto a nylon membrane, and cross-linked for 10–15 min under 312 nm bulbs. The nylon membrane was visualized using the Chemiluminescent EMSA kit (Thermo Fisher Scientific, Inc.).

Immunocytochemistry for NF-κB p65 localization

The effect of Bigelovii A on NF-κB nuclear translocation was examined by immunofluorescence confocal microscopy according to the kit's protocol. MCF7 cells were plated on glass coverslips in 6-well plates and treated with 10 µM Bigelovii A for 24 h. Following washing, cells were incubated with a blocking buffer at room temperature for 1 h and the primary NF-κB p65 antibody at 4°C overnight. The slides were washed again in washing buffer and incubated with Cy3-labeled secondary antibody for 1 h. The nuclei were counterstained with DAPI for 5 min. The stained slides were observed using a laser confocal microscope.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis of mRNA levels

RT-qPCR was performed as described in previous reports (12,13). Briefly, total RNA was extracted with TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. First-strand cDNA was synthesized using HiScript II Q RT SuperMix for qPCR (Vazyme Biotech Co., Ltd., Nanjing, China) according to the manufacturer's protocol. The primers were designed using the software Primer Premier 5.0 (Premier Biosoft International, Palo Alto, CA, USA) and are listed in Table I. The quantified expression levels of the tested genes were normalized against the housekeeping gene β-actin. qPCR was performed using SYBR-Green Master mix (Vazyme Biotech Co., Ltd.) and run on a qTOWER2.2 Real-Time PCR system (Analytik Jena AG, Jena, Germany). The conditions for quantitative analysis were as follows: 95°C for 5 min; 40 cycles of 95°C for 15 sec, 56°C for 15 sec, and 72°C for 20 sec; 72°C for 5 min. The specificity of each PCR reaction was determined by melting curve analysis. Data for each sample were calculated using the 2−ΔΔCq method (14).

Table I.

Sequences of primers used for PCR and RT-qPCR.

Table I.

Sequences of primers used for PCR and RT-qPCR.

GenePrimer sequence (5′ to 3′)
Bcl-2
  Forward GGTCATGTGTGTGGAGAGCG
  Reverse CAGGGTGATGCAAGCTCCCA
Cyclin D1
  Forward TGAACCTGAGGAGCCCCAAC
  Reverse GCCTTGGGGTCCATGTTCTGCT
COX-2
  Forward GCAGTACAGAAAGTATCACAGGC
  Reverse CGATGTCACCATAGAGTGCTTCC
Bcl-xl
  Forward ATGGGGTAAACTGGGGTCGC
  Reverse GCATTGTTCCCATAGAGTTCCAC
β-actin
  Forward CCGACAGGATGCAGAAGGAG
  Reverse CTCGTCATACTCCTGCTTGCTG

[i] RT-qPCR, reverse transcription-quantitative polymerase chain reaction; Bcl-xl, B-cell lymphoma extra large; COX-2, cyclooxygenase-2.

Statistical analysis

Data are presented as the mean ± standard deviation from triplicate experiments. The statistical significance was evaluated using Student's t-test to compare the difference between two groups, and one-way analysis of variance followed by a Newman-Keuls post-hoc test was used to perform multiple comparisons (GraphPad Software, Inc., San Diego, CA, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Bigelovii A inhibits the proliferation of human breast cancer cells

To measure the cytotoxic effect of Bigelovii A, three human breast cancer cell lines (MCF-7, MDA-MB-231 and MDA-MB-468) were treated with 5, 10, 20 and 40 µM of Bigelovii A for 48 h. As presented in Fig. 1B, the inhibitory effect of Bigelovii A occurred in a concentration-dependent manner, particularly in MCF7 cells (IC50: 4.10±1.19 µM). The inhibitory effect on MCF7 cells was also in a time-dependent manner (Fig. 1C). Microscopy observations indicated that MCF7 cells with treatment with Bigelovii A became round and floated, while untreated cells exhibited a epithelial and adherent cytoskeleton (Fig. 1D).

Bigelovii A induces apoptosis in MCF7 cells

To evaluate whether Bigelovii A induced apoptosis in MCF7 cells, Annexin V-FITC, Hoechst 33258 staining, sub-G1 DNA content, caspase and PARP cleavage assays were conducted (Fig. 2). Flow cytometric analysis of Annexin V/7-AAD staining suggested that Bigelovii A increased the percentage of Annexin V-positive MCF7 cells in a dose-dependent manner (Fig. 2A), indicating the activation of apoptosis. Hoechst 33258 staining (Fig. 2B) indicated that Bigelovii A at 20 µM induced chromatin fragmentation and condensation in MCF7 cells following 24 h of treatment. Cell cycle analysis revealed that treatment with this compound at 5 and 10 µM for 24 h resulted in cell cycle arrest at G1 phase, while treatment at 20 µM induced the hypodiploid sub-G1 phase, confirming an apoptotic effect (Fig. 2C). As indicated in Fig. 2D, treatment of MCF7 cells with Bigelovii A (5, 10 or 20 µM) led to activation of caspase-7 and caspase-9, and cleavage of PARP. Z-VAD-FMK, a pan caspase inhibitor, reversed Bigelovii A-induced caspase and PARP activation. These data indicated that Bigelovii A killed MCF7 cells by inducing apoptosis. However, activation of caspase-3 and caspase-8 was not detected. Thangaiyan and Sipra (15) reported that MCF-7 cells do not express caspase-3. Bigelovii A activated caspase-9 instead of caspase-8, indicating mitochondrion-mediated apoptosis.

Figure 2.

Bigelovii A induced apoptosis in MCF7 cells. (A) Cells were treated with 10 or 20 µM Bigelovii A for 24 h and Annexin V-PE/7-AAD double staining was performed to measure apoptotic and necrotic cells. (B) Morphological changes in MCF7 cells induced by 20 µM of Bigelovii A for 24 h were detected by Hoechst 33258 staining. (magnification, ×400). (C) The ratio of cells at sub-G1 phase was detected by flow cytometry. (D) Western blotting was performed to evaluate protein levels of cleaved caspase-7, cleaved caspase-9 and PARP. (E) The protein levels of cleaved-caspase-7, cleaved-caspase −9, and cleaved-PARP were quantified using Image J. *P<0.05, **P<0.01 vs. 0 µM; #P<0.01 vs. 20 µM. i, 10 µM Z-VAD-FMK.

Bigelovii A induces apoptosis via mitochondrial pathways

To confirm whether the mitochondrial pathway contributed to the induction of apoptosis by Bigelovii A, mitochondrial membrane potential was examined in MCF7 cells. As indicated in Fig. 3, loss of mitochondrial membrane potential was observed following treatment with Bigelovii A for 24 h (8.6, 13.9, 24.2 and 97.3% at 0, 5, 10 and 20 µM Bigelovii A, respectively). To further confirm that Bigelovii A induced mitochondrial damage, the levels of Bcl-2 family proteins (p-Bcl-2, Bcl-2 and Bcl-xl) were measured by western blot analysis. These anti-apoptotic Bcl-2 proteins (p-Bcl-2, Bcl-2 and Bcl-xl) were all markedly decreased following exposure to Bigelovii A for 24 h. In addition, as indicated in Fig. 2D, caspase-9 instead of caspase-8 was activated. Therefore, the apoptosis induced by Bigelovii A was mediated via the mitochondrial pathway.

Figure 3.

Bigelovii A induced apoptosis via mitochondrial pathways. (A) Following treatment with Bigelovii A for 24 h, mitochondrial membrane potential was measured by flow cytometry. (B and C) Protein levels of p-Bcl-2, Bcl-2 and Bcl-xl were analyzed by (B) western blotting and (C) quantified by Image J. *P<0.05, **P<0.01 vs. 0 µM. Bcl-xl, B-cell lymphoma-extra large.

Apoptosis induced by Bigelovii A involves inhibition of NF-κB

Bcl-2 and Bcl-xl are negative regulators of apoptosis and their overexpression can be induced by NF-κB (16,17). Significantly decreased expression levels of Bcl-2 and Bcl-xl in MCF7 cells were induced by Bigelovii A, suggesting that its pro-apoptotic effect may lead to NF-κB inactivation. In order to investigate the effect of Bigelovii A on the NF-κB pathway, the effect of Bigelovii A on the translocation and phosphorylation at serine residue 536 of p65 were analyzed, since phosphorylation is necessary for the transcriptional activity of p65. Cytoplasmic total p65 level was not altered, while cytoplasmic phosphorylated p65 was decreased. Meanwhile, nuclear total p65 expression and nuclear phosphorylated p65 expression were both reduced (Fig. 4A and B). These results indicated that Bigelovii A inhibited the translocation and phosphorylation of p65. Furthermore, immunocytochemical analysis demonstrated that Bigelovii A inhibited the translocation of p65 to the nucleus in MCF7 cells (Fig. 4C). For cells without any treatment, some p65 was translocated to the nucleus, whereas for cells treated with Bigelovii A, nearly all p65 was fixed in the cytoplasm. These results supported the notion that Bigelovii A inhibited the translocation of p65. Next, in order to investigate the role of Bigelovii A in regulating NF-κB DNA binding activity in MCF-7 breast cancer cells, cells were treated with 5, 10 or 20 µM Bigelovii A for 24 h and EMSA was performed. The results indicated that DNA binding activity of NF-κB decreased as the concentration of Bigelovii A increased (Fig. 4D). Phosphorylation of the inhibitor IκB by IKKs is a vital step for the nuclear translocation and activity of NF-κB (18). Fig. 4E and F indicated that Bigelovii A treatment for 4 h decreased phosphorylation levels of IKKα, IKKβ and IκBα, and increased the expression levels of IκBα, while there was no effect on the expression levels of IKKα and IKKβ. In addition to Bcl-2 and Bcl-xl, COX-2 and Cyclin D1 are also NF-κB-regulated genes (19,20). It was identified that in MCF7 cells, Bigelovii A decreased protein expression of COX-2 and Cyclin D1 (Fig. 5A). RT-qPCR analysis was performed to further confirm Bcl-2, Bcl-xl, COX-2 and Cyclin D1 gene alterations. As indicated in Fig. 5B, Bigelovii A suppressed Bcl-2, Bcl-xl, COX-2 and Cyclin D1 mRNA levels. Fig. 6 demonstrated the role of Bigelovii A in blocking NF-κB activation and mediating cell apoptosis.

Figure 4.

Bigelovii A blocked the IKK/NF-κB pathway. (A and B) Protein levels of p65 and phosphorylated p65 in the cytoplasm (C) and nucleus (N) were analyzed by western blotting and quantified by Image J. For loading control of cytoplasmic and nuclear proteins, the membranes were reblotted with β-actin and H3 antibody, respectively. (C) Nuclear translocation of p65 was analyzed by immunocytochemistry. Blue indicates nuclei and red indicates p65. (D) NF-κB DNA binding activity was assayed by EMSA with nuclear extracts. (E and F) Following treatment with Bigelovii A for 4 h, total protein extracts were analyzed and quantified for the expression levels of p-IKK, IKKα, IKKβ, p-IκBα and IκBα. *P<0.05, **P<0.01 vs. 0 µM. EMSA, electrophoretic mobility shift assay; NF, nuclear factor; IKK, IκB kinase.

Figure 5.

Effects on NF-κB-dependent gene expression of Bigelovii A. (A) Western blotting analysis. Following treatment with Bigelovii A for 24 h, total protein extracts were isolated and subjected to western blotting for Cyclin D1 and COX-2. (B) Effects of Bigelovii A on levels of Bcl-2, Bcl-xl, COX-2 and Cyclin D1 mRNA. Cells were treated with 10 µM Bigelovii A. Total RNA was extracted at 24 h, and was examined by RT-qPCR for Bcl-2, Bcl-xl, COX-2 and Cyclin D1. β-actin was used as an internal control. *P<0.05, **P<0.01 vs. 0 µM. NF, nuclear factor; Bcl-xl, B-cell lymphoma-extra large; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.

Figure 6.

Proposed mechanism of the anti-tumor effects of Bigelovii A. Bigelovii A downregulates the constitutive activation of IκBα kinase and nuclear factor-κB in human breast cancer cells, leading to inhibition of proliferation and induction of apoptosis. Bcl-xl, B-cell lymphoma-extra large; IKK, IκB kinase.

Discussion

Breast cancer is the leading cause of cancer-associated cases of mortality in women worldwide (21). Plant-derived triterpenoids are considered to be promising agents in treating breast cancer (22). In the current study, Bigelovii A, a new triterpenoid isolated from Salicornia bigelovii Torr., was shown to inhibit the growth of MCF7 cells in dose-dependent and time-dependent manners. MCF-7 cells were arrested in the G1 phase of the cell cycle and underwent apoptosis in a dose-dependent manner following treatment with Bigelovii A, as indicated by chromatin condensation, externalization of phosphatidylserine on the plasma membrane, hypodiploid DNA, caspase activation and PARP cleavage.

Two apoptotic pathways have been identified in cells, regulated by either the death receptor or mitochondria (23). The mitochondrion transduction pathway is regulated by the Bcl-2 protein family (15). Pro-apoptotic protein Bax is translocated to the mitochondrial outer membrane, after which cytochrome c is released and MMP is disrupted. By contrast, mitochondrial integrity is preserved by anti-apoptotic Bcl-2 in order to inhibit the process. Caspase-9 is recruited and cleaved by mitochondria-dependent death signal, while activation of caspase-2, −8, or −10 is induced by death receptors. These caspases then activate caspase-3, −6 and −7 (24), and PARP is cleaved into p24 and p89, leading to DNA fragmentation and inducing apoptosis (25,26). The current results suggested that Bigelovii A disrupted the mitochondrial membrane potential. Western blotting indicated that Bcl-2 anti-apoptotic protein was decreased, and caspase-7 and caspase-9, instead of caspase-8, were activated following Bigelovii A treatment. Therefore, Bigelovii A induced apoptosis via the mitochondrion-mediated pathway.

Aberrant NF-κB activation is responsible for the development of various cancer types (5). Inflammatory cytokines, including tumor necrosis factor-α and interleukin-1β, are abundant in breast cancer and activate NF-κB pathway in cancer cells (5,27). The current results indicated that MCF7 cells had the ability to constitutively express active NF-κB, which was consistent with two recent reports by Liu et al (28) and Wang et al (29), which indicated constitutive NF-κB activation in MCF7 cells on western blot analysis. In the current study, Bigelovii A was demonstrated to inhibit constitutive NF-κB activation in MCF7 cells. These results were in accordance with previous reports from our laboratory (9) and other groups, that triterpenoids are potent inhibitors of NF-κB activation (30). By using antibodies that specifically detect the phosphorylated form of IκBα, we showed that Bigelovii A blocks consitutive phosphorylation of IκBα. The phosphorylation of IκBα is regulated by a large number of kinases including IKK-α, IKK-β, IKK-γ, NIK, TAK1, Akt, and mitogen-activated protein kinase kinase kinase 1 (31). Akt and NIK are primarily known to activate IKK-α, whereas mitogen-activated protein kinase kinase kinase 1 and atypical protein kinase C activate IKK-β. Bigelovii A inhibited IKK activity without directly interfering with the IKK protein. Thus, more detailed studies are warranted to identify one or more of the upstream kinases responsible for IKK activation. Inhibition of NF-κB by Bigelovii A significantly decreased expression of several gene products regulated by NF-κB. The expression of Bcl-2, Bcl-xl, cyclin D1 and COX-2, are known to be regulated by NF-κB, whose synthesis process was inhibited by Bigelovii A. Therefore, it was not surprising to identify that Bigelovii A induced G1 arrest and apoptosis.

In conclusion, Bigelovii A decreased IKK kinase activity, suppressed constitutive IκBα phosphorylation and nuclear p65 expression, and reduced expression of the NF-κB-regulated gene products Bcl-2, Bcl-xl, cyclin D1 and COX-2. These effects inhibited the proliferation of MCF7 cells, arrested cells at the G1 phase boundary of the cell cycle and induced apoptosis.

Acknowledgements

The authors would like to thank Dr Sheng Xu, Dr Lu Yan and Dr Xiaoqin Ding at the Institute of Botany, Jiangsu Province and Chinese Academy of Sciences for performing RT-qPCR and statistical analysis.

Funding

The present study was funded by the National Natural Science Foundation of China (grant nos. 81402829, 31470425 and 31570359) and the Jiangsu Provincial Natural Science Foundation of China (grant no. BK20131338).

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

FQG, YS and XF designed the study. FQG, MY, FL, YYZ and JHZ performed the experiments. FQG, QZW, MW and YC analyzed the data. FQG, MY and FL wrote the manuscript.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Siegel RL, Miller KD and Jemal A: Cancer statistics, 2015. CA Cancer J Clin. 65:5–29. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Santa-Maria CA and Gradishar WJ: Changing treatment paradigms in metastatic breast cancer: Lessons learned. JAMA Oncol. 1:528–534. 2015. View Article : Google Scholar : PubMed/NCBI

3 

O'Shaughnessy J: Extending survival with chemotherapy in metastatic breast cancer. Oncologist. 10:20–29. 2005. View Article : Google Scholar : PubMed/NCBI

4 

Ruland J: Return to homeostasis: Downregulation of NF-κB responses. Nat Immunol. 12:709–714. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Chaturvedi MM, Sung B, Yadav VR, Kannappan R and Aggarwal BB: NF-κB addiction and its role in cancer: ‘One size does not fit all’. Oncogene. 30:1615–1630. 2011. View Article : Google Scholar : PubMed/NCBI

6 

Fornier MN, Rathkopf D, Shah M, Patil S, O'Reilly E, Tse AN, Hudis C, Lefkowitz R, Kelsen DP and Schwartz GK: Phase I dose finding study of weekly docetaxel followed by flavopiridol for patients with advanced solid tumors. Clin Cancer Res. 13:5841–5846. 2007. View Article : Google Scholar : PubMed/NCBI

7 

Guan FQ, Shan Y, Zhao YY, Wang QZ, Wang M, Sun H, Chen Y, Yin M and Feng X: Research development on pharmacological activities and mechanism of Salicornia plants. Chin Pharm Bull. 29:1188–1191. 2013.

8 

Wang QZ, Liu XF, Shan Y, Guan FQ, Chen Y, Wang XY, Wang M and Feng X: Two new nortriterpenoid saponins from Salicornia bigelovii Torr. and their cytotoxic activity. Fitoterapia. 83:742–749. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Yan C, Guan F, Shen Y, Tang H, Yuan D, Gao H and Feng X: Bigelovii a protects against lipopolysaccharide-induced acute lung injury by blocking NF-κB and CCAAT/enhancer-binding protein δ pathways. Mediators Inflamm. 2016:92016042016. View Article : Google Scholar : PubMed/NCBI

10 

Guan FQ, Wang HT, Shan Y, Zhang DM, Zhao YY, Chen Y, Wang QZ, Wang M and Feng X: Bigelovii A induces apoptosis of HL60 human acute promyelocytic leukaemia cells. Mol Med Rep. 7:1585–1590. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Guan F, Wang Q, Wang M, Shan Y, Chen Y, Yin M, Zhao Y, Feng X, Liu F and Zhang J: Isolation, identification and cytotoxicity of a new noroleanane-type triterpene saponin from Salicornia bigelovii Torr. Molecules. 20:6419–6431. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Wang F, Cai HY, Zhao Q, Xing T, Li JH and Wang NS: Epinephrine evokes renalase secretion via α-adrenoceptor/NF-κB pathways in renal proximal tubular epithelial cells. Kidney Blood Press Res. 39:252–259. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Wang F, Zhang G, Lu Z, Geurts A M, Usa K, Jacob HJ, Cowley AW, Wang N and Liang M: Antithrombin III/SerpinC1 insufficiency exacerbates renal ischemia/reperfusion injury. Kidney Int. 88:796–803. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

15 

Rabi T and Banerjee S: Novel Synthetic triterpenoid methyl 25-hydroxy-3-oxoolean-12-en-28-oate induces apoptosis through JNK and p38 MAPK pathways in human breast adenocarcinoma MCF-7 cells. Mol Carcinog. 47:415–423. 2008. View Article : Google Scholar : PubMed/NCBI

16 

Yip KW and Reed JC: Bcl-2 family proteins and cancer. Oncogene. 27:6398–6406. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Sevilla L, Zaldumbide A, Pognonec P and Boulukos KE: Transcriptional regulation of the bcl-x gene encoding the antiapoptotic Bcl-xL protein by Ets, Rel/NF-κB, STAT and AP1 transcription factor families. Histol Histopathol. 16:595–601. 2001.PubMed/NCBI

18 

Zandi E and Karin M: Bridging the gap: Composition, regulation and physiological function of the IκB kinase complex. Mol Cell Biol. 19:4547–4551. 1999. View Article : Google Scholar : PubMed/NCBI

19 

Pahl HL: Activators and target genes of Rel/NF-κB transcription factors. Oncogene. 18:6853–6866. 1999. View Article : Google Scholar : PubMed/NCBI

20 

Plummer SM, Holloway KA, Manson MM, Munks RJ, Kaptein A, Farrow S and Howells L: Inhibition of cyclo-oxygenase 2 expression in colon cells by the chemopreventive agent curcumin involves inhibition of NF-κB activation via the NIK/IKK signalling complex. Oncogene. 18:6013–6020. 1999. View Article : Google Scholar : PubMed/NCBI

21 

DeSantis C, Siegel R, Bandi P and Jemal A: Breast cancer statistics. CA Cancer J Clin. 61:409–418. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Bishayee A, Ahmed S, Brankov N and Perloff M: Triterpenoids as potential agents for the chemoprevention and therapy of breast cancer. Front Biosci (Landmark Ed). 16:980–996. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Ouyang L, Shi Z, Zhao S, Wang FT, Zhou TT, Liu B and Bao JK: Programmed cell death pathways in cancer: A review of apoptosis, autophagy and programmed necrosis. Cell Prolif. 45:487–498. 2012. View Article : Google Scholar : PubMed/NCBI

24 

Ashe PC and Berry MD: Apoptotic signaling cascades. Prog Neuropsychopharmacol Biol Psychiatry. 27:199–214. 2003. View Article : Google Scholar : PubMed/NCBI

25 

Gambi N, Tramontano F and Quesada P: Poly (ADPR)polymerase inhibition and apoptosis induction in cDDP-treated human carcinoma cell lines. Biochem Pharmacol. 75:2356–2363. 2008. View Article : Google Scholar : PubMed/NCBI

26 

Scovassi AI and Poirier GG: Poly (ADP-ribosylation) and apoptosis. Mol Cell Biochem. 199:125–137. 1999. View Article : Google Scholar : PubMed/NCBI

27 

Goldberg JE and Schwertfeger KL: Proinflammatory cytokines in breast cancer: Mechanisms of action and potential targets for therapeutics. Curr Drug Targets. 11:1133–1146. 2010. View Article : Google Scholar : PubMed/NCBI

28 

Liu B, Sun L, Liu Q, Gong C, Yao Y, Lv X, Lin L, Yao H, Su F, Li D, et al: A cytoplasmic NF-κB interacting long noncoding RNA blocks IκB phosphorylation and suppresses breast cancer metastasis. Cancer Cell. 27:370–381. 2015. View Article : Google Scholar : PubMed/NCBI

29 

Wang J, Zhao B, Yi Y, Zhang W, Wu X, Zhang L and Shen Y: Mycoepoxydiene, a fungal polyketide inhibits MCF-7 cells through simultaneously targeting p53 and NF-κB pathways. Biochem Pharmacol. 84:891–899. 2012. View Article : Google Scholar : PubMed/NCBI

30 

Shanmugam MK, Dai X, Kumar AP, Tan BK, Sethi G and Bishayee A: Oleanolic acid and its synthetic derivatives for the prevention and therapy of cancer: Preclinical and clinical evidence. Cancer Lett. 346:206–216. 2014. View Article : Google Scholar : PubMed/NCBI

31 

Baldwin AS: Regulation of cell death and autophagy by IKK and NF-κB: Critical mechanisms in immune function and cancer. Immunol Rev. 246:327–345. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Guan F, Shan Y, Wang Q, Wang M, Chen Y, Yin M, Liu F, Zhao Y, Zhang J, Feng X, Feng X, et al: Induction of apoptosis by Bigelovii A through inhibition of NF‑κB activity. Mol Med Rep 18: 1600-1608, 2018.
APA
Guan, F., Shan, Y., Wang, Q., Wang, M., Chen, Y., Yin, M. ... Feng, X. (2018). Induction of apoptosis by Bigelovii A through inhibition of NF‑κB activity. Molecular Medicine Reports, 18, 1600-1608. https://doi.org/10.3892/mmr.2018.9104
MLA
Guan, F., Shan, Y., Wang, Q., Wang, M., Chen, Y., Yin, M., Liu, F., Zhao, Y., Zhang, J., Feng, X."Induction of apoptosis by Bigelovii A through inhibition of NF‑κB activity". Molecular Medicine Reports 18.2 (2018): 1600-1608.
Chicago
Guan, F., Shan, Y., Wang, Q., Wang, M., Chen, Y., Yin, M., Liu, F., Zhao, Y., Zhang, J., Feng, X."Induction of apoptosis by Bigelovii A through inhibition of NF‑κB activity". Molecular Medicine Reports 18, no. 2 (2018): 1600-1608. https://doi.org/10.3892/mmr.2018.9104
Copy and paste a formatted citation
x
Spandidos Publications style
Guan F, Shan Y, Wang Q, Wang M, Chen Y, Yin M, Liu F, Zhao Y, Zhang J, Feng X, Feng X, et al: Induction of apoptosis by Bigelovii A through inhibition of NF‑κB activity. Mol Med Rep 18: 1600-1608, 2018.
APA
Guan, F., Shan, Y., Wang, Q., Wang, M., Chen, Y., Yin, M. ... Feng, X. (2018). Induction of apoptosis by Bigelovii A through inhibition of NF‑κB activity. Molecular Medicine Reports, 18, 1600-1608. https://doi.org/10.3892/mmr.2018.9104
MLA
Guan, F., Shan, Y., Wang, Q., Wang, M., Chen, Y., Yin, M., Liu, F., Zhao, Y., Zhang, J., Feng, X."Induction of apoptosis by Bigelovii A through inhibition of NF‑κB activity". Molecular Medicine Reports 18.2 (2018): 1600-1608.
Chicago
Guan, F., Shan, Y., Wang, Q., Wang, M., Chen, Y., Yin, M., Liu, F., Zhao, Y., Zhang, J., Feng, X."Induction of apoptosis by Bigelovii A through inhibition of NF‑κB activity". Molecular Medicine Reports 18, no. 2 (2018): 1600-1608. https://doi.org/10.3892/mmr.2018.9104
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team