Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
September-2018 Volume 18 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2018 Volume 18 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Triticum aestivum sprout extract attenuates 2,4‑dinitrochlorobenzene‑induced atopic dermatitis‑like skin lesions in mice and the expression of chemokines in human keratinocytes

  • Authors:
    • Ji‑Hyun Lee
    • Hyeon‑Hui Ki
    • Dae‑Ki Kim
    • Young‑Mi Lee
  • View Affiliations / Copyright

    Affiliations: Department of Immunology and Institute of Medical Sciences, Medical School, Chonbuk National University, Jeonju, Jeonbuk 54907, Republic of Korea, Department of Oriental Pharmacy, College of Pharmacy and Wonkwang‑Oriental Medicines Research Institute, Wonkwang University, Iksan, Jeollabuk 54538, Republic of Korea
  • Pages: 3461-3468
    |
    Published online on: July 31, 2018
       https://doi.org/10.3892/mmr.2018.9339
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Atopic dermatitis (AD) is a common chronic, recurring, inflammatory skin disease. A number of researchers have been seeking safe AD therapies for a long time. Triticum aestivum sprouts (TAEE), known as wheatgrass, are one of the most widely used health foods worldwide. They show numerous beneficial effects, including anticancer, anti‑inflammatory, anti‑oxidant, anti‑obesity, anti‑colitis and anti‑allergy effects; however, their effect on AD is unknown. In the present study, the anti‑AD effects of a 70% ethanol extract of TAEE were investigated in 2,4‑dinitrochlorobenzene (DNCB)‑treated mice with AD‑like skin lesions and in tumor necrosis factor (TNF)‑α‑ and interferon (IFN)‑γ‑stimulated human keratinocytes (HaCaT cells). Oral administration of 200 mg/kg TAEE for 10 days significantly decreased the skin thickness, transepidermal water loss and serum immunoglobulin E levels in DNCB‑treated mice. In addition, TAEE reduced the secretion of inflammatory chemokines via regulation of the signal transducer and activator of transcription 1 and suppressor of cytokine signaling pathways in TNF‑α‑ and IFN‑γ‑stimulated HaCaT cells. These results indicate that TAEE may have beneficial effects in the treatment and prevention of AD and associated skin diseases.

Introduction

Atopic dermatitis (AD) is a common chronic inflammatory skin disease that affects ~20% of children worldwide, and the prevalence of AD increases rapidly every year (1). AD is characterized by chronic recurrence of skin inflammation, epidermal barrier dysfunction, IgE-mediated sensitization, edema, and thickened epidermis (2). Although various genetic and environmental factors have been reported to contribute to the pathogenesis and development of AD, the precise cause of AD has not yet been determined (3). Current treatments for AD include topical ointments or systemic oral administration of steroids and antihistamines to decrease inflammatory damage and itching (4). Steroids are widely used to treat AD because they alleviate atopic symptoms, while functioning as anti-inflammatory agents and promoting cell proliferation and immunosuppression. However, prolonged treatment with steroids has side effects such as the development of drug tolerance, endocrine abnormalities, increased susceptibility to infections, metabolic abnormalities, and skin atrophy that leads to the cracking of skin and bleeding (5). Therefore, there is a growing interest in AD treatments using natural materials that have fewer side effects. Natural compounds and natural extracts of various herbs have been reported as potential medicines to prevent and treat inflammatory skin diseases.

Wheat (Triticum sp.) is an important crop worldwide. The young grass of Triticum aestivum, called wheatgrass, is richer in nutrients such as vitamins, minerals, and proteins than the mature cereal plant (6). T. aestivum is used as a health food supplement in the form of tablets, juice, powder, and fresh produce. Many papers report that T. aestivum has anticancer, anti-inflammation, antioxidant (7,8), and therapeutic effects in diseases such as diabetes, colitis, allergies, and heart diseases (9–11). In previous studies, we found that T. aestivum sprouts are effective in treating several diseases, such as diabetes (12), obesity (13,14), liver injury (15,16), and cancer (17). Thus, T. aestivum sprouts represent a potential remedy for these diseases. Furthermore, the dichloromethane fraction of T. aestivum ameliorated allergic reaction by inhibition of Th2 cell differentiation in mice (18). AD is mediated by and related to allergic disease (2). However, the influence of T. aestivum on allergy-mediated inflammation is not clearly understood. In addition, the specific effects of T. aestivum sprouts in AD are not yet known.

In the present study, considering their various biological effects, we evaluated the effects of T. aestivum sprouts in AD. We report the anti-atopic effects of a 70% ethanol extract of T. aestivum sprouts (TAEE) in vitro and in vivo.

Materials and methods

Preparation of TAEE

T. aestivum Lamarck was supplied by the National Institute of Crop Science (Jeonbuk, Korea). After germination, the seeds were grown in organic sterile peat moss at a constant temperature (average 20±2°C). The T. aestivum sprouts were harvested at 2 weeks after germination, lyophilized, and laboratory-scale pulverized. The pulverized T. aestivum sprouts (30 g) were ultrasonically extracted with 70% EtOH for 1 h and then filtered. After evaporation on a rotary vacuum evaporator (N-000; EYELA, Tokyo, Japan), the TAEE was obtained. For subsequent experiments, the TAEE was stored at 4°C and protected from light until immediately before the experiment. The TAEE was dissolved in purified water for use in subsequent experiments.

Cell culture

Human keratinocytes (HaCaT cells) were obtained from the Korean cell line bank (Seoul, Korea). Cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Lonza, Walkersville, MD, USA), containing 10% fetal bovine serum (FBS; Biotechnics Research, CA, USA), 100 units/ml of penicillin, and 100 µg/ml of streptomycin (both Welgene, Seoul, Korea) at 37°C in a humidified 5% CO2 air atmosphere.

Cell Counting kit-8 (CCK-8) assay

The HaCaT cell proliferation rate was evaluated using a CCK-8 (Dojindo, Kumamoto, Japan), according to the manufacturer's instructions. Briefly, HaCaT cells were seeded at 5×103 cells/well in 96-well plates. After incubation for 24 h, the cells were treated with different TAEE concentrations (0–400 µg/ml), and then incubated for another 24 or 48 h. The cells were washed with phosphate-buffered saline (PBS), the CCK-8 solution was added, and the cells were incubation for 1.5 h. The absorbance of cells was measured at 450 nm using a microplate reader (Synergy HTX Multi-Mode Reader; BioTek, Winooski, VT, USA).

Animals and treatment

Female BALB/c mice (4 weeks old) were purchased from Samtako Bio Korea (Osan, Korea). To induce AD-like skin lesions in mice, 2,4-dinitrochlorobenzene (DNCB) was used. The mice were divided into five groups: i) Normal control group, not treated with DNCB; ii) AD group, treated with DNCB; iii) TAEE 100 group, treated with DNCB and administered 100 mg/kg TAEE p.o.; iv) TAEE 200 group, treated with DNCB and administered 200 mg/kg TAEE p.o.; and v) dexa group, treated with DNCB and administered 1 mg/kg dexamethasone p.o. After the mice were acclimatized in the facility for one week, the dorsal skin hairs of the mice were removed using an electronic clipper and hair removal cream, and the skin was allowed to heal for 24 h. A 1% (w/v) DNCB solution was prepared with an acetone and olive oil mixture (4:1, v/v), and the solution was applied to the back of the mice once a day for 3 days from the start of the experiment. Afterwards, a 0.5% DNCB solution was applied once every 2 for 10 days. TAEE or dexamethasone were administered for 10 days from day 4 to day 14 of the experiment. The design of the experiment is summarized in Fig. 1A. The research was conducted in accordance with the ethical regulations of the Animal Experiment Ethics Committee of Chonbuk National University and with their approval (approval no. CBNU 2017-0002).

Figure 1.

TAEE improves clinical symptoms in DNCB-treated mice. (A) The DNCB treatment and oral administration schedule used in this experiment. Dorsal skin was removed from mice following the experiment. The histological status of the tissues was examined using (B) hematoxylin and eosin staining and (C) toluidine blue staining. Magnification, ×100. (D) The thickness of dorsal skin tissues was measured using a thickness gauge. (E) The number of mast cells (red arrows) was counted at randomly selected locations per group. (F) Moisture content (%) was measured using a Tewameter TM 210 device. (G) The serum was collected after the mice were sacrificed and serum IgE levels were measured by ELISA. Values are presented as the mean ± standard error of the mean. Data were analyzed by Tukey's post-hoc test. ###P<0.001 vs. the normal group; *P<0.05, **P<0.01 and ***P<0.001 vs. the DNCB-treated group. TAEE, 70% EtOH extract of T. aestivum sprouts; DNCB, 2,4-dinitrochlorobenzene; Dexa, dexamethasone; IgE, immunoglobulin E.

Histological analysis

Dorsal skin of the mice was sampled, fixed in 4% formaldehyde solution at room temperature for 24 h, and embedded in paraffin. Each paraffin block was serially sectioned into five 4-µm sections (n=5). Each tissue section was deparaffinized with xylene and stained with hematoxylin for 1 min and with eosin for 3 min. Other section was stained with toluidine blue for determining the number of mast cells. After staining, each tissue section was dehydrated, sealed with mounting solution, and examined under an optical microscope (CX21; Olympus, Tokyo, Japan).

Analysis of dorsal skin moisture content

The moisture content of the dorsal skin was analyzed using the TS-skin diagnosis system (Aram Huvis Co., Ltd., Seongnam, Korea), which measures the moisture content (%) based on the electrical capacitance of the skin surface. According to the manufacturer's instructions, three different regions of the dorsal skin were measured for 10 sec each.

Serum IgE measurement

Blood was collected from the mice using 23 G syringes and centrifuged at 3,000 rpm for 10 min to separate the serum. Total serum IgE was analyzed using sandwich enzyme-linked immunosorbent assay (ELISA), performed using a mouse IgE ELISA kit (BD Biosciences, San Jose, CA, USA). After incubation overnight at 4°C with 250 µl of diluted capture antibodies in 0.1 M sodium carbonate (pH 9.5), 200 µl of assay diluent was added to each well and blocked for 1 h at room temperature. The serum and serially diluted standard solutions were dispensed at 100 µl per well and allowed to react at room temperature for 2 h. Diluted detection antibodies and streptavidin-horseradish peroxidase (HRP; 100 µl) were then added into each well and incubated at room temperature for 1 h. Between each step, the wells were washed with 0.05% PBS-Tween-20. After the final wash, 100 µl of the substrate solution was dispensed and allowed to react for 30 min in the dark. To stop the reaction, 50 µl of 2 N H2SO4 was added to each well, and the absorbance was measured at 450 nm using a microplate reader (Synergy HTX Multi-Mode Reader; BioTek).

RNA extraction

Cells were seeded in 6-well plates at a concentration of 1×105 cells/ml. After overnight incubation, the cells were pretreated with TAEE for 2 h and incubated with 10 ng/ml tumor necrosis factor α (TNF-α) and 10 ng/ml interferon γ (IFN-γ; ProSpec-Tany TechnoGene, Rehovot, Israel) for 6 h. In addition, the dorsal skin tissue was cut at the end of the experiment. One milliliter of TRIzol solution (Ambion, Austin, TX, USA) was added to each well to extract the total RNA. The RNA was mixed with 0.2 ml of chloroform and centrifuged at 12,000 rpm at 4°C. The supernatant was collected, mixed with 0.5 ml of 2-propanol, and centrifuged at 12,000 rpm for 10 min, after which the RNA pellets were dried. The dried RNA pellets were dissolved in RNase-free water.

Reverse transcription-polymerase chain reaction (RT-PCR)

Total RNA was quantified using spectrophotometry, after which cDNA was synthesized using 2 µg of total RNA and a PrimeScript™ II 1st strand cDNA synthesis kit (Takara Bio Inc., Otsu, Japan). RT-PCR was performed using a Real-Time™ PCR System with SYBR-Green PCR Master Mix (both Applied Biosystems, Foster City, CA, USA). The PCR conditions were as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. The housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), was simultaneously measured for normalization. The nucleotide sequences of the primers used are shown in Table I.

Table I.

Primer sequences for reverse transcription-polymerase chain reaction.

Table I.

Primer sequences for reverse transcription-polymerase chain reaction.

GeneSenseAnti-senseBPs
hRANTES CGCTGTCATCCTCATTGCTA GCACTTGCCACTGGTGTAGA148
hMDC TGCCGTGATTACGTCCGTTAC AAGGCCACGGTCATCAGAGTAG201
hIP-10 TTGCTGCCTTATCTTTCTGACTC ATGGCCTTCGATTCTGGATT222
mRANTES TGCCCACGTCAAGGAGTATTTC AACCCACTTCTTCTCTGGGTTG112
mMDC GTGGCTCTCGTCCTTCTTGC GGACAGTTTATGGAGTAGCTT249
mIP-10 CTGAGTGGGACTCAAGGGAT TCGTGGCAATGATCTCAACAC151
hSOCS-1 TTTTTCGCCCTTAGCGTGA AGCAGCTCGAAGAGGCAGTC119
GAPDH GAAGGTGAAGGTCGGAGT GAAGATGGTGATGGGATTTC226

[i] h, human; m, mouse; RANTES, regulated on activation, normal T cell expressed and secreted; MDC, macrophage-derived chemokine; IP-10, IFN-γ-induced protein of 10 kd; SOCS-1, suppressor of cytokine signaling; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; BPs, base pairs.

Western blot analysis

HaCaT cells were harvested in PBS. The cells were then centrifuged at 12,000 g for 20 min at 4°C to remove the supernatant, lysed using radioimmunoprecipitation assay (RIPA) lysis buffer (Pierce Biotechnology, Rockford, IL, USA), and kept on ice for 30 min. The extracted proteins were mixed with 5X SDS sample buffer. Lysates were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene difluoride (PVDF) membranes. The membranes were blocked with 5% bovine serum albumin (BSA) in Tris-buffered saline containing 0.1% Tween 20 (TBST) for 1 h at room temperature. The membranes were then incubated with primary antibodies at 4°C overnight. After incubation, the membranes were washed with TBST buffer three times for 15 min and then incubated for 1 h at room temperature with HRP-conjugated secondary antibodies diluted to 1:5,000. Membranes were then washed four times with TBST buffer and protein signals were developed using an enhanced chemiluminescence (ECL) detection kit (Merck Millipore, Burlington, MA, USA). Images were obtained using the Fusion Fx gel documentation system (Vilber Lourmat, Marne-la-Vallee, France).

Statistical analysis

Results are expressed as mean values ± standard error of the mean (SEM). Statistical significance was determined using one-way analysis of variance (ANOVA) with Tukey's post-hoc test to determine differences between groups. All statistical analyses were performed using Graph Pad Prism software 5.0 (Graph Pad Software, Inc. La Jolla, CA, USA). *P<0.05 was considered to indicate a statistically significant difference.

Results

Effects of TAEE on AD-like symptoms in DNCB-treated mice

To investigate the effect of TAEE on AD-like skin lesions, the DNCB-treated mice were orally administered TAEE for 10 days. As a positive control, the Dexa group was orally administered dexamethasone. On day 15 after the start of the experiment, the mice were sacrificed (Fig. 1A). To examine the effect of TAEE on skin thickness, sections of dorsal skin tissue were stained with hematoxylin and eosin (H&E) and observed under a microscope. Repeated DNCB application caused severe skin changes, including skin hypertrophy and fibrosis of the dermis in the dorsal skin tissues of DNCB-treated mice. TAEE treatments lead to reduced skin thickness in a dose-dependent manner. Oral administration of 200 mg/kg TAEE and 1 mg/kg dexamethasone markedly decreased the skin thickness (Fig. 1B and D). Furthermore, to analyze the effect of TAEE on the number of mast cells, sections of dorsal skin tissue were stained with toluidine blue and examined under a microscope. Repeated DNCB application increased the number of mast cells that infiltrated the dermis of the dorsal skin of DNCB-treated mice. Oral administration of TAEE reduced the number of infiltrated mast cells in a dose-dependent manner. Oral administration of 200 mg/kg TAEE and 1 mg/kg dexamethasone significantly decreased the number of mast cells (Fig. 1C and E).

Effects of TAEE on transepidermal water loss (TEWL) in dorsal skin of DNCB-treated mice

AD increases skin moisture loss and impairs the skin barrier function. Therefore, skin hydration is essential to control AD (19). We examined the effect of TAEE on loss of skin moisture induced by DNCB. Fig. 1F shows the moisture content of dorsal skin after 10 days of oral drug administration. We observed a marked decrease in the skin moisture content of down to 40.77% in the DNCB-treated group. Compared with the DNCB-treated group, the skin moisture content increased in a dose-dependent manner by oral administration of TAEE. Oral administration of 200 mg/kg TAEE and 1 mg/kg dexamethasone significantly recovered the TEWL to 55.61 and 55.83%, respectively.

Effects of TAEE on elevation of serum IgE levels in DNCB-treated mice

IgE binds to receptors on the surface of mast cells or white blood cells, leading to an allergic reaction. In addition, IgE antibody production is related to the T helper 2 (Th2) immune response (20). IgE plays an important role in AD occurrence and progression, and patients with AD usually have high serum IgE levels. We analyzed the effect of TAEE on serum levels of total IgE using ELISA. The serum IgE levels were elevated in the DNCB-treated group. Compared with the DNCB-treated group, the serum IgE levels were markedly decreased in a dose-dependent manner by oral administration of TAEE (Fig. 1G).

Effects of TAEE on expression of chemokines in DNCB-treated mice

Keratinocytes are activated by inflammatory stimulation to produce a variety of chemokines. These chemokines include regulated upon activation, normally T-expressed, and presumably secreted (RANTES, also known as CCL5), macrophage-derived chemokine (MDC, also known as CCL22), and IFN-γ-induced protein of 10 kDa (IP-10, also known as CXCL10) (21). To analyze the effects of TAEE on inflammatory chemokines in dorsal skin tissue, we assessed the mRNA levels of RANTES, MDC, and IP-10 using real-time PCR. In skin lesions, the expression levels of RANTES, MDC, and IP-10 were elevated in the DNCB-treated group. Oral administration of TAEE decreased the mRNA levels of RANTES, MDC, and IP-10 in a dose-dependent manner. Oral administration of 200 mg/kg TAEE and 1 mg/kg dexamethasone considerably lowered the mRNA levels of the said chemokines (Fig. 2).

Figure 2.

TAEE decreases inflammatory chemokines in DNCB-treated mice. The mRNA levels of the chemokines (A) RANTES, (B) MDC and (C) IP-10 were determined using reverse transcription-polymerase chain reaction. Values are presented as the mean ± standard error of the mean of three independent experiments. Data were analyzed by Tukey's post-hoc test. ###P<0.001 vs. the normal group; *P<0.05, **P<0.01 and ***P<0.001 vs. the DNCB-treated group. TAEE, 70% EtOH extract of T. aestivum sprouts; DNCB, 2,4-dinitrochlorobenzene; Dexa, dexamethasone; RANTES, regulated upon activation, normally T-expressed, and presumably secreted; MDC, macrophage-derived chemokine IP-10, IFN-γ-induced protein of 10 kDa.

Effects of TAEE on expression of chemokines in TNF-α- and IFN-γ-treated HaCaT cells

We analyzed the effect of TAEE on cell viability in HaCaT cells using the CCK-8 assay. The cells were pretreated with TAEE at doses of 0, 25, 50, 100, 200, and 400 µg/ml for 24 and 48 h. As shown in Fig. 3A, the viability of HaCaT cells was similar at all concentrations. To investigate the effects of TAEE on the expression of inflammatory chemokines in HaCaT cells, we analyzed the mRNA levels of RANTES, MDC, and IP-10 using real-time PCR. As shown Fig. 3, the expression levels of RANTES, MDC, and IP-10 were elevated in TNF-α- and IFN-γ-treated cells. TAEE treatment significantly decreased the mRNA levels of RANTES, MDC, and IP-10.

Figure 3.

TAEE suppresses inflammatory chemokines in TNF-α- and IFN-γ-stimulated HaCaT cells. (A) HaCaT cells were treated with various concentrations of TAEE for 24 and 48 h and the cell viability was determined using the Cell Counting kit assay. Cells were pre-treated with TAEE (50 µg/ml) for 2 h and in the presence of TNF-α (10 ng/ml) and IFN-γ (10 ng/ml) for the indicated time. The mRNA levels of (B) RANTES, (C) MDC and (D) IP-10 were examined using reverse transcription-polymerase chain reaction. GAPDH was used as the internal control. Values are presented as the mean ± standard error of the mean of three independent experiments. Data were analyzed by Tukey's post-hoc test. **P<0.01 and ***P<0.001 vs. 0 h; ###P<0.001. TAEE, 70% EtOH extract of T. aestivum sprouts; TI, TNF-α + IFN-γ; TNF, tumor necrosis factor; IFN, interferon; RANTES, regulated upon activation, normally T-expressed, and presumably secreted; MDC, macrophage-derived chemokine IP-10, IFN-γ-induced protein of 10 kDa.

Effects of TAEE on TNF-α- and IFN-γ-induced STAT1 phosphorylation in HaCaT cells

Previous reports have shown that TNF-α and IFN-γ activate the STAT pathway in human epidermal keratinocytes and that TNF-α- and IFN-γ-induced release of chemokines involves phosphorylation of the STAT1 transcription factor (22). Therefore, we examined STAT1 phosphorylation in TNF-α- and IFN-γ-treated HaCaT cells, with or without TAEE. The results showed that, when compared with the control, treatment with TAEE for 1 h effectively inhibited STAT1 phosphorylation (Fig. 4A and B).

Figure 4.

TAEE inhibits STAT-1 phosphorylation in TNF-α- and IFN-γ-stimulated HaCaT cells. Cells were pre-treated with TAEE (50 µg/ml) for 2 h and in the presence of TNF-α (10 ng/ml) and IFN-γ (10 ng/ml) for the indicated time. (A) The protein levels of phosphorylated and total forms of STAT1 were determined by western blot analysis and (B) the data was quantified. The intensities of the bands are expressed as the mean ± standard error of the mean of three independent experiments. Data were analyzed by Tukey's post-hoc test. ***P<0.001 vs. the TNF-α and IFN-γ treatment-only group. TAEE, 70% EtOH extract of T. aestivum sprouts; T+I, TNF-α + IFN-γ; TNF, tumor necrosis factor; IFN, interferon; STAT1, signal transducer and activator of transcription 1.

Effects of TAEE on SOCS1 expression in TNF-α- and IFN-γ-treated HaCaT cells

SOCS1 exhibits inhibitory activity against STAT1 (23,24). Therefore, we assessed the effects of TAEE on SOCS1. The SOCS1 mRNA levels were examined in TNF-α- and IFN-γ-treated HaCaT cells in the presence or absence of TAEE. As shown in Fig. 5, TAEE markedly enhanced SOCS1 expression compared with the control.

Figure 5.

TAEE induces SOCS1 expression in TNF-α- and IFN-γ-stimulated HaCaT cells. Cells were pre-treated with TAEE (50 µg/ml) for 2 h and in the presence of TNF-α (10 ng/ml) and IFN-γ (10 ng/ml) for the indicated time. The mRNA level of SOCS1 was analyzed using reverse transcription-polymerase chain reaction. GAPDH was used as the internal control. Values are presented as the mean ± standard error of the mean of three independent experiments. Data were analyzed by Tukey's post-hoc test. ***P<0.001 vs. 0 h; ###P<0.001 vs. the TNF-α and IFN-γ treatment-only group. TAEE, 70% EtOH extract of T. aestivum sprouts; TI, TNF-α + IFN-γ; TNF, tumor necrosis factor; IFN, interferon; SOCS1, suppressor of cytokine signaling 1.

Discussion

AD is characterized by relapsing, eczematous skin lesions, skin hypersensitivity, and dry skin, caused by the interaction of Th1 and Th2 cells (2,25). Despite extensive research, the exact cause of AD and a definitive cure remain elusive. Although AD is usually treated with anti-inflammatory or immunosuppressive drugs such as steroids and antihistamines, many of these treatments have serious side effects (26,27). Currently, many patients are turning to alternative strategies that use plant-based natural products with fewer side effects. Therefore, it is essential to investigate health products and new drugs for the safe and effective prevention and treatment of AD. Many plant-based products have been used to treat and meliorate AD (28,29).

T. aestivum sprouts, known as wheatgrass, are consumed in the form of juices or dried powders, and are known as a health food. T. aestivum sprouts contain vitamins A, B, C, and K, calcium, potassium, iron, magnesium, sodium, amino acids, chlorophyll, and minerals (30). In our previous studies, we showed that a dichloromethane fraction isolated from T. aestivum sprouts attenuated the allergic immune response in ovalbumin (OVA)-sensitized mice, which indicated that T. aestivum sprouts might have the potential to regulate the immune response in allergic diseases (18). However, until now, the effect of T. aestivum sprouts on AD, an allergic diseases, was not known. In this study, we examined whether TAEE, as a promising plant candidate compound, could attenuate AD in a DNCB-treated mouse model and in inflammatory cytokine-treated human keratinocytes.

AD patients have skin barrier dysfunctions, such as skin hyperkeratosis and increased TEWL (31). In addition, AD increases the levels of IgE antibodies. When IgE binds to cell surface receptors, mast cells become activated and secrete histamine, causing inflammation and worsening the skin condition. Thus, it is important to reduce serum IgE levels and TEWL. For this reason, we measured skin thickness and moisture content and serum IgE levels in DNCB-treated dermatitis. Oral administration of TAEE significantly reduced TEWL and serum IgE levels when compared to DNCB-treated mice. A histological section of dorsal skin tissues showed that TAEE markedly suppressed an increase in the thickness of the epidermis and dermis, as well as the infiltration of mast cells.

Keratinocytes make up to 90% of cells in the epidermis and, when activated by inflammation (e.g., by TNF-α, and IFN-γ), produce a variety of chemokines. Th2-related chemokines attract inflammatory cells to promote their infiltration into inflammatory skin lesions. These infiltrating inflammatory cells promote a switch from acute to chronic responses in AD. In chronic AD skin lesions, Th1 cells produce TNF-α and IFN-γ. In HaCaT cells, Th2-related chemokines are induced by TNF-α and IFN-γ stimulation. The downregulation of inflammatory chemokine production in keratinocytes may be an effective therapeutic strategy for inflammatory skin diseases.

Many studies have shown that TNF-α and IFN-γ induce the production of Th2-chemokines through STAT in human epidermal keratinocytes (32,33).

The SOCS proteins are cytokine-inducible negative regulators of cytokine signaling, and their levels are increased by IFN-γ treatment. The family consists of three proteins, of which SOCS1 and SOCS3 inhibit increased STAT1 phosphorylation in response to IFN-γ stimulation (23,24).

In the present study, we found that TAEE suppressed the mRNA levels of chemokines such as RANTES, MDC and IP-10 in TNF-α- and IFN-γ-stimulated HaCaT cells and in DNCB-treated mice. In addition, TAEE decreased STAT1 phosphorylation and increased the mRNA levels of SOCS1. Thus, TAEE appears to decrease the expression of chemokines by inhibiting the STAT1 pathway and increasing the level of SOCS1. These results suggest that TAEE exerts its protective effect in skin inflammation by regulating pro-inflammatory chemokines via phosphorylation of STAT1.

In conclusion, the results of our study demonstrate that TAEE is a natural anti-AD compound, which inhibits AD like-skin lesions and the release of inflammatory chemokines in the skin by regulating inflammation and allergy mediators. Thus, TAEE has potential as a natural treatment for inflammatory allergic responses of the skin.

Acknowledgements

Not applicable.

Funding

The present study was financially supported by grants from Wonkwang University (2018).

Availability of data and materials

All data sets generated or analyzed during this article are included within the published article.

Authors' contributions

Y-ML, D-KK and H-HK designed the study. J-HL and H-HK wrote the manuscript. H-HK collected clinical samples. J-HL reviewed and analyzed the data. All authors confirmed and approved review for this manuscript.

Ethics approval and consent to participate

The present study was approved by the Animal Experiment Ethics Committee of Chonbuk National University (approval no. CBNU 2017-0002).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Bieber T: Atopic dermatitis. N Engl J Med. 358:1483–1494. 2008. View Article : Google Scholar : PubMed/NCBI

2 

Leung DY and Bieber T: Atopic dermatitis. Lancet. 361:151–160. 2003. View Article : Google Scholar : PubMed/NCBI

3 

Udompataikul M and Limpa-o-vart D: Comparative trial of 5% dexpanthenol in water-in-oil formulation with 1% hydrocortisone ointment in the treatment of childhood atopic dermatitis: A pilot study. J Drugs Dermatol. 11:366–374. 2012.PubMed/NCBI

4 

Schäkel K, Döbel T and Bosselmann I: Future treatment options for atopic dermatitis-small molecules and beyond. J Dermatol Sci. 73:91–100. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Jeziorkowska R, Sysa-Jędrzejowska A and Samochocki Z: Topical steroid therapy in atopic dermatitis in theory and practice. Postepy Dermatol Alergol. 32:162–166. 2015. View Article : Google Scholar : PubMed/NCBI

6 

Tirgar PR, Thumber BL and Desai TR: Isolation, characterization and biological evaluation of iron chelator from Triticum aestivum (wheat grass). Int J Pharma Bio Sci. 2:288–296. 2011.

7 

Das A, Raychaudhuri U and Chakraborty R: Effect of freeze drying and oven drying on antioxidant properties of fresh wheatgrass. Int J Food Sci Nutr. 63:718–721. 2012. View Article : Google Scholar : PubMed/NCBI

8 

Lee SH, Lee YM, Lee HS and Kim DK: Anti-oxidative and anti-hyperglycemia effects of Triticum aestivum wheat sprout water extracts on the streptozotocin-induced diabetic mice. Korean J Pharmacogn. 40:408–411. 2009.

9 

Ben-Arye E, Goldin E, Wengrower D, Stamper A, Kohn R and Berry E: Wheat grass juice in the treatment of active distal ulcerative colitis: A randomized double-blind placebo-controlled trial. Scand J Gastroenterol. 37:444–449. 2002. View Article : Google Scholar : PubMed/NCBI

10 

Shermer M: Wheatgrass juice and folk medicine. Sci Am. 299:422008. View Article : Google Scholar

11 

Gore RD, Palaskar SJ and Bartake AR: Wheatgrass: Green blood can help to fight cancer. J Clin Diagn Res. 11:ZC40–ZC42. 2017.PubMed/NCBI

12 

Lee SH, Lim SW, Lee YM, Lee HS and Kim DK: Polysaccharide isolated from Triticum aestivum stimulates insulin release from pancreatic cells via the ATP-sensitive K+ channel. Int J Mol Med. 29:913–919. 2012.PubMed/NCBI

13 

Poudel B, Nepali S, Xin M, Ki HH, Kim YH, Kim DK and Lee YM: Flavonoids from Triticum aestivum inhibit adipogenesis in 3T3-L1 cells by upregulating the insig pathway. Mol Med Rep. 12:3139–3145. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Luyen BT, Thao NP, Tai BH, Lim JY, Ki HH, Kim DK, Lee YM and Kim YH: Chemical constituents of Triticum aestivum and their effects on adipogenic differentiation of 3T3-L1 preadipocytes. Arch Pharm Res. 38:1011–1018. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Nepali S, Ki HH, Lee JH, Lee HY, Kim DK and Lee YM: Wheatgrass-derived polysaccharide has antiinflammatory, anti-oxidative and anti-apoptotic effects on lps-induced hepatic injury in mice. Phytother Res. 31:1107–1116. 2017. View Article : Google Scholar : PubMed/NCBI

16 

Nepali S, Ki HH, Lee JH, Cha JY, Lee YM and Kim DK: Triticum aestivum sprout-derived polysaccharide exerts hepatoprotective effects against ethanol-induced liver damage by enhancing the antioxidant system in mice. Int J Mol Med. 40:1243–1252. 2017. View Article : Google Scholar : PubMed/NCBI

17 

Ki HH, Poudel B, Lee JH, Lee YM and Kim DK: In vitro and in vivo anti-cancer activity of dichloromethane fraction of Triticum aestivum sprouts. Biomed Pharmacother. 96:120–128. 2017. View Article : Google Scholar : PubMed/NCBI

18 

Ki HH, Hwang SW, Lee JH, Kim YH, Kim DK and Lee YM: A dichloromethane fraction of Triticum aestivum sprouts reduces allergic immune response through inhibiting Th2 differentiation in ovalbumin-immunized mice. Mol Med Rep. 16:3535–3541. 2017. View Article : Google Scholar : PubMed/NCBI

19 

Werner Y and Lindberg M: Transepidermal water loss in dry and clinically normal skin in patients with atopic dermatitis. Acta Derm Venereol. 65:102–105. 1985.PubMed/NCBI

20 

Bieber T: Atopic dermatitis. Ann Dermatol. 22:125–137. 2010. View Article : Google Scholar : PubMed/NCBI

21 

Sallusto F, Mackay CR and Lanzavecchia A: The role of chemokine receptors in primary, effector, and memory immune responses. Annu Rev Immunol. 18:593–620. 2000. View Article : Google Scholar : PubMed/NCBI

22 

Park JH, Kim MS, Jeong GS and Yoon J: Xanthii fructus extract inhibits TNF-α/IFN-γ-induced Th2-chemokines production via blockade of NF-κB, STAT1 and p38-MAPK activation in human epidermal keratinocytes. J Ethnopharmacol. 171:85–93. 2015. View Article : Google Scholar : PubMed/NCBI

23 

Song MM and Shuai K: The suppressor of cytokine signaling (SOCS) 1 and SOCS3 but not SOCS2 proteins inhibit interferon-mediated antiviral and antiproliferative activities. J Biol Chem. 273:35056–35062. 1998. View Article : Google Scholar : PubMed/NCBI

24 

Croker BA, Kiu H and Nicholson SE: SOCS regulation of the JAK/STAT signalling pathway. Semin Cell Dev Biol. 19:414–422. 2008. View Article : Google Scholar : PubMed/NCBI

25 

Spergel JM and Paller AS: Atopic dermatitis and the atopic march. J Allergy Clin Immunol. 112 6 Suppl:S118–S127. 2003. View Article : Google Scholar : PubMed/NCBI

26 

Saeki H, Nakahara T, Tanaka A, Kabashima K, Sugaya M, Murota H, Ebihara T, Kataoka Y, Aihara M, Etoh T, et al: Clinical practice guidelines for the management of atopic dermatitis 2016. J Dermatol. 43:1117–1145. 2016. View Article : Google Scholar : PubMed/NCBI

27 

Arellano FM, Wentworth CE, Arana A, Fernández C and Paul CF: Risk of lymphoma following exposure to calcineurin inhibitors and topical steroids in patients with atopic dermatitis. J Invest Dermatol. 127:808–816. 2007. View Article : Google Scholar : PubMed/NCBI

28 

Santoro D, Bohannon M, Ahrens K, Navarro C, Gatto H and Marsella R: Evaluation on the effects of 0.1% Peumus boldus leaf and Spiraea ulmaria plant extract combination on bacterial colonization in canine atopic dermatitis: A preliminary randomized, placebo controlled, double-blinded study. Res Vet Sci. 118:164–170. 2018. View Article : Google Scholar : PubMed/NCBI

29 

Yin J, Yoon SH, Ahn HS and Lee MW: Inhibitory activity of allergic contact dermatitis and atopic dermatitis-like skin in BALB/c mouse through oral administration of fermented barks of Alnus sibirica. Molecules. 23:pii: E450. 2018.

30 

Rajesh M and Ramesh BB: A study on wheat grass and its nutritional value. Food Sci Qual Manage. 2:1–8. 2011.

31 

Knor T, Meholjić-Fetahović A and Mehmedagić A: Stratum corneum hydration and skin surface pH in patients with atopic dermatitis. Acta Dermatovenerol Croat. 19:242–247. 2011.PubMed/NCBI

32 

Jeong SJ, Lim HS, Seo CS, Kim JH, Jin SE, Yoo SR and Shin HK: Traditional herbal formula Jakyakgamcho-tang (Paeonia lactiflora and Glycyrrhiza uralensis) impairs inflammatory chemokine production by inhibiting activation of STAT1 and NF-κB in HaCaT cells. Phytomedicin. 22:326–332. 2015. View Article : Google Scholar

33 

Lim HS, Jin SE, Kim OS, Shin HK and Jeong SJ: Alantolactone from saussurea lappa exerts antiinflammatory effects by inhibiting chemokine production and STAT1 phosphorylation in TNF-α and IFN-γ-induced in HaCaT cells. Phytother Res. 29:1088–1096. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Lee JH, Ki HH, Kim DK and Lee YM: Triticum aestivum sprout extract attenuates 2,4‑dinitrochlorobenzene‑induced atopic dermatitis‑like skin lesions in mice and the expression of chemokines in human keratinocytes. Mol Med Rep 18: 3461-3468, 2018.
APA
Lee, J., Ki, H., Kim, D., & Lee, Y. (2018). Triticum aestivum sprout extract attenuates 2,4‑dinitrochlorobenzene‑induced atopic dermatitis‑like skin lesions in mice and the expression of chemokines in human keratinocytes. Molecular Medicine Reports, 18, 3461-3468. https://doi.org/10.3892/mmr.2018.9339
MLA
Lee, J., Ki, H., Kim, D., Lee, Y."Triticum aestivum sprout extract attenuates 2,4‑dinitrochlorobenzene‑induced atopic dermatitis‑like skin lesions in mice and the expression of chemokines in human keratinocytes". Molecular Medicine Reports 18.3 (2018): 3461-3468.
Chicago
Lee, J., Ki, H., Kim, D., Lee, Y."Triticum aestivum sprout extract attenuates 2,4‑dinitrochlorobenzene‑induced atopic dermatitis‑like skin lesions in mice and the expression of chemokines in human keratinocytes". Molecular Medicine Reports 18, no. 3 (2018): 3461-3468. https://doi.org/10.3892/mmr.2018.9339
Copy and paste a formatted citation
x
Spandidos Publications style
Lee JH, Ki HH, Kim DK and Lee YM: Triticum aestivum sprout extract attenuates 2,4‑dinitrochlorobenzene‑induced atopic dermatitis‑like skin lesions in mice and the expression of chemokines in human keratinocytes. Mol Med Rep 18: 3461-3468, 2018.
APA
Lee, J., Ki, H., Kim, D., & Lee, Y. (2018). Triticum aestivum sprout extract attenuates 2,4‑dinitrochlorobenzene‑induced atopic dermatitis‑like skin lesions in mice and the expression of chemokines in human keratinocytes. Molecular Medicine Reports, 18, 3461-3468. https://doi.org/10.3892/mmr.2018.9339
MLA
Lee, J., Ki, H., Kim, D., Lee, Y."Triticum aestivum sprout extract attenuates 2,4‑dinitrochlorobenzene‑induced atopic dermatitis‑like skin lesions in mice and the expression of chemokines in human keratinocytes". Molecular Medicine Reports 18.3 (2018): 3461-3468.
Chicago
Lee, J., Ki, H., Kim, D., Lee, Y."Triticum aestivum sprout extract attenuates 2,4‑dinitrochlorobenzene‑induced atopic dermatitis‑like skin lesions in mice and the expression of chemokines in human keratinocytes". Molecular Medicine Reports 18, no. 3 (2018): 3461-3468. https://doi.org/10.3892/mmr.2018.9339
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team