Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
October-2018 Volume 18 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2018 Volume 18 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Transcriptome sequencing identifies key pathways and genes involved in gastric adenocarcinoma

  • Authors:
    • Wenhu Zhang
    • Shaozhuang Liu
    • Hanxiang Zhan
    • Zhibo Yan
    • Guangyong Zhang
  • View Affiliations / Copyright

    Affiliations: Department of General Surgery, Qilu Hospital of Shandong University, Jinan, Shandong 250012, P.R. China
    Copyright: © Zhang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 3673-3682
    |
    Published online on: August 9, 2018
       https://doi.org/10.3892/mmr.2018.9370
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The present study aimed to investigate the key pathways and genes associated with gastric adenocarcinoma via transcriptome sequencing. Five pairs of gastric adenocarcinoma tissue and normal tumor‑adjacent tissue were harvested. After sequencing, raw data were processed and differentially expressed genes (DEGs) between tumor and control groups were screened, followed by functional enrichment analysis and gene clustering analysis. The effect of DEGs on patient prognosis was analyzed on the basis of the survival data from gastric adenocarcinoma patients in The Cancer Genome Atlas database. Several genes were validated through reverse transcription‑quantitative polymerase chain reaction. In total, 1,477 upregulated and 282 downregulated DEGs were screened in tumor groups. These genes were segregated into four clusters. Genes in cluster 1 were significantly involved in metabolism of xenobiotics by cytochrome P450, genes in cluster 2 were majorly involved in apoptosis, tight junction formation, and platelet activation, genes in cluster 3 were primarily enriched in the p53 signaling pathway and genes in cluster 4 were significantly enriched in the insulin resistance pathway. Furthermore, 15 DEGs significantly influenced prognosis, including F2R, CTHRC1, and RASGRP3. The expression levels of CYP2B6, MAPK13, CTHRC, RASGRP3 and PYGM were consistent with our analysis results. In conclusion, pathways for metabolism of xenobiotics via cytochrome P450, apoptosis, tight junction formation, platelet activation, and insulin resistance may serve important roles in the progression of gastric adenocarcinoma. Notably, CTHRC1 and RASGRP3 may serve as key prognostic markers.

Introduction

Gastric cancer is the third leading cause of cancer-related mortality worldwide (1). Adenocarcinoma constitutes the majority, approximately 90%, of gastric cancer cases (2). Adenocarcinoma is a malignant epithelial tumor that invades the gastric wall, and infiltrates the muscularis mucosae, submucosa, and muscularis propria. Since early gastric cancer yields few symptoms, gastric cancer is usually advanced at diagnosis, which is difficult to cure (3). Advanced-stage gastric adenocarcinoma has a poor prognosis and the spontaneous median survival ranges from 3 to 6 months (4). Achieving a detailed understanding of the genetics and molecular pathogenesis of gastric adenocarcinoma may help improve patient outcomes.

Altered regulation of gene expression programs is important for tumors to express different cancer biomarkers (5,6). A Recent study has achieved considerable progress in identifying the key molecular mediators of gastric cancer. For instance, gene changes in Cadherin 1 expression, AT-rich interaction domain 1A, and ras homolog family member A, as well as some deregulated pathways including AMPK/HNF4a/Wnt5a pathways are associated with gastric malignancy and progression (7–10). Although several genes have been reported, a large proportion of gastric cancer patients have none of these genes in their cancer genome. Therefore, further detailed genomic characterization of gastric cancer patients is required.

Transcriptome sequencing is a rapidly developing approach to provide an unprecedented global view of the transcriptome, thereby revealing the entire transcriptional landscape (11,12). In this study, we used transcriptome sequencing to compare gene expression changes in five pairs of gastric adenocarcinoma tissue and normal tumor-adjacent tissue. Transcriptome sequencing data were then analyzed in silico. The present study aimed to further explore genetic and biochemical markers associated with gastric adenocarcinoma.

Materials and methods

Samples

Five pairs of gastric adenocarcinoma tissue and normal tumor-adjacent tissue were obtained from five gastric adenocarcinoma patients (Table I). The tissue samples were snap-frozen and stored in liquid nitrogen. All patients provided informed consent before the study. In addition, all procedures in this study were approved by our hospital's protection of human ethics committee.

Table I.

Characteristics of patients.

Table I.

Characteristics of patients.

SamplesSexAgeHeight (cm)Weight (kg)Stage
G1Male6417055T1N0M0
G2Female7814960T2N2M1
G3Male6317265T4aN2M0
G4Female8415555T1N0M0
G5Male7417165T1N0M0
RNA isolation, library preparation, and sequencing

Total RNAs were isolated from tumor and paired normal tumor-adjacent tissues using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). RNA integrity was detected using the RNA Nano 6000 Assay kit (Agilent Technologies, Inc., Santa Clara, CA, USA). RNA concentration and purity were assessed using Qubit®RNA Assay kit in Qubit®2.0 Flurometer (Thermo Fisher Scientific, Inc.), and NanoPhotometer® spectrophotometer (Implen, Inc., Westlake Village, CA), respectively. mRNA was then purified using oligo (dT) magnetic beads, and the high-quality mRNA were pooled to generate a cDNA library, using the NEBNext® Ultra™ RNA Library Prep kit for Illumina®. Briefly, mRNA was fragmented into small pieces, followed with first-strand cDNA synthesis with random hexamer-primers. Thereafter, double-stranded cDNA was synthesized and purified with AMPure XP beads. Purified double stranded cDNA was then subjected to end repair, dA tailing, and adaptor ligation. After size selection using AMPure XP beads, cDNA libraries were constructed and sequenced using the Illumina HiSeq 4000 platform.

The data are deposited at National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) database (accession no. SRP119102).

Raw read quality control and reference genome alignment

Raw reads were quality-filtered to obtain clear data via removal of adaptor sequences, ambiguous or low-quality reads and reads with more than 5% N, using Fastx toolkit version 0.0.13 and Prinseq-lite version 0.20.4 (13). The clear reads were aligned with the human reference genome GRCh38 using Tophat (version 2.0.8, http://htseq.readthedocs.io/) (14). The default parameters were the following: read-mismatches, 2; read-gap-length, 2; and min-anchor, 8. Thereafter, the clear reads were annotated using HTseq (version 0.6.1, http://www-huber.embl.de/HTSeq) (15) on the basis of the GRCh38 gene annotation information in gene code.

Identification of differentially expressed genes (DEGs) analysis

The mRNA read counts were transformed into log-counts per million (logCPM) using edger (version 3.4, http://www.bioconductor.org/packages/release/bioc/html/edgeR.html) in R (16,17). Genes with low expression values were excluded. The obtained genes were normalized using trimmed mean of M-values (TMM) algorithm. Thereafter, the normalized data were transformed into a gene expression matrix, using the voom method (18) in limma (version 3.32.5, http://bioconductor.org/packages/release/bioc/html/limma.html) package (19). DEGs were determined using empirical Bayes linear model and the P-value for the expression of all genes was obtained. A P-value <0.05 and|log2 (fold-change)|≥1 were set as the cut-off values. The heatmap of DEGs was clustered using pheatmap (version 1.0.8, http://cran.r-project.org/web/packages/pheatmap) package in R (20).

Functional and pathway enrichment analyses

We used clusterProfiler (version 3.4.4, http://bioconductor.org/packages/release/bioc/html/clusterProfiler.html) to implement Gene Ontology (GO) (21) and Kyoto Encyclopedia of Genes and Genomes (KEGG) (22) analyses for up- and down-regulated DEGs. The Benjamini and Hochberg (BH) method-adjusted P-value <0.05 was used as cut-off criteria.

Gene clustering analysis

On the basis of the gene expression valuesin cancer and control groups, we applied clustering analysis for DEGs using ConsensusClusterPlus (version 1.40.0, http://www.bioconductor.org/packages/release/bioc/html/ConsensusClusterPlus.html) in R (23). The clustering method was K-means algorithm with the Euclidean distance. The number of clusters was identified through cumulative distribution function (24).

PPI network and pathway analyses of clustering module

Based on the clustering modules obtained, we utilized the Search Tool for the Retrieval of Interacting Genes (STRING, Version 10.0, http://www.string-db.org/) (25) database to analyze protein-protein interactions among DEGs. The Cytoscape (version 3.4.0, http://www.cytoscape.org/) (26) software was used to visualize the PPI network. The topological characteristics of nodes in the network were analyzed using CytoNCA (version 2.1.6, http://apps.cytoscape.org/apps/cytonca) (27). Based on the topological propertyscores of nodes, hub proteins (28) were selected. Additionally, we performed KEGG pathway enrichment analysis for genes in clustering modules.

Prognostic analysis

The effect of DEGs on patient prognosis was analyzed using the stomach adenocarcinoma (STAD) survival data in The Cancer Genome Atlas (TCGA) database. In TCGA database, we downloaded the mRNA-Seq and clinical data. In total, 371 samples displayed both gene expression values and clinical data, which were selected for prognostic analysis. Briefly, each DEG was divided into two groups in accordance with its expression level (relative to the median of expression value) in patients, followed by analysis using Kaplan-Meier (KM) survival curves. Significant differences between high- and low-expression groups were analyzed using the log-rank test.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) verification of the expression of key genes

The expression levels of several genes were detected using RT-qPCR based on the five pairs of gastric adenocarcinoma tissue and normal tumor-adjacent tissue. Briefly, total RNAs were isolated using a TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). RNA concentration and quality were determined on a TECAN infinite M100 PRO Biotek microplate reader (Tecan, San Jose, CA, USA). Then 0.5 µg of the total RNA was used from cDNA synthesis using the PrimeScript RT Master Mix (RR036A; Takara Biotechnology Co., Ltd., Dalian, China). RT-qPCR was performed using the SYBR-Green kit (4367659; Thermo Fisher Scientific, Inc.) in the Viia7 Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). The primers used in this study are listed in Table II.

Table II.

Primers used in qPCR.

Table II.

Primers used in qPCR.

Primer nameSequences (5′-3′)
GAPDH-hF TGACAACTTTGGTATCGTGGAAGG
GAPDH-hR AGGCAGGGATGATGTTCTGGAGAG
CYP2B6-hF TCCAGTCCATTACCGCCAAC
CYP2B6-hR GTAAACTTGCCTGTGTGCCC
MAPK13-hF CGTCAACAAGACAGCCTGGGA
MAPK13-hR TGAAGACATCCAGGAGCCCAA
F2R-hF CCGCCTGCTTCAGTCTGTG
F2R-hR TGACCGGGGATCTAAGGTGG
CTHRC1-hF CCGCCAGGTAGGAGCATCAC
CTHRC1-hR TTTCCCTCAGACATTCCCCCT
RASGRP3-hF TCAGTTTCTGACCTCCTGGCA
RASGRP3-hR TGCATGGAAGAAGCAGTCTGT
PYGM-hF AGAAGAGGCGGGAGAGGAAA
PYGM-hR TGTTTGGGGGAGAAGAAGCC
Statistical analysis

Data are presented as mean ± standard deviation. Statistical analysis was performed using SPSS 22.0 (IBM Corp., Armonk, NY, USA). Differences in gene expression levels among different groups were analyzed by one-way analysis of variance. The least square difference test was used for post hoc analyses. P<0.05 was considered significant.

Results

Reference genome alignment

The reads mapped to the human reference genome (GRCh38). The alignment rates of ten samples ranged from 76.58% to 82.83% (data not shown).

Analysis of DEGs

In total, 1477 upregulated and 282 downregulated DEGs were screened out in tumor groups compared with the control. Clustering analysis revealed that DEGs could clearly distinguish between tumor and control groups, as shown in the heatmap (Fig. 1).

Figure 1.

Heatmaps of differentially expressed genes between tumor and control samples. Red represents high expression; blue, low expression.

Functional enrichment analysis

Results of functional enrichment analysis are shown in Fig. 2. Upregulated DEGs were significantly associated with the binding of cell adhesion molecules, and cysteine-type endopeptidase activity, as well as the p53 signaling pathway, and TNF signaling pathway. Downregulated DEGs were significantly associated with the GO term ‘ion channel binding’, and pathway of ‘Vascular smooth muscle contraction’.

Figure 2.

Gene Ontology functions and Kyoto Encyclopedia of Genes and Genomes pathways enriched with upregualted and downregulated differentially expressed genes.

Gene clustering analysis

Using the consensus cluster algorithm, when k=4, the consensus matrix plot (Fig. 3A) presented a clear distribution of high consistency and low consistency in classification. Moreover, the classification achieved the maximum stability when k=4 (Fig. 3B). Furthermore, k=4 was the largest k with an appreciable increase in consensus (Fig. 3C). Therefore, k=4 was considered the optimal clustering number. Based on k=4, four clusters were obtained. The number of genes in clusters 1–4 was 410 (upregulated), 567 (479 upregulated and 88 downregulated), 591 (588 upregulated and 3 downregulated), and 191 (downregulated), respectively.

Figure 3.

(A) Consensus matrix plots of differentially expressed genes; (B) Empirical cumulative distribution function (DF) plots; (C) Delta area plot.

PPI network and pathway analyses of clustering module

The genes in the four clusters were subjected to PPI network analysis. The PPI network of cluster 1 comprised 192 nodes (such as non-SMC condensin I complex subunit H) and 511 edges (Fig. 4); cluster 2, 440 nodes (such as mitogen-activated protein kinase 13 (MAPK13)) and 1,745 edges (Fig. 5); cluster 3, 385 nodes and 1,260 edges (Fig. 6); cluster 4, 40 nodes [glycogen phosphorylase, muscle associated (PYGM)] and 47 edges (Fig. 7). The top five genes with high degrees (hub genes) in the four networks are enlisted in Table III.

Figure 4.

The protein-protein interaction network generated on the basis of genes in the cluster 1. The gray round node represents upregualted genes.

Figure 5.

The protein-protein interaction network generated on the basis of genes in the cluster 2. The gray round node represents upregulated genes and white diamonds indicate downregulated genes.

Figure 6.

The protein-protein interaction network generated on the basis of genes in the cluster 3. The gray round node represents upregulated genes and white diamonds indicate downregulated genes.

Figure 7.

The protein-protein interaction network generated on the basis of genes in the cluster 4. The white diamond node represents downregulated genes.

Table III.

Top five differentially expressed genes with high degrees (hub genes) in four networks.

Table III.

Top five differentially expressed genes with high degrees (hub genes) in four networks.

ClusterNode numberUp DEGsDown DEGsEdge numberDegree top 5 gene
Cluster 11921920511NCAPH, CDX1, DLGAP5, NCAPG, MNX1
Cluster 2440375651,745GGT1, MAPK13, ENO2, TRAP1, DUSP4
Cluster 338538411,260AURKA, CDH17, MYBL2, CDC6, CFTR
Cluster 44004747GHR, PYGM, CSF3, STX1B, FAM149A

KEGG pathway enrichment analysis revealed that genes in cluster 1 were significantly involved in Maturity-onset diabetes among younger individuals, protein digestion and absorption, and xenobiotic metabolism via cytochrome P450; cluster 2, majorly involved in apoptosis, tight junction formation, and platelet activation; cluster 3, primarily enriched in the p53 signaling pathway, cell cycle, and TNF signaling pathway; cluster 4, significantly enriched in insulin resistance and neuroactive ligand-receptor interactions (Fig. 8).

Figure 8.

Kyoto Encyclopedia of Genes and Genomes pathways enriched by genes in the four clusters.

Prognostic analysis

A total of 15 DEGs were identified to significantly influence patient prognosis (Table IV), including cystatin SA (CST2), coagulation factor II thrombin receptor (F2R), Collagen triple helix repeat containing 1 (CTHRC1), and RAS guanylreleasing protein 3 (RASGRP3). Furthermore, 9 genes were identified in cluster 3.

Table IV.

Differentially expressed genes that significantly affect patient prognosis.

Table IV.

Differentially expressed genes that significantly affect patient prognosis.

NamespHigh.medianLow.medianRegulatedCluster
CST20.04217822.1746.22Up1
CTSV0.0348125.5957.39Up1
MATN30.00018421.9868.99Up1
SYT120.04083225.5946.22Up1
F2R0.01366325.5955.39Up2
AADAC0.04763725.6955.39Up3
AGT0.02557326.0255.39Up3
TMEM2430.03148122.1755.39Up3
CTHRC10.00140923.3959.49Up3
F50.00154221.4255.39Up3
KYNU0.01168325.0359.49Up3
MSC0.02815525.1646.22Up3
RASGRP30.03534225.5942.51Up3
SLC7A70.02533222.1742.51Up3
ADPRHL10.04358942.5126.08Down4

[i] p, represents statistical significance analyzed via a log-rank test; High.median, represents median survival time in the high expression group; Low.median, represents median survival time in the low expression group; Regulated, represents variations in the expression level trends of genes (Tumor vs. Control).

RT-qPCR verification of the expression of key genes

Expression levels of CYP2B6, MAPK13, F2R, CTHRC, RASGRP3, and PYGM were determined using RT-qPCR. As shown in Fig. 9, CYP2B6, MAPK13, and CTHRC were significantly upregulated in tumor samples compared with that in control samples (P<0.05). RASGRP3 was also upregulated in tumor tissue but the difference was not significant. Additionally, F2R and PYGM were significantly downregulated in tumor samples compared with control (P<0.05). Taken together, the expression levels of CYP2B6, MAPK13, CTHRC, RASGRP3 and PYGM were consistent with our analysis results.

Figure 9.

Relative expression levels of CTHRC1, CYP2B6, F2R, MAPK13, PYGM and RASGRP3 in gastric adenocarcinoma tissue and normal tumor-adjacent tissue determined by reverse transcription-quantitative polymerase chain reaction. Their expression levels are normalized against GAPDH. *P<0.05, **P<0.01.

Discussion

In total, 1,477 upregulated and 282 downregulated DEGs were screened out in tumor groups compared with the control. These genes were segregated into 4 clusters. Genes in cluster 1 were significantly involved metabolism of xenobiotics via cytochrome P450. Genes in cluster 2 were majorly involved in apoptosis, tight junction formation, and platelet activation. Genes in cluster 3 were primarily enriched in the p53 signaling pathway. Genes in cluster 4 were significantly enriched in the insulin resistance pathway. Furthermore, 15 DEGs were identified to significantly influence patient prognosis, including F2R, CTHRC1, and RASGRP3.

Cytochrome P450 enzymes are predominantly hepatic enzymes involved in drug and xenobiotic metabolism (29). However, reactive intermediates are formed during the conversion of the parent compound to the hydrophilic conjugated product that is cleared via excretion. These intermediates could cause genotoxicity and affect the checkpoint-signaling and stress-signaling pathways to cause aberrant cell growth and alter the cell cycle, thereby leading to tumor initiation (30). Interestingly, some cytochrome P450 family genes are correlated with the progression of gastric adenocarcinoma (31). The present study shows that three differentially expressed cytochrome P450 family genes (CYP2B6, CYP2C9, and CYP3A4) of cluster 1 were significantly enriched in xenobiotic metabolism via cytochrome P450 (hsa00980), suggesting that these DEGs may be involved in the development of gastric adenocarcinoma through xenobiotic metabolism via the cytochrome P450 pathway.

DEGs in cluster 2 were significantly enriched in apoptosis (hsa04210) and tight junction formation (hsa04530). These two pathways are associated with gastric tumorigenesis (32,33). Additionally, platelet activation (hsa04611) was also a significant pathway among genes of cluster 2, which was enriched by MAPK13 (a hub gene) and F2R (prognosis associated gene). MAPK13 encodes the p38d isoform, which plays a role in the tumor initiation (34). Platelets are multifaceted cells, and circulating platelets can influence various pathophysiologic events (35). Platelets exacerbate tumor progression and metastasis (36,37). In 1968, Gasic et al (38) reported that thrombocytopenic mice are protected against metastasis, supporting the relevance of platelets in cancer progression. Together, pathways of apoptosis, tight junction formation, and platelet activation, as well as MAPK13 and F2R may play important roles in gastric adenocarcinoma. Nevertheless, the F2R expression detected in RT-qPCR was inconsistent with the analysis results. Therefore, further study are needed to investigate the role of F2R in gastric adenocarcinoma. Prognostic analysis revealed that most of the obtained prognosis-associated genes were present in cluster 3, including CTHRC1 and RASGRP3. CTHRC1 was first identified during screening of differentially expressed sequences between balloon-injured and normal rat arteries (39). It is overexpressed in several types of malignant tumors, including gastric cancer (40). Tang et al (41) reported that CTHRC1 plays key functional roles in cancer progression by increasing cancer cell invasion and metastasis. RASGRP3 is a member of the RASGRP family that was initially reported to be present in the screen of genes whose overexpression induce fibroblast transformation (42). The involvement of the RasGRP family in cancer progression and development is proving to be extensive (43,44). RASGRP3 could mediate the activation of the Ras signaling pathway, which plays a key role in carcinogenesis (45). Considering the critical roles of CTHRC1 and RASGRP3 in carcinogenesis and the present results, we considered the two genes as important prognostic markers in gastric adenocarcinoma.

PYGM, a hub gene in the PPI network of cluster 4, was involved in the insulin resistance pathway (hsa04931). Insulin resistance is a pathological condition characterized by a decline in the efficiency of insulin signaling for the regulation of blood sugar (46). Insulin is a potent mitogenic agent, which can inhibit apoptosis and promote cell proliferation (47). Trevisan et al (48) reported that the variables related to an increase in insulin resistance are related to an increased risk of death from colorectal cancer. Furthermore, Mu et al (49) reported that insulin resistance was a risk factor for endometrial cancer. Therefore, we speculated that PYGM may be implicated in gastric adenocarcinoma via the insulin resistance pathway.

In conclusion, the present study suggested that pathways of xenobiotic metabolism via cytochrome P450, apoptosis, tight junction formation, platelet activation, and insulin resistance as well as the enriched genes including CYP2B6, MAPK13, and PYGM may play important roles in the progression of gastric adenocarcinoma. Furthermore, CTHRC1 and RASGRP3 may serve as key prognostic markers for gastric adenocarcinoma patients.

Acknowledgements

Not applicable.

Funding

This work was supported by The National Natural Science Foundation of China (grant no. 81370496/H0308) and The Fundamental Research Funds of Shandong University (grant no. 2014QLKY22).

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

WHZ and SZL contributed to the study design, conducting the study, data analysis, and writing of the manuscript. HXZ and ZBY contributed to the data collection and in conducting the study. GYZ contributed to data interpretation and discussion. All authors read and approved the final manuscript.

Ethics approval and consent to participate

All procedures in this study were in accordance with the Declaration of Helsinki and approved by the protection of human ethics committee of Qilu Hospital of Shandong University.

Patient consent for publication

All patients provided informed consent for the study.

Competing interests

The authors declare that they have no competing interests.

References

1 

Stewart B and Wild CP: World Cancer Report 2014. IARC press; Lyon: 2015

2 

Lauren P: The two histological main types of gastric carcinoma: Diffuse and so-called intestinal-type carcinoma. An attempt at a histo-clinical classification. Acta Pathol Microbiol Scand. 64:31–49. 1965. View Article : Google Scholar : PubMed/NCBI

3 

Wadhwa R, Taketa T, Sudo K, Blum MA and Ajani JA: Modern oncological approaches to gastric adenocarcinoma. Gastroenterol Clin North Am. 42:359–369. 2013. View Article : Google Scholar : PubMed/NCBI

4 

Wagner AD, Grothe W, Haerting J, Kleber G, Grothey A and Fleig WE: Chemotherapy in advanced gastric cancer: A systematic review and meta-analysis based on aggregate data. J Clin Oncol. 24:2903–2909. 2006. View Article : Google Scholar : PubMed/NCBI

5 

Chen X, Leung SY, Yuen ST, Chu KM, Ji J, Li R, Chan AS, Law S, Troyanskaya OG, Wong J, et al: Variation in gene expression patterns in human gastric cancers. Mol Biol Cell. 14:3208–3215. 2003. View Article : Google Scholar : PubMed/NCBI

6 

Boussioutas A, Li H, Liu J, Waring P, Lade S, Holloway AJ, Taupin D, Gorringe K, Haviv I, Desmond PV and Bowtell DD: Distinctive patterns of gene expression in premalignant gastric mucosa and gastric cancer. Cancer Res. 63:2569–2577. 2003.PubMed/NCBI

7 

Tan P and Yeoh KG: Genetics and molecular pathogenesis of gastric adenocarcinoma. Gastroenterology. 149:1153–1162.e3. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Pharoah PD, Guilford P and Caldas C; International Gastric Cancer Linkage Consortium, : Incidence of gastric cancer and breast cancer in CDH1 (E-cadherin) mutation carriers from hereditary diffuse gastric cancer families. Gastroenterology. 121:1348–1353. 2001. View Article : Google Scholar : PubMed/NCBI

9 

Chang HR, Nam S, Kook MC, Kim KT, Liu X, Yao H, Jung HR, Lemos R Jr, Seo HH, Park HS, et al: HNF4α is a therapeutic target that links AMPK to WNT signalling in early-stage gastric cancer. Gut. 1–32. 2014.

10 

Kim YH, Liang H, Liu X, Lee JS, Cho JY, Cheong JH, Kim H, Li M, Downey TJ, Dyer MD, et al: AMPKα modulation in cancer progression: Multilayer integrative analysis of the whole transcriptome in Asian gastric cancer. Cancer Res. 72:2512–2521. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Mäder U, Nicolas P, Richard H, Bessières P and Aymerich S: Comprehensive identification and quantification of microbial transcriptomes by genome-wide unbiased methods. Curr Opin Biotechnol. 22:32–41. 2011. View Article : Google Scholar : PubMed/NCBI

12 

Zhang P, Li C, Zhu L, Su X, Li Y, Jin C and Li T: De novo assembly of the sea cucumber Apostichopus japonicus hemocytes transcriptome to identify miRNA targets associated with skin ulceration syndrome. PLoS One. 8:1254–1256. 2013.

13 

Schmieder R and Edwards R: Quality control and preprocessing of metagenomic datasets. Bioinformatics. 27:863–864. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R and Salzberg SL: TopHat2: Accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 14:R362013. View Article : Google Scholar : PubMed/NCBI

15 

Anders S, Pyl PT and Huber W: HTSeq-a Python framework to work with high-throughput sequencing data. Bioinformatics. 31:166–169. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Robinson MD, McCarthy DJ and Smyth GK: edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 26:139–140. 2010. View Article : Google Scholar : PubMed/NCBI

17 

McCarthy DJ, Chen Y and Smyth GK: Differential expression analysis of multifactor RNA-Seq experiments with respect to biological variation. Nucleic Acids Res. 40:4288–4297. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Law CW, Chen Y, Shi W and Smyth GK: voom: Precision weights unlock linear model analysis tools for RNA-seq read counts. Genome biol. 15:R292014. View Article : Google Scholar : PubMed/NCBI

19 

Smyth GK: Limma: Linear models for microarray dataBioinformatics and computational biology solutions using R and Bioconductor. Springer; New York, NY: pp. 397–420. 2005, View Article : Google Scholar

20 

Kolde R: pheatmap: Pretty heatmaps. R package version 1.0. 8. 2015.

21 

Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, et al: Gene ontology: Tool for the unification of biology. The gene ontology consortium. Nat Genet. 25:25–29. 2000. View Article : Google Scholar : PubMed/NCBI

22 

Kanehisa M and Goto S: KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Res. 28:27–30. 2000. View Article : Google Scholar

23 

Wilkerson MD and Hayes DN: ConsensusClusterPlus: A class discovery tool with confidence assessments and item tracking. Bioinformatics. 26:1572–1573. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Xue B, Oldfield CJ, Dunker AK and Uversky VN: CDF it all: Consensus prediction of intrinsically disordered proteins based on various cumulative distribution functions. FEBS Lett. 583:1469–1474. 2009. View Article : Google Scholar : PubMed/NCBI

25 

Szklarczyk D, Franceschini A, Wyder S, Forslund K, Heller D, Huerta-Cepas J, Simonovic M, Roth A, Santos A, Tsafou KP, et al: STRING v10: Protein-protein interaction networks, integrated over the tree of life. Nucleic Acids Res. 43:D447–D452. 2015. View Article : Google Scholar : PubMed/NCBI

26 

Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, Amin N, Schwikowski B and Ideker T: Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 13:2498–2504. 2003. View Article : Google Scholar : PubMed/NCBI

27 

Yu Tang ML, Jianxin, Wang Yi and Pan Fang-Xiang Wu: CytoNCA: A cytoscape plugin for centrality analysis and evaluation of biological networks. Biosystems. 127:67–72. 2015. View Article : Google Scholar : PubMed/NCBI

28 

He X and Zhang J: Why do hubs tend to be essential in protein networks? PLoS Genet. 2:e882006. View Article : Google Scholar : PubMed/NCBI

29 

Nebert DW and Dalton TP: The role of cytochrome P450 enzymes in endogenous signalling pathways and environmental carcinogenesis. Nat Rev Cancer. 6:9472006. View Article : Google Scholar : PubMed/NCBI

30 

Nebert DW and Russell DW: Clinical importance of the cytochromes P450. Lancet. 360:1155–1162. 2002. View Article : Google Scholar : PubMed/NCBI

31 

Tsukino H, Kuroda Y, Qiu D, Nakao H, Imai H and Katoh T: Effects of cytochrome P450 (CYP) 2A6 gene deletion and CYP2E1 genotypes on gastric adenocarcinoma. Int J Cancer. 100:425–428. 2002. View Article : Google Scholar : PubMed/NCBI

32 

Lee SK, Moon J, Park SW, Song SY, Chung JB and Kang JK: Loss of the tight junction protein claudin 4 correlates with histological growth-pattern and differentiation in advanced gastric adenocarcinoma. Oncol Rep. 13:193–199. 2005.PubMed/NCBI

33 

Johnson AH, Frierson HF, Zaika A, Powell SM, Roche J, Crowe S, Moskaluk CA and El-Rifai W: Expression of tight-junction protein claudin-7 is an early event in gastric tumorigenesis. Am J Pathol. 167:577–584. 2005. View Article : Google Scholar : PubMed/NCBI

34 

Yasuda K, Hirohashi Y, Kuroda T, Takaya A, Kubo T, Kanaseki T, Tsukahara T, Hasegawa T, Saito T, Sato N and Torigoe T: MAPK13 is preferentially expressed in gynecological cancer stem cells and has a role in the tumor-initiation. Biochem Biophys Res Commun. 472:643–647. 2016. View Article : Google Scholar : PubMed/NCBI

35 

Franco AT, Corken A and Ware J: Platelets at the interface of thrombosis, inflammation and cancer. Blood. 126:582–588. 2015. View Article : Google Scholar : PubMed/NCBI

36 

Nash GF, Turner LF, Scully MF and Kakkar AK: Platelets and cancer. Lancet Oncol. 3:4252002. View Article : Google Scholar : PubMed/NCBI

37 

Taucher S, Salat A, Gnant M, Kwasny W, Mlineritsch B, Menzel RC, Schmid M, Smola MG, Stierer M, Tausch C, et al: Impact of pretreatment thrombocytosis on survival in primary breast cancer. Thromb Haemost. 89:1098–1106. 2003. View Article : Google Scholar : PubMed/NCBI

38 

Gasic GJ, Gasic TB and Stewart CC: Antimetastatic effects associated with platelet reduction. Proc Natl Acad Sci USA. 61:pp. 46–52. 1968; View Article : Google Scholar : PubMed/NCBI

39 

Pyagay P, Heroult M, Wang Q, Lehnert W, Belden J, Liaw L, Friesel RE and Lindner V: Collagen triple helix repeat containing 1, a novel secreted protein in injured and diseased arteries, inhibits collagen expression and promotes cell migration. Circ Res. 96:261–268. 2005. View Article : Google Scholar : PubMed/NCBI

40 

Wang P, Wang YC, Chen XY, Shen ZY, Cao H, Zhang YJ, Yu J, Zhu JD, Lu YY and Fang JY: CTHRC1 is upregulated by promoter demethylation and transforming growth factor-β1 and may be associated with metastasis in human gastric cancer. Cancer Sci. 103:1327–1333. 2012. View Article : Google Scholar : PubMed/NCBI

41 

Tang L, Dai DL, Su M, Martinka M, Li G and Zhou Y: Aberrant expression of collagen triple helix repeat containing 1 in human solid cancers. Clin Cancer Res. 12:3716–3722. 2006. View Article : Google Scholar : PubMed/NCBI

42 

Ebinu JO, Bottorff DA, Chan EY, Stang SL, Dunn RJ and Stone JC: RasGRP, a Ras guanyl nucleotide-releasing protein with calcium-and diacylglycerol-binding motifs. Science. 280:1082–1086. 1998. View Article : Google Scholar : PubMed/NCBI

43 

Lauchle JO, Kim D, Le DT, Akagi K, Crone M, Krisman K, Warner K, Bonifas JM, Li Q, Coakley KM, et al: Response and resistance to MEK inhibition in leukaemias initiated by hyperactive Ras. Nature. 461:411–414. 2009. View Article : Google Scholar : PubMed/NCBI

44 

Oki-Idouchi CE and Lorenzo PS: Transgenic overexpression of RasGRP1 in mouse epidermis results in spontaneous tumors of the skin. Cancer Res. 67:276–280. 2007. View Article : Google Scholar : PubMed/NCBI

45 

Yang D, Kedei N, Li L, Tao J, Velasquez JF, Michalowski AM, Tóth BI, Marincsák R, Varga A, Bíró T, et al: RasGRP3 contributes to formation and maintenance of the prostate cancer phenotype. Cancer Res. 70:7905–7917. 2010. View Article : Google Scholar : PubMed/NCBI

46 

Djiogue S, Kamdje AH, Vecchio L, Kipanyula MJ, Farahna M, Aldebasi Y and Seke Etet PF: Insulin resistance and cancer: the role of insulin and IGFs. Endocr Relat Cancer. 20:R1–R17. 2013. View Article : Google Scholar : PubMed/NCBI

47 

Bruce W and Corpet D: The colonic protein fermentation and insulin resistance hypotheses for colon cancer etiology: Experimental tests using precursor lesions. Eur J Cancer Prev. 5:41–47. 1996. View Article : Google Scholar : PubMed/NCBI

48 

Trevisan M, Liu J, Muti P, Misciagna G and Menotti A; Risk Factors and Life Expectancy Research Group, : Markers of insulin resistance and colorectal cancer mortality. Cancer Epidemiol Biomarkers Prev. 10:937–941. 2001.PubMed/NCBI

49 

Mu N, Zhu Y, Wang Y, Zhang H and Xue F: Insulin resistance: A significant risk factor of endometrial cancer. Gynecol Oncol. 125:751–757. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang W, Liu S, Zhan H, Yan Z and Zhang G: Transcriptome sequencing identifies key pathways and genes involved in gastric adenocarcinoma. Mol Med Rep 18: 3673-3682, 2018.
APA
Zhang, W., Liu, S., Zhan, H., Yan, Z., & Zhang, G. (2018). Transcriptome sequencing identifies key pathways and genes involved in gastric adenocarcinoma. Molecular Medicine Reports, 18, 3673-3682. https://doi.org/10.3892/mmr.2018.9370
MLA
Zhang, W., Liu, S., Zhan, H., Yan, Z., Zhang, G."Transcriptome sequencing identifies key pathways and genes involved in gastric adenocarcinoma". Molecular Medicine Reports 18.4 (2018): 3673-3682.
Chicago
Zhang, W., Liu, S., Zhan, H., Yan, Z., Zhang, G."Transcriptome sequencing identifies key pathways and genes involved in gastric adenocarcinoma". Molecular Medicine Reports 18, no. 4 (2018): 3673-3682. https://doi.org/10.3892/mmr.2018.9370
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang W, Liu S, Zhan H, Yan Z and Zhang G: Transcriptome sequencing identifies key pathways and genes involved in gastric adenocarcinoma. Mol Med Rep 18: 3673-3682, 2018.
APA
Zhang, W., Liu, S., Zhan, H., Yan, Z., & Zhang, G. (2018). Transcriptome sequencing identifies key pathways and genes involved in gastric adenocarcinoma. Molecular Medicine Reports, 18, 3673-3682. https://doi.org/10.3892/mmr.2018.9370
MLA
Zhang, W., Liu, S., Zhan, H., Yan, Z., Zhang, G."Transcriptome sequencing identifies key pathways and genes involved in gastric adenocarcinoma". Molecular Medicine Reports 18.4 (2018): 3673-3682.
Chicago
Zhang, W., Liu, S., Zhan, H., Yan, Z., Zhang, G."Transcriptome sequencing identifies key pathways and genes involved in gastric adenocarcinoma". Molecular Medicine Reports 18, no. 4 (2018): 3673-3682. https://doi.org/10.3892/mmr.2018.9370
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team