Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
November-2018 Volume 18 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2018 Volume 18 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Association between the methylation of six apoptosis‑associated genes with autism spectrum disorder

  • Authors:
    • Yuanzhi Zhao
    • Cong Zhou
    • Hang Yu
    • Wenwu Zhang
    • Fang Cheng
    • Haihang Yu
    • Dongsheng Zhou
    • Bin Li
    • Jing Liu
    • Jie Dai
    • Jie Zhong
    • Min Chen
    • Tianyi Huang
    • Ranran Pan
    • Shiwei Duan
    • Zhenyu Hu
  • View Affiliations / Copyright

    Affiliations: Department of Child Psychiatry, Ningbo Kangning Hospital, Ningbo, Zhejiang 315211, P.R. China, Medical Genetics Center, School of Medicine, Ningbo University, Ningbo, Zhejiang 315211, P.R. China
  • Pages: 4629-4634
    |
    Published online on: September 10, 2018
       https://doi.org/10.3892/mmr.2018.9473
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Excessive apoptosis hinders the process of brain maturation and is regarded as one of the principal risk factors for the development of autism spectrum disorder (ASD). The aim of the present study was to investigate the association between the methylation of six apoptosis‑associated genes [transforming growth factor β 1 (TGFB1), BCL2 associated X, apoptosis regulator, insulin like growth factor binding protein 3, protein kinase C β 1, presenilin 2 and C‑C motif chemokine ligand 2] and ASD. Using quantitative methylation‑specific polymerase chain reaction technology, DNA methylation levels were detected in 42 autistic and 26 control subjects. The logistic regression analysis results demonstrated that of the six genes, only TGFB1 was significantly hypomethylated in peripheral blood samples from children with autism compared with control samples (mean percentage of methylated reference, 0.011% vs. 0.019%; age‑adjusted P=0.028). In addition, TGFB1 methylation was identified to be positively associated with the interaction ability score from the Autism Behavior Checklist (r=0.452; P=0.035). These data suggested that decreased TGFB1 methylation may contribute to the development of ASD.

Introduction

Autism spectrum disorder (ASD) is a disorder of the central nervous system (CNS) that is characterized by impairments in social communication skills, including difficulties with forming and maintaining relationships (1). According to the data of the 2007 and 2011–2012 US National Survey of Children's Health (NSCH), the prevalence of ASD increased between 1.16 and 2.00% (2). At present, the diagnosis of ASD is primarily based on Childhood Autism Rating Scale (CARS) (3) and Autism Behavior Checklist (ABC) (4) scores. Furthermore, there is no cure for ASD, and medical therapy is limited to managing behavioral symptoms (5).

In addition to exposure to environmental toxins at critical periods during brain development, nutritional influences, genetic predisposition and epigenetic modifications contribute to the development of ASD (6). DNA methylation was suggested as a potential mechanism by which environmental factors confer the risk of ASD (7). Evidence additionally suggested that alterations to DNA methylation are common in multiple brain regions of autistic people (8).

Excessive apoptosis impaired brain maturation and mediated autism-like behaviors (9), and results in CNS dysfunction (10). Transforming growth factor β 1 (TGFB1) serves an important role in cell proliferation, differentiation, invasion, altering the cellular microenvironment and apoptosis (11). TGFB1 expression levels were previously observed to be significantly decreased in the plasma of autistic children (12). Apoptosis regulator BAX protein mediates the translocation of cytochrome c between the outer mitochondrial membrane and the cytosol in the apoptotic process (13). C-C motif chemokine ligand 2 (CCL2) is important in the protection of human neurons and astrocytes from N-methyl-D-aspartate or human immunodeficiency virus-tat-induced apoptosis (14). Insulin like growth factor binding protein 3 (IGFBP3) activates pro-apoptotic factors in various cell lines (15). Protein kinase C β 1 (PRKCB1) was demonstrated to serve a pivotal role in ischemia/reperfusion-induced apoptosis (16). Presenilin 2 (PSEN2) overexpression was previously reported to be a cause of aberrant apoptosis (17).

At present, to the best of the authors' knowledge, there are no existing studies regarding the DNA methylation status of the above six apoptosis-associated genes in ASD, the purpose of the present study was to test the association between ASD and the methylation of these genes.

Materials and methods

Subjects

A total of 68 subjects were recruited for the present study. The ASD group included 42 children diagnosed with ASD (35 males, 7 females; mean age, 4.07±2.78 years). All of the children with autism and the control group were recruited from the Children's Psychiatric Clinic of Ningbo Kangning Hospital (Ningbo, China), and their peripheral blood samples were collected (2 ml) between September 2015 and September 2017. They were diagnosed with ASD by at least two psychiatric chief physicians according to the Diagnostic and Statistical Manual-5 diagnostic criteria (DSM-5, American Psychiatric Association, 2013) (18). The CARS and the ABC was additionally used to confirm the accuracy of the diagnosis (19). The tested phenotypes comprised 21 clinical characteristics, including interaction ability, athletic ability and emotional response. The ABC scale score of the 24 participating children with autism that were tested was 30.10±10.30, and the CARS scale score was 78.00±36.15. Patients diagnosed with mental retardation, congenital/genetic disease or severe physical illness were excluded from the present study. The cases included in this study had a CARS score of >30 points, or an ABC scale score of >31 points. A total of 26 children whose physical examination results were completely normal were included in the control group (22 males, 4 females; mean age, 5.85±0.78 years); none of the control subjects had a family or personal medical history of neurological or psychiatric disorders. The general information of the recruited subjects is presented in Table I. All the participants were Han Chinese. The present study was approved by the Bioethics Committees of Ningbo Kangning Hospital and Ningbo University (Ningbo, China). All the parents or guardians of the participating children provided written informed consent.

Table I.

General information of the individuals in the present study.

Table I.

General information of the individuals in the present study.

VariablesASDControlχ2 valueP-value
No.4226––
Sex, M/F35/722/40.0190.889
Age, years4.07±2.785.85±0.78– 9.5×10−6

[i] ASD, autism spectrum disorder; F, female; M, male.

Quantitative methylation-specific (qMSP) polymerase chain reaction (PCR) assay

The tested fragments of the six genes were obtained from the UCSC genome browser (http://genome.ucsc.edu/). The details of genomic DNA extraction and bisulfite conversion were as described in our previous study (20). The details of the qMSP and the validation of the qMSP products were the same as previously described (21–24). The primer sequences for the six apoptosis-associated genes [TGFB1, BCL2 associated X, apoptosis regulator (BAX), IGFBP3, PRKC1, PSEN2 and CCL2] are presented in Table II.

Table II.

Primer sequences of the six apoptotic genes.

Table II.

Primer sequences of the six apoptotic genes.

GeneForward primer (5′-3′)Reverse primer (5′-3′)Product, bpTm, °C
TGFB1 TTGTAGGTGGATAGTTTC CTACTACCGCTACTACTA8058
BAX GAAGGTATTAGAGTTGCGATT CCAATAAACATCTCCCGATAA7858
IGFBP3 GGTTGTTTAGGGCGAAGTAC GAAACTATAAAATCCAAACAAAAAACG20958
PRKCB CGGCGTGTTTGATGTTATGAT GCAACCATCCAACCAACTC11358
PSEN2 GGTAGGGTCGTAGGTTTA ACTTCTAACTATCTCCTCACTA9858
CCL2 TGTATTGTTAGGGAGTCGGTTA TCGCTACCAACTTACCTTCA8956

[i] TGFB1, transforming growth factor β 1; BAX, BCL2 associated X, apoptosis regulator; IGFBP3, insulin like growth factor binding protein 3; PRKCB, protein kinase C β 1; PSEN2, presenilin 2; CCL2, C-C motif chemokine ligand 2; Tm, melting temperature.

Capillary electrophoresis of qMSP product

To verify that the fragment size matched the theoretical fragment length, the qMSP product was analyzed by the fully automatic capillary electrophoresis apparatus (Qsep100™ Capillary Gel Electrophoresis System; BiOptic, Inc. Taiwan, China). Equipment and reagents used in the present study were self-contained, including a replaceable gel-cartridge kit, 96-well auto-sampler, buffer tank, burette, centrifugal tubes used for Alignment marker, Alignment marker (20 and 1,000 bp), Alignment marker mineral oil, dilution buffer and separation buffer. The gel-cartridges were stored at 4°C and the Alignment marker was stored at −20°C. The percentage of gel matrix in the gel-cartridge was suitable for the analysis of DNA samples of 100–500 bp. One gel-cartridge provides 200 sample injections. All operations were conducted according to the manufacturer's protocol.

Gene expression omnibus (GEO) data-mining study

The mRNA expression data was extracted from the GSE30192 (25) and GSE5230 (26) GEO datasets (www.ncbi.nlm.nih.gov/gds/). 5-Aza-2′-deoxycytidine (5-AZA) was a demethylation agent. The expression values of genes in 5-AZA-treated C2C12 and HepG2 cells were compared with negative controls. Notably, the C2C12 cell line is a mouse myoblast cell line, and the HepG2 cell line was originally identified as a hepatocellular carcinoma cell line; however, has been demonstrated to be derived from hepatoblastoma (27). An independent samples t-test was performed using SPSS 16.0 (SPSS, Inc., Chicago, IL, USA) for the comparison of expression values.

Statistical analysis

Data with normal distribution was presented as the mean ± standard deviation; otherwise, it was presented as the median with interquartile range. Each sample was subjected to three experimental replicates and the mean value was calculated to represent final methylation data. An independent samples t-test was applied to compare the gene methylation data between the case and control groups. A Mann-Whitney U test was used to compare the age distribution between the groups. Pearson's χ2 test was used to compare the sex distribution between the groups. As the age distribution difference was statistically significant between cases and controls, the binary logistic method (28) was used to correct the age difference. The Pearson's correlation test (normal distribution) and Spearman's rank test (abnormal distribution) were used to determine the associations between gene methylation and ABC or CARS scores. An independent samples t-test was applied to compare gene expression between 5-AZA-treated cells and negative controls. Two-tailed P<0.05 was considered to indicate statistically significant difference. The statistical analysis was performed by SPSS version 16.0 (SPSS, Inc., Chicago, IL, USA). All figures were produced with GraphPad Prism 6 software (GraphPad Software, Inc., San Diego, CA, USA).

Results

Location of the tested fragments is identified by the qMSP assay

The tested fragments in the qMSP assay were located in the promoter CpG islands of TGFB1 [chromosome (chr)19:45960809-45961017; Fig. 1A], BAX (chr19:49457911-49457988; data not shown), IGFBP3 (chr7:45960809-45961017; data not shown), PRKC1 (chr3:169940046-169940158; data not shown), PSEN2 (chr1:227058897-227058994; data not shown) and CCL2 (chr17:32581869-32581947; data not shown). The PCR products were verified by capillary electrophoresis (Fig. 1B).

Figure 1.

Location and sequence information of TGFB1 with the PCR product verification. (A) Genomic position and functional annotations of TGFB1 were obtained from UCSC genome browser, according to human 2013 (GRCh38/hg38) assembly. The quantitative methylation-specific primers are underlined and the two ‘CG’ dinucleotides are in grey. (B) Capillary electrophoresis demonstrated that the PCR amplified fragment was 80 bp, which was consistent with the prediction. TGFB1, transforming growth factor β 1; PCR, polymerase chain reaction; UCSC, University of California, Santa Cruz; F, forward; R, reverse; chr, chromosome.

Rate of TGFB1 methylation is significantly decreased in children with ASD

The present analysis demonstrated that the sex distribution was not different between the ASD and control groups (χ2=0.019; P=0.889; Table I); whereas, age distribution differed significantly between the patients with ASD and the controls (4.07±2.78 vs. 5.85±0.78; P<0.0001; Table I). A logistic regression analysis was subsequently conducted to adjust for the difference in age in the analysis of the association of the six apoptosis-associated genes with ASD. The results suggested that the rate of TGFB1 methylation in the blood samples from the children with ASD was significantly decreased compared with the control blood samples (mean percentage of methylated reference, 0.011% vs. 0.019%; adjusted P=0.028; Table III and Fig. 2). There were no significant associations of the remaining five genes with ASD subsequent to age adjustment (Table III).

Figure 2.

Comparisons of TGFB1 methylation levels between ASD cases and normal controls. TGFB1 methylation was significantly decreased in children with ASD compared with the control children (mean percentage of methylated reference, 0.010% vs. 0.018%; P=0.007). *The binary logistic method was used to correct for the age difference (P=0.028). The data are presented as the mean ± standard deviation. TGFB1, transforming growth factor β 1; ASD, autism spectrum disorder.

Table III.

Comparison of apoptotic gene methylation between patients with ASD and the controls.

Table III.

Comparison of apoptotic gene methylation between patients with ASD and the controls.

GenePMR of ASD, %PMR of controls, %P-value P-valuea
TGFB10.011±0.0110.019±0.0160.0070.028
BAX1.104±0.8681.238 (0.033, 3.859)0.5950.644
IGFBP30.032 (0.018, 0.048)0.021 (0.011, 0.030)0.0030.483
CCL23.123 (2.747, 3.848)2.552 (2.064, 3.102) 2×10−40.995
PSEN20.716±0.3960.894 (0.376, 1.592)0.1070.095
PRKCB1.366±0.7250.519 (0.365, 0.814) 3×10−140.281

{ label (or @symbol) needed for fn[@id='tfn3-mmr-18-05-4629'] } PMR values are presented as the median (lower quartile, upper quartile) or the mean ± standard deviation. P-values were calculated using the independent samples t-test

a adjusted to correct the difference in age using the binary logistic method. ASD, autism spectrum disorder; PMR, percentage of methylated reference; TGFB1, transforming growth factor β 1; BAX, BCL2 associated X, apoptosis regulator; IGFBP3, insulin like growth factor binding protein 3; PRKCB, protein kinase C β 1; PSEN2, presenilin 2; CCL2, C-C motif chemokine ligand 2.

TGFB1 methylation is positively correlated with the interaction ability of the ASD group

In the present study, 24 participants with autism were included, and the CARS and ABC were used to assess ASD clinical phenotypes. Using the Spearman's rank correlation coefficient test, it was identified that TGFB1 methylation was positively correlated with the interaction ability of the ASD group (r=0.452; P=0.035; Fig. 3). There was no correlation between TGFB1 methylation and other clinical characteristics (P>0.05; data not shown).

Figure 3.

TGFB1 methylation is positively associated with interaction ability. Spearman's rank correlation coefficient test demonstrated that there was a significant correlation between TGFB1 methylation and interaction ability (P=0.035; r=0.452). TGFB1, transforming growth factor β 1.

TGFB1 mRNA expression levels are increased in 5-AZA-treated cell lines

Due to the lack of TGFB1 expression data for the study participants, it was not possible to assess the effect of TGFB1 methylation on TGFB1 expression. Therefore, a GEO dataset was analyzed to identify that the TGFB1 mRNA expression levels in 5-AZA-treated cell lines were significantly increased compared with the negative controls (C2C12, P=0.022, fold change >1.24; HepG2, P=0.032, fold change >1.96; Fig. 4). These results suggested that TGFB1 expression may be upregulated by TGFB1 hypomethylation, although the cell lines were not CNS-specific.

Figure 4.

TGFB1 mRNA expression levels are increased in 5-AZA-treated C2C12 and HepG2 cell lines. TGFB1, transforming growth factor β 1; 5-AZA, 5-aza-2′-deoxycytidine.

Discussion

In the present study, it was identified that TGFB1 hypomethylation was significantly associated with ASD. Additionally, aberrant TGFB1 methylation was positively correlated with the interaction ability score of the subjects. These data suggested epigenetic dysregulation as a potential mechanism for the development of ASD.

Previous studies have identified that alterations in TGFB1 methylation are associated with the occurrence of CNS disease. Impairment of the TGFB1 signaling pathway is associated with Alzheimer's disease (AD), supporting a role for an alteration in the DNA methylation of TGFB1 in AD pathogenesis (29). As a complex CNS condition, ASD was previously associated with TGFB1-associated apoptotic activity in a number of previous studies (12,30,31). In the present study, it was reported for the first time, to the best of the authors' knowledge, that the hypomethylation of TGFB1 may be associated with ASD. Additionally, it was observed that the hypomethylation of TGFB1 is associated with a decreased interaction ability score, which is an important element of social communication ability.

DNA methylation levels of protein-coding genes are generally negatively correlated with expression levels (32,33). To confirm that the TGFB1 gene methylation identified in the present study affected TGFB1 expression, the association between TGFB1 methylation and TGFB1 expression was examined by GEO data-mining. The present analysis demonstrated that TGFB1 expression was increased in cells following treatment with the demethylation agent 5-AZA. Although the cell lines were not CNS specific, it is sufficient to demonstrate the negative correlation between methylation and expression of the TGFB1 gene. Therefore, it was hypothesized that TGFB1 hypomethylation causes TGFB1 overexpression, leading to subsequent disturbances in apoptosis, inducing cerebral dysplasia and eventually contributing to the development of ASD.

Additionally, other apoptosis-associated genes were considered in the present study that encode proteins previously described to be associated with apoptosis in the brain or ASD. Psychiatric symptoms were accompanied with altered BAX expression and increased neuronal apoptosis in the medial prefrontal cortex in a rat model (34). Children with autism demonstrated increased deficits in cognitive functions, in addition to altered expression levels of immunological markers, including CCL2 (35) and significantly increased blood IGFBP-3 expression levels (36), compared with children without autism. Functional variants of PRKCB1 were identified to be associated with an increased likelihood of ASD (37). PSEN2 overexpression was observed to induce excessive apoptosis (17). Although the present study was unable to identify any association between the methylation of these genes and ASD, further studies with larger cohorts are required to clarify their roles in ASD.

There were specific limitations to the present study. The verification of the regulatory mechanism of TGFB1 hypomethylation was based on the GEO data analysis, and the cell lines analyzed were not CNS-specific. Validation with clinical samples is required to confirm the association between TGFB1 gene methylation and expression. In addition, as the present results were based on a relatively small sample size, larger samples are required to confirm the present results. Furthermore, as obtaining brain tissue from study subjects is not possible, the DNA methylation levels of the six genes were only tested in peripheral blood samples. Further studies are required to examine whether gene methylation may be detected in brain tissue, similar to peripheral blood.

In conclusion, the present data suggested that TGFB1 hypomethylation may be associated with ASD. The correlation between TGFB1 hypomethylation and interaction ability may provide novel molecular insight for the understanding of the development of ASD.

Acknowledgements

Not applicable.

Funding

This research was supported by grants from the Medical Science and Technology Project of Zhejiang Province (grant no. 2017207569) and the K.C. Wong Magna Fund of Ningbo University.

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

SD, ZH and YZ contributed to the conception and design of the study, and the final approval of the manuscript. CZ, HanY, WZ, FC, HaiY, DZ, BL, JL, JD, JZ, MC, TH and RP performed the data analyses and conducted the experiments. YZ and CZ created the figures and tables, and wrote the paper. All authors read and approved the final version of the manuscript.

Ethics approval and consent to participate

The present study was approved by the Bioethics Committees in Ningbo Kangning Hospital (Ningbo, China) and Ningbo University (Ningbo, China). All the parents or guardians of the participating children provided written informed consent.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Jones RM, Pickles A and Lord C: Evaluating the quality of peer interactions in children and adolescents with autism with the Penn Interactive Peer Play Scale (PIPPS). Mol Autism. 8:282017. View Article : Google Scholar : PubMed/NCBI

2 

Blumberg SJ, Bramlett MD, Kogan MD, Schieve LA, Jones JR and Lu MC: Changes in prevalence of parent-reported autism spectrum disorder in school-aged U.S. children: 2007 to 2011–2012. Natl Health Stat Rep. 1–11. 2013.

3 

Avcil S, Baykara B, Baydur H, Munir KM and Inal Emiroglu N: The validity and reliability of the Social Communication Questionnaire-Turkish form in autistics aged 4–18 years. Turk Psikiyatri Derg. 26:56–64. 2015.(In Turkish). PubMed/NCBI

4 

Krug DA, Arick J and Almond P: Behavior checklist for identifying severely handicapped individuals with high levels of autistic behavior. J Child Psychol Psychiatry. 21:221–229. 1980. View Article : Google Scholar : PubMed/NCBI

5 

Wink LK, Plawecki MH, Erickson CA, Stigler KA and McDougle CJ: Emerging drugs for the treatment of symptoms associated with autism spectrum disorders. Expert Opin Emerg Drugs. 15:481–494. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Siniscalco D, Cirillo A, Bradstreet JJ and Antonucci N: Epigenetic findings in autism: New perspectives for therapy. Int J Environ Res Public Health. 10:4261–4273. 2013. View Article : Google Scholar : PubMed/NCBI

7 

Keil KP and Lein PJ: DNA methylation: A mechanism linking environmental chemical exposures to risk of autism spectrum disorders? Environ Epigenet. 2(pii): dvv0122016. View Article : Google Scholar : PubMed/NCBI

8 

Ladd-Acosta C, Hansen KD, Briem E, Fallin MD, Kaufmann WE and Feinberg AP: Common DNA methylation alterations in multiple brain regions in autism. Mol Psychiatry. 19:862–871. 2014. View Article : Google Scholar : PubMed/NCBI

9 

Wei H, Alberts I and Li X: The apoptotic perspective of autism. Int J Dev Neurosci. 36:13–18. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Kim JE, Shin MS, Seo TB, Ji ES, Baek SS, Lee SJ, Park JK and Kim CJ: Treadmill exercise ameliorates motor disturbance through inhibition of apoptosis in the cerebellum of valproic acid-induced autistic rat pups. Mol Med Rep. 8:327–334. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Zhong J, Liu C, Zhang QH, Chen L, Shen YY, Chen YJ, Zeng X, Zu XY and Cao RX: TGF-β1 induces HMGA1 expression: The role of HMGA1 in thyroid cancer proliferation and invasion. Int J Oncol. 50:1567–1578. 2017. View Article : Google Scholar : PubMed/NCBI

12 

Ashwood P, Enstrom A, Krakowiak P, Hertz-Picciotto I, Hansen RL, Croen LA, Ozonoff S, Pessah IN and Van de Water J: Decreased transforming growth factor beta1 in autism: A potential link between immune dysregulation and impairment in clinical behavioral outcomes. J Neuroimmunol. 204:149–153. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Simonyan L, Renault TT, Novais MJ, Sousa MJ, Côrte-Real M, Camougrand N, Gonzalez C and Manon S: Regulation of Bax/mitochondria interaction by AKT. FEBS Lett. 590:13–21. 2016. View Article : Google Scholar : PubMed/NCBI

14 

Eugenin EA, D'Aversa TG, Lopez L, Calderon TM and Berman JW: MCP-1 (CCL2) protects human neurons and astrocytes from NMDA or HIV-tat-induced apoptosis. J Neurochem. 85:1299–1311. 2003. View Article : Google Scholar : PubMed/NCBI

15 

Luo LL, Zhao L, Xi M, He LR, Shen JX, Li QQ, Liu SL, Zhang P, Xie D and Liu MZ: Association of insulin-like growth factor-binding protein-3 with radiotherapy response and prognosis of esophageal squamous cell carcinoma. Chin J Cancer. 34:514–521. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Schechter B, Rosing MA, Wilchek M and Arnon R: Blood levels and serum protein binding of cis-platinum(II) complexed to carboxymethyl-dextran. Cancer Chemother Pharmacol. 24:161–166. 1989. View Article : Google Scholar : PubMed/NCBI

17 

Kumar A, Sivanandam TM and Thakur MK: Presenilin 2 overexpression is associated with apoptosis in Neuro2a cells. Transl Neurosci. 7:71–75. 2016. View Article : Google Scholar : PubMed/NCBI

18 

American Psychiatric Association, . Diagnostic and Statistical Manual of Mental Disorders. 5th. Arlington, VA: American Psychiatric Publishing; 2013

19 

Rellini E, Tortolani D, Trillo S, Carbone S and Montecchi F: Childhood Autism Rating Scale (CARS) and Autism Behavior Checklist (ABC) correspondence and conflicts with DSM-IV criteria in diagnosis of autism. J Autism Dev Disord. 34:703–708. 2004. View Article : Google Scholar : PubMed/NCBI

20 

Li J, Chen C, Bi X, Zhou C, Huang T, Ni C, Yang P, Chen S, Ye M and Duan S: DNA methylation of CMTM3, SSTR2 and MDFI genes in colorectal cancer. Gene. 630:1–7. 2017. View Article : Google Scholar : PubMed/NCBI

21 

Hu H, Chen X, Wang C, Jiang Y, Li J, Ying X, Yang Y, Li B, Zhou C and Zhong J: The role of TFPI2 hypermethylation in the detection of gastric and colorectal cancer. Oncotarget. 8:84054–84065. 2017. View Article : Google Scholar : PubMed/NCBI

22 

Chen R, Hong Q, Jiang J, Chen X, Jiang Z, Wang J, Liu S, Duan S and Shi S: AGTR1 promoter hypermethylation in lung squamous cell carcinoma but not in lung adenocarcinoma. Oncol Lett. 14:4989–4994. 2017. View Article : Google Scholar : PubMed/NCBI

23 

Li B, Chen X, Jiang Y, Yang Y, Zhong J, Zhou C, Hu H and Duan S: CCL2 promoter hypomethylation is associated with gout risk in Chinese Han male population. Immunol Lett. 190:15–19. 2017. View Article : Google Scholar : PubMed/NCBI

24 

Yang Y, Chen X, Hu H, Jiang Y, Yu H, Dai J, Mao Y and Duan S: Elevated UMOD methylation level in peripheral blood is associated with gout risk. Sci Rep. 7:111962017. View Article : Google Scholar : PubMed/NCBI

25 

Hupkes M, Jonsson MK, Scheenen WJ, van Rotterdam W, Sotoca AM, van Someren EP, van der Heyden MA, van Veen TA, van Ravestein-van Os RI, Bauerschmidt S, et al: Epigenetics: DNA demethylation promotes skeletal myotube maturation. FASEB J. 25:3861–3872. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Dannenberg LO and Edenberg HJ: Epigenetics of gene expression in human hepatoma cells: Expression profiling the response to inhibition of DNA methylation and histone deacetylation. BMC Genomics. 7:1812006. View Article : Google Scholar : PubMed/NCBI

27 

Lopez-Terrada D, Cheung SW, Finegold MJ and Knowles BB: Hep G2 is a hepatoblastoma-derived cell line. Hum Pathol. 40:1512–1515. 2009. View Article : Google Scholar : PubMed/NCBI

28 

Zhong J, Chen X, Ye H, Wu N, Chen X and Duan S: CDKN2A and CDKN2B methylation in coronary heart disease cases and controls. Exp Ther Med. 14:6093–6098. 2017.PubMed/NCBI

29 

Cong L, Jia J, Qin W, Ren Y and Sun Y: Genome-wide analysis of DNA methylation in an APP/PS1 mouse model of Alzheimer's disease. Acta Neurol Belg. 114:195–206. 2014. View Article : Google Scholar : PubMed/NCBI

30 

Okada K, Hashimoto K, Iwata Y, Nakamura K, Tsujii M, Tsuchiya KJ, Sekine Y, Suda S, Suzuki K, Sugihara G, et al: Decreased serum levels of transforming growth factor-beta1 in patients with autism. Prog Neuropsychopharmacol Biol Psychiatry. 31:187–190. 2007. View Article : Google Scholar : PubMed/NCBI

31 

Depino AM, Lucchina L and Pitossi F: Early and adult hippocampal TGF-β1 overexpression have opposite effects on behavior. Brain Behav Immun. 25:1582–1591. 2011. View Article : Google Scholar : PubMed/NCBI

32 

Dunn BK: Hypomethylation: One side of a larger picture. Ann N Y Acad Sci. 983:28–42. 2003. View Article : Google Scholar : PubMed/NCBI

33 

Moore LD, Le T and Fan G: DNA methylation and its basic function. Neuropsychopharmacology. 38:23–38. 2013. View Article : Google Scholar : PubMed/NCBI

34 

Li Y, Han F and Shi Y: Increased neuronal apoptosis in medial prefrontal cortex is accompanied with changes of Bcl-2 and Bax in a rat model of post-traumatic stress disorder. J Mol Neurosci. 51:127–137. 2013. View Article : Google Scholar : PubMed/NCBI

35 

Han YM, Cheung WK, Wong CK, Sze SL, Cheng TW, Yeung MK and Chan AS: Distinct Cytokine and Chemokine Profiles in Autism Spectrum Disorders. Front Immunol. 8:112017. View Article : Google Scholar : PubMed/NCBI

36 

Mills JL, Hediger ML, Molloy CA, Chrousos GP, Manning-Courtney P, Yu KF, Brasington M and England LJ: Elevated levels of growth-related hormones in autism and autism spectrum disorder. Clin Endocrinol. 67:230–237. 2007. View Article : Google Scholar

37 

Lintas C, Sacco R, Garbett K, Mirnics K, Militerni R, Bravaccio C, Curatolo P, Manzi B, Schneider C, Melmed R, et al: Involvement of the PRKCB1 gene in autistic disorder: Significant genetic association and reduced neocortical gene expression. Mol Psychiatry. 14:705–718. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhao Y, Zhou C, Yu H, Zhang W, Cheng F, Yu H, Zhou D, Li B, Liu J, Dai J, Dai J, et al: Association between the methylation of six apoptosis‑associated genes with autism spectrum disorder. Mol Med Rep 18: 4629-4634, 2018.
APA
Zhao, Y., Zhou, C., Yu, H., Zhang, W., Cheng, F., Yu, H. ... Hu, Z. (2018). Association between the methylation of six apoptosis‑associated genes with autism spectrum disorder. Molecular Medicine Reports, 18, 4629-4634. https://doi.org/10.3892/mmr.2018.9473
MLA
Zhao, Y., Zhou, C., Yu, H., Zhang, W., Cheng, F., Yu, H., Zhou, D., Li, B., Liu, J., Dai, J., Zhong, J., Chen, M., Huang, T., Pan, R., Duan, S., Hu, Z."Association between the methylation of six apoptosis‑associated genes with autism spectrum disorder". Molecular Medicine Reports 18.5 (2018): 4629-4634.
Chicago
Zhao, Y., Zhou, C., Yu, H., Zhang, W., Cheng, F., Yu, H., Zhou, D., Li, B., Liu, J., Dai, J., Zhong, J., Chen, M., Huang, T., Pan, R., Duan, S., Hu, Z."Association between the methylation of six apoptosis‑associated genes with autism spectrum disorder". Molecular Medicine Reports 18, no. 5 (2018): 4629-4634. https://doi.org/10.3892/mmr.2018.9473
Copy and paste a formatted citation
x
Spandidos Publications style
Zhao Y, Zhou C, Yu H, Zhang W, Cheng F, Yu H, Zhou D, Li B, Liu J, Dai J, Dai J, et al: Association between the methylation of six apoptosis‑associated genes with autism spectrum disorder. Mol Med Rep 18: 4629-4634, 2018.
APA
Zhao, Y., Zhou, C., Yu, H., Zhang, W., Cheng, F., Yu, H. ... Hu, Z. (2018). Association between the methylation of six apoptosis‑associated genes with autism spectrum disorder. Molecular Medicine Reports, 18, 4629-4634. https://doi.org/10.3892/mmr.2018.9473
MLA
Zhao, Y., Zhou, C., Yu, H., Zhang, W., Cheng, F., Yu, H., Zhou, D., Li, B., Liu, J., Dai, J., Zhong, J., Chen, M., Huang, T., Pan, R., Duan, S., Hu, Z."Association between the methylation of six apoptosis‑associated genes with autism spectrum disorder". Molecular Medicine Reports 18.5 (2018): 4629-4634.
Chicago
Zhao, Y., Zhou, C., Yu, H., Zhang, W., Cheng, F., Yu, H., Zhou, D., Li, B., Liu, J., Dai, J., Zhong, J., Chen, M., Huang, T., Pan, R., Duan, S., Hu, Z."Association between the methylation of six apoptosis‑associated genes with autism spectrum disorder". Molecular Medicine Reports 18, no. 5 (2018): 4629-4634. https://doi.org/10.3892/mmr.2018.9473
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team