Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
October-2019 Volume 20 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2019 Volume 20 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article Open Access

TGF‑β induces periodontal ligament stem cell senescence through increase of ROS production

  • Authors:
    • Chun Fan
    • Qiuxia Ji
    • Chunyang Zhang
    • Shuo Xu
    • Hui Sun
    • Zhiyuan Li
  • View Affiliations / Copyright

    Affiliations: Department of Periodontology, Affiliated Hospital of Qingdao University, Qingdao, Shandong 266555, P.R. China, Key Laboratory, Department of Otolaryngology‑Head and Neck Surgery, Affiliated Hospital of Qingdao University, Qingdao, Shandong 266555, P.R. China
    Copyright: © Fan et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 3123-3130
    |
    Published online on: August 9, 2019
       https://doi.org/10.3892/mmr.2019.10580
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Periodontal ligament stem cells (PDLSCs) are vital for the regeneration of periodontal tissue. Transforming growth factor (TGF) β1, a potent stimulator of tissue regeneration, is extensive and abundant in the bone matrix. However, the effect of TGF‑β1 in periodontal differentiation remains to be elucidated. The present study aimed to evaluate the effect of TGF‑β1 on human PDLSCs. PDLSCs were isolated using CD146 microbeads, and characterized by flow cytometry. The present study demonstrated that treatment with TGF‑β1 induced PDLSC senescence, characterized by increases in senescence‑associated beta‑galactosidase activity and elevation of both p16 and p21 expression. Furthermore, TGF‑β1 treatment demonstrated the capacity to induce the production of reactive oxygen species (ROS). Of note, addition of a ROS scavenger successfully rescued the TGF‑β1‑induced PDLSC senescence. Thus, the present results indicated that TGF‑β1 may serve a vital role in PDLSC senescence, and thus represent a potential target involved in the fabrication and formation of hard tissue for clinical treatment.

Introduction

Periodontal ligament (PDL) is the connective tissue located between the alveolar bone and tooth root. If PDL is severely damaged by periodontitis, regeneration is difficult (1). Periodontal ligament stem cells (PDLSCs) are essential for periodontal tissue regeneration, which often forms a cementum/PDL-like structure after transplantation in vivo (1,2). However, the mechanisms responsible for regulating PDLSC differentiation have yet to be fully elucidated. PDL regeneration involves fiber fabrication and hard tissue formation, such as alveolar bone and cementum. It is significative for the stimulation of PDLSCs to differentiate into osteoblast, cementoblast and ligaments in damaged periodontal tissue regeneration. The use of morphogens and growth factors have been shown to stimulate PDLSC differentiation (3–5).

Transforming growth factor (TGF) β1 is a potent stimulator of tissue regeneration, and is abundant in the bone matrix (6,7). A previous study found that TGF-β1 can improve bone regeneration in animal models of guided tissue regeneration (8). However, a previous study reported that TGF-β1 inhibited primary PDL cell cementogenic and osteogenic differentiation via competition with bone morphogenetic protein 2 (9). The differential effects of TGF-β1 on fibrogenesis, chondrogenesis and osteogenesis have been identified by comparing in vivo and in vitro experiments, suggesting a controversial role for TGF-β1 in periodontal differentiation (10,11).

Cellular senescence results in irreversible cell cycle arrest, as well as a series of morphological and functional changes, which may further inhibit the potential for self-renewal in PDLSCs (12–14). The acquisition of a senescence-associated secretory phenotype (SASP) reinforces senescence and stimulates the immune system to clear the senescent cells (15). Cellular senescence can be induced by various stimuli and stressors, including DNA damage, metabolic insults, oxidative stresses, oncogene activation and epigenetic changes (16–18). A number of studies suggest that TGF-β1 is also capable of inducing senescence in tumor and other cells (19–21). However, whether TGF-β1 induces PDLSC senescence has yet to be clarified. Thus, the present study attempted to investigate the effect of TGF-β1 on the senescence of PDLSCs and its association to reactive oxygen species (ROS) generation, in order to elucidate the function of TGF-β1 in periodontal differentiation.

Materials and methods

Human PDLSC culture and treatment

PDL tissues were collected from healthy third molar teeth extracted from ten male and eight female dental surgery patients aged between 18 and 25 years old who had visited the Department of Periodontology in the Affiliated Hospital of Qingdao University from February 2018 to April 2019. The study guidelines were approved by the Review Board of the Affiliated Hospital of Qingdao University. Normal periodontal tissues were digested using dispase (4 mg/ml; Sigma-Aldrich; Merck KGaA) and collagenase (3 mg/ml; Sigma-Aldrich; Merck KGaA) for 1 h at 37°C. Cell suspensions were cultured in α-MEM (HyClone; GE Healthcare Life Sciences) supplemented with 20% fetal bovine serum (HyClone; GE Healthcare Life Sciences) and 1% streptomycin and penicillin at 37°C in 5% CO2. PDLSCs were isolated from third-passage periodontal ligament cells using a cluster of differentiation (CD)146 microbead kit (Miltenyi Biotec GmbH) according to the manufacturer's instructions. For characterization of the isolated cells, the PDLSCs were pre-incubated with Human TruStain FcX™ (Fc Receptor Blocking Solution; cat. no. 422301; BioLegend, Inc.) for 10 min at room temperature, and then stained with the following antibodies for 30 min at 4°C: Anti-human PE-conjugated CD34 (cat. no. 12-0349-42), CD44 (cat. no. 12-0441-82), CD45 (cat. no. 12-9459-42), CD90 (cat. no. 12-0909-42) and CD105 (cat. no. 12-1057-42) antibodies (eBioscience; Thermo Fisher Scientific, Inc.). Flow cytometry analysis was performed on a FACS Calibur flow cytometer (BD Biosciences) and analyzed using WinMDI version 2.9 software (http://www.cyto.purdue.edu/flowcyt/software/Winmdi.htm).

For cell treatments, the isolated PDLSCs were starved in serum-free α-MEM overnight and then cultured in fresh serum-free α-MEM supplemented with TGF-β1 (10 ng/ml; PeproTech, Inc.,) alone, or in combination with N-acetyl-L-cysteine (NAC; 10 mM; Beyotime Institute of Biotechnology) or LY364947 (2 µM; Selleck Chemicals).

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was extracted from cultured PDLSCs with TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and then reverse-transcribed to cDNA using a PrimeScript RT reagent kit (Takara Bio, Inc.) according to the manufacturer's protocols. qPCR analysis was performed on a Light Cycler 96 (Roche Diagnostics GmbH) using SYBR Green mix (Takara Bio, Inc.). Samples were initially denatured for 30 sec at 95°C, followed by 40 cycles of denaturation for 5 sec at 95°C and annealing for 30 sec at 60°C. Primers used for qPCR are listed in Table I. The 2−∆∆Cq method normalized to GAPDH was used for quantification (22). Experiments were repeated three times independently.

Table I.

Primers used for reverse transcription-quantitative PCR.

Table I.

Primers used for reverse transcription-quantitative PCR.

GenePrimerSequence (5′-3′)
GAPDHForward AGGGCTGCTTTTAACTCTGGT
Reverse CCCCACTTGATTTTGGAGGGA
IL-6Forward GATGAGTACAAAAGTCCTGATCCA
Reverse CTGCAGCCACTGGTTCTGT
IL-8Forward TTGGCAGCCTTCCTGATTTC
Reverse TGGTCCACTCTCAATCACTCTCA
IL-18Forward CACCCCGGACCATATTTATTATAAGT
Reverse TGTTATCAGGAGGATTCATTTCCTT
P21Forward GCCTGGACTGTTTTCTCTCG
Reverse ATTCAGCATTGTGGGAGGAG
P16Forward CACGGGTCGGGTGAGAGT
Reverse CCCAACGCACCGAATAGTTAC

[i] IL, interleukin.

ROS measurement

ROS were detected using a MitoSOX Red Superoxide Indicator (Invitrogen; Thermo Fisher Scientific, Inc.), or hydrogen peroxide-specific peroxy orange 1 (PO1; APExBIO Technology LLC) probe. Following treatment with TGF-β1, PDLSCs were incubated with 5 µM MitoSOX Red for 10 min, or 5 µM PO1 for 30 min at 37°C. Fluorescence was detected by a FACSCalibur flow cytometer (BD Biosciences) and analyzed using WinMDI version 2.9 software.

Western blot analysis

PDLSCs treated with TGF-β1 were lysed in 2% SDS lysis buffer (Beyotime Institute of Biotechnology). The concentration of protein lysates were assayed using a Pierce™ BCA protein assay kit (cat. no. 23225; Thermo Fisher Scientific, Inc.). A total of 20 µg of protein was resolved via 12% SDS-PAGE and transferred to 0.45-µm PVDF membranes. Following 1 h of blocking with 5% skimmed milk at room temperature, PVDF membranes were incubated with the following primary antibodies: Anti-α-tubulin (1:5,000; cat. no. 11224-1; ProteinTech Group, Inc.); anti-p21 (1:1,000; cat. no. ab109520; Abcam); anti-p16 (1:1,000; cat. no. ab108349; Abcam); and anti-superoxide dismutase2 (SOD2; 1:1,000; cat. no. ab13533; Abcam), and then reacted with horseradish peroxidase (HRP)-conjugated secondary antibodies (1:5,000; cat. no. 31460; Invitrogen; Thermo Fisher Scientific, Inc.). α-tubulin was used as internal reference. Signals were visualized using an enhanced chemiluminescent HRP substrate (cat. no. WBKLS0050; EMD Millipore) and ImageJ (version 1.50i; National Institutes of Health) was used for densitometry.

ELISA

An ELISA kit (cat. no. KHC0081; Invitrogen; Thermo Fisher Scientific, Inc.) was used to detect levels of interleukin (IL)-8 in the cell culture supernatants, according to the manufacturer's instructions.

Senescence-associated beta-galactosidase (SA-β-Gal) staining

The PDLSCs were treated with TGF-β1 alone or combined with NAC or LY364947 for 48 h. SA-β-gal activity was detected with the SA-β-gal staining kit (cat. no. RG0039; Beyotime Institute of Biotechnology), in accordance with the manufacturer's protocols.

Statistical analysis

Data are shown as mean ± standard deviation. One-way analysis of variance (ANOVA) followed by Tukey's post-hoc test was used for comparisons between >2 groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Isolation and characterization of PDLSCs

PDLSCs were isolated using CD146 microbeads. The majority of PDLSCs exhibited a fibroblastic spindle morphology, and a small round or triangular shape (Fig. 1A and B). The mesenchymal stem cell (MSC) properties of PDLSCs were then characterized, by detecting their expression levels for MSC-specific cell surface antigens by flow cytometry. As presented in Fig. 1C, PDLSCs highly expressed the MSC-specific markers CD44, CD90 and CD105. In addition, the cells were negative for the hematopoietic stem cell marker CD34 and the pan-leukocyte marker CD45.

Figure 1.

Characterization of PDLSCs. (A) PDL cell clusters exhibited radiating or whirlpool-like morphology. The central structure in this image is a fragment of PDL tissue. Scale bar, 200 μm (B) CD146+ PDLSCs were small, round, fusiform and triangular. Scale bar, 100 μm. (C) PDLSCs were positive for the stem cell markers CD44, CD90 and CD105, but negative for CD34 and CD45, as detected by flow cytometry. PDL, periodontal ligament; PDLSCs, PDL stem cells.

TGF-β1 induces PDLSC senescence

β-Galactosidase activity is a specific marker for cellular senescence, and is observed only in senescent cells (23). As shown in Fig. 2, following treatment with TGF-β1, the percentage of positive PDLSCs for SA-β-gal staining was significantly increased. TGF-β1 treatment also significantly increased the mRNA and protein expression levels of p16 and p21 (Fig. 3). To confirm the effect of TGF-β1 on PDLSC senescence, the TGF-β signaling pathway was blocked with a specific TGFβR inhibitor, LY364947. It was identified that the percentage of SA-β-gal positive cells decreased significantly (Fig. 2), and the expression levels of p21 and p16 were also downregulated (Fig. S1), following treatment with LY364947. These results indicated that TGF-β1 treatment induced PDLSC senescence.

Figure 2.

β-galactosidase activity in PDLSCs after TGF-β1 treatment. PDLSCs were treated with 10 ng/ml TGF-β1 alone, or in combination with 10 mM NAC or 2 µM LY364947, for 48 h. Senescence was assayed by SA-β-gal staining. (A) Representative images. Scale bar, 50 μm. (B) The percentage of SA-β-gal-positive cells in PDLSCs in each treatment group. Results are presented as mean ± standard deviation. **P<0.01, with comparisons indicated by lines. Data are representative of three independent experiments. PDLSCs, periodontal ligament stem cells; TGF-β1, transforming growth factor-β1; NAC, N-acetyl-L-cysteine; SA-β-Gal, senescence-associated beta-galactosidase.

Figure 3.

Expression of p16 and p21 in PDLSCs after TGF-β1 treatment. (A) mRNA and (B and C) protein expression levels of p16 and p21 in PDLSCs treated with TGF-β1 (10 ng/ml) alone, or in combination with 10 mM NAC, for 48 h. Results are presented as mean ± standard deviation. **P<0.01, with comparisons indicated by lines. Data are representative of three independent experiments. PDLSCs, periodontal ligament stem cells; TGF-β1, transforming growth factor-β1; NAC, N-acetyl-L-cysteine.

It has been reported that senescent cells release a series of inflammatory cytokines, a process that further reinforces cellular senescence (15). To investigate whether senescent PDLSCs develop a complex SASP, the expression of several key inflammatory mediators was investigated in the present study. Elevated IL-18 and IL-8 mRNA levels (Fig. 4A) and secreted IL-8 protein levels (Fig. 4B) were observed in TGF-β1-induced senescent PDLSCs; by contrast, IL-6 mRNA expression levels were unchanged (Fig. 4A).

Figure 4.

Effects of TGF-β1 on cytokine production. (A) mRNA levels of the indicated genes in PDLSCs treated with TGF-β1 (10 ng/ml) alone, or in combination with 10 mM NAC, for 72 h. (B) The levels of secreted IL-8 in cultured PDLSC supernatants were detected by ELISA. Results are presented as mean ± standard deviation. **P<0.01, with comparisons indicated by lines. Data are representative of three independent experiments. TGF-β1, transforming growth factor-β1; IL, interleukin.

TGF-β1 treatment increases ROS production in PDLSCs

ROS was detected using the MitoSox Red probe, and the results demonstrated that treatment with TGF-β1 for 48 h markedly increased ROS production in PDLSCs (Fig. 5A and B). H2O2was also detected with a PO1 probe. Detection of PO1 further confirmed the TGF-β1-induced ROS production (Fig. 5A and B). Additionally, the protein expression levels of SOD2, which is a mitochondrial matrix enzyme and protects mitochondria against ROS insult (24), were obviously downregulated following TGF-β1 treatment (Fig. 5C), suggesting the involvement of SOD2 expression levels in cellular senescence.

Figure 5.

ROS production in PDLSCs after TGF-β1 treatment. (A) PDLSCs were treated with 10 ng/ml TGF-β1 alone, or in combination with 10 mM NAC, for 48 h. ROS production was assayed by MitoSOX Red or peroxy orange 1 staining and flow cytometry analysis. Representative plots are shown. (B) Quantification of results from panel A. (C) Protein expression levels of SOD2 in TGF-β1-treated PDLSCs. **P<0.01, with comparisons indicated by lines. Data are representative of three independent experiments. ROS, reactive oxygen species; PDLSCs, periodontal ligament stem cells; TGF-β1, transforming growth factor-β1; SOD2, superoxide dismutase2; MFI, mean fluorescence intensity.

Senescence of PDLSCs is rescued by NAC

To evaluate the role of ROS in TGF-β1-induced PDLSC senescence, the physiological mitochondrial ROS scavenger NAC was used in the senescence assay. The results demonstrated that NAC effectively impaired TGF-β1-induced ROS production in PDLSCs (Fig. 5A and B). NAC treatment significantly suppressed TGF-β1-induced SA-β-Gal activity (Fig. 2), p16 and p21 expression (Fig. 3), as well as IL-8 and IL-18 production (Fig. 4). These results indicated that ROS were an important mediator of the TGF-β1-induced PDLSC senescence.

Discussion

PDLSCs which are positive for CD146 or STRO-1 have greater osteogenic potential and colony-forming ability than CD146 or STRO-1-negative PDLSCs (25,26). The present study investigated the effect of TGF-β1 on CD146+ PDLSC senescence. PDLSCs also possess characteristics of MSCs, such as cell surface MSC-specific marker expression (CD44+, CD73+, CD90+, CD105+, CD45−, CD31− and CD34−) (27,28). In accordance with that, the present study characterized the isolated PDLSCs by flow cytometry, and found that the isolated PDLSCs successfully expressed the MSC-specific markers CD44, CD90 and CD105, and were negative for CD34 and the pan-leukocyte marker CD45. The data from the present study demonstrated that TGF-β1 increased SA-β-Gal activity and ROS production in PDLSCs. The expression levels of the aging-related p16 and p21 proteins were also significantly increased following TGF-β1 treatment. In addition, expression of the mitochondrial matrix enzyme SOD2 was decreased in TGF-β1-treated PDLSCs. Addition of the ROS scavenger NAC repressed the ROS production and PDLSC senescence induced by TGF-β1. The data from the present study thus demonstrated that TGF-β1 induced PDLSC senescence through the increase of ROS production.

Periodontal disease (PD) is characterized by inflammation and tissue destruction in the periodontal apparatus. PDLSCs are critical to the PDL tissue reconstruction process and are known to differentiate into osteoblastic or cementoblastic cells to form calcified tissue (29,30). Previous studies have indicated that TGF-β1 could cause tumor cell senescence (19,20). The present study demonstrated that TGF-β1 significantly increased SA-β-Gal activity in PDLSCs, suggesting that PDLSCs were undergoing senescence. Cellular senescence can result in phenotype changes and low proliferation of PDLSCs (12–14), which may further attenuate the efficiency of PDLSC-based transplantation. PDLSC expression of aging regulators p16 and p21 was also upregulated significantly following TGF-β1 treatment.

Senescent cells usually produce a series of cytokines, chemokines, and other soluble factors, a phenotype called SASP, which is believed to reinforce senescence (13,15). In the present study, elevated IL-8 and IL-18 expression was detected following TGF-β1 treatment, suggesting that TGF-β1 was capable of instigating inflammation in PDLSCs. IL-8 can cause extensive infiltration of neutrophils, which serve an essential role in the inflammatory process (31). Additionally, the levels of IL-8 in periapical lesions has been reported to correlate with pain in patients with apical periodontitis (32). In a recent study, IL-18 was demonstrated to promote matrix metallopeptidase secretion by activating the NF-κB signaling pathway in human periodontal ligament fibroblasts, indicating that IL-18 is involved in chronic periodontitis development (33).

The findings of the present study reveal a new role for TGF-β1 signaling in PDLSC senescence and SASP production. It should also be noted that TGF-β1 serves important roles in cell growth, differentiation and transformation (34). In addition, the complete deletion of TGF-β1 is developmentally lethal (34). Concerning the periodontal regeneration, TGF-β1 signaling deficiency affects cementoblast differentiation and periodontal wound-healing, indicating that a normal level of TGF-β1 is biologically required and thereby protective of the periodontium (35,36). Therefore, appropriate TGF-β1 suppression can present a therapeutic basis for treating periodontitis. Cellular senescence was initially considered a fail-safe mechanism for tumor suppression (37). However, several studies have shown that senescent cells promote the growth of premalignant or malignant cells, at least partly via SASP (38,39). A specific SASP component, IL-6 also serves an established role in liver regeneration and repair (40). In addition, during periodontal regeneration and wound repair, a phase of inflammation and granulation is indispensable (41), thus making TGF-β1-induced SASP a likely contributor to the process of regeneration.

Our previous study found that TGF-β1 treatment enhanced ROS production in corneal endothelium cells and further induced cellular senescence (42), which raised the hypothesis that ROS could be involved in PDLSC senescence. The results of the present study demonstrated that ROS production was significantly upregulated in TGF-β1-treated PDLSCs. The results also demonstrated that the expression levels of SOD2, which can protect mitochondria against ROS insult (24), were significantly decreased in PDLSCs following TGF-β1 treatment. To further examine the role of ROS in TGF-β1 induced PDLSC senescence, PDLSCs were treated with the ROS scavenger NAC in combination with TGF-β1. The results revealed that NAC significantly inhibited the TGF-β1 induced ROS production and SA-β-Gal activity, suggesting that TGF-β1-induced PDLSCs senescence depended on ROS production.

In conclusion, the present study demonstrated that TGF-β1, a potent stimulator for tissue regeneration, promoted PDLSC senescence and this effect was dependent on ROS induction.

Supplementary Material

Supporting Data

Acknowledgements

Not applicable.

Funding

This work was supported by the National Natural Science Foundation of China (grant no. 81701381).

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

CF, HS and ZL designed the study and analyzed the data. CF, QJ, and CZ performed cell culture, SA-β-Gal staining, RT-qPCR and western blotting. CF and SX performed the flow cytometry analysis. CF, HS and ZL wrote the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Review Board of the Affiliated Hospital of Qingdao University. Written informed consent was obtained from patients prior to procedure.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Liu Y, Zheng Y, Ding G, Fang D, Zhang C, Bartold PM, Gronthos S, Shi S and Wang S: Periodontal ligament stem cell-mediated treatment for periodontitis in miniature swine. Stem Cells. 26:1065–1073. 2008. View Article : Google Scholar : PubMed/NCBI

2 

Huang GT, Gronthos S and Shi S: Mesenchymal stem cells derived from dental tissues vs. those from other sources: Their biology and role in regenerative medicine. J Dent Res. 88:792–806. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Lekic P and McCulloch CA: Periodontal ligament cell population: The central role of fibroblasts in creating a unique tissue. Anat Rec. 245:327–341. 1996. View Article : Google Scholar : PubMed/NCBI

4 

Kao RT, Murakami S and Beirne OR: The use of biologic mediators and tissue engineering in dentistry. Periodontol 2000. 50:127–153. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Li X, Yang H, Zhang Z, Yan Z, Lv H, Zhang Y and Wu B: Concentrated growth factor exudate enhances the proliferation of human periodontal ligament cells in the presence of TNF-α. Mol Med Rep. 19:943–950. 2019.PubMed/NCBI

6 

Hyun SY, Lee JH, Kang KJ and Jang YJ: Effect of FGF-2, TGF-β-1, and BMPs on Teno/Ligamentogenesis and Osteo/Cementogenesis of human periodontal ligament stem cells. Mol Cells. 40:550–557. 2017. View Article : Google Scholar : PubMed/NCBI

7 

Shi Y and Massague J: Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell. 113:685–700. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Wikesjo UM, Razi SS, Sigurdsson TJ, Tatakis DN, Lee MB, Ongpipattanakul B, Nguyen T and Hardwick R: Periodontal repair in dogs: Effect of recombinant human transforming growth factor-beta1 on guided tissue regeneration. J Clin Periodontol. 25:475–481. 1998. View Article : Google Scholar : PubMed/NCBI

9 

Kawahara T, Yamashita M, Ikegami K, Nakamura T, Yanagita M, Yamada S, Kitamura M and Murakami S: TGF-beta negatively regulates the BMP2-dependent early commitment of periodontal ligament cells into hard tissue forming cells. PLoS One. 10:e01255902015. View Article : Google Scholar : PubMed/NCBI

10 

De Gorter DJ, van Dinther M, Korchynskyi O and ten Dijke P: Biphasic effects of transforming growth factor β on bone morphogenetic protein-induced osteoblast differentiation. J Bone Miner Res. 26:1178–1187. 2011. View Article : Google Scholar : PubMed/NCBI

11 

Lorda-Diez CI, Montero JA, Martinez-Cue C, Garcia-Porrero JA and Hurle JM: Transforming growth factors beta coordinate cartilage and tendon differentiation in the developing limb mesenchyme. J Biol Chem. 284:29988–29996. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Baker DJ, Wijshake T, Tchkonia T, LeBrasseur NK, Childs BG, van de Sluis B, Kirkland JL and van Deursen JM: Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature. 479:232–236. 2011. View Article : Google Scholar : PubMed/NCBI

13 

Lopez-Otin C, Blasco MA, Partridge L, Serrano M and Kroemer G: The hallmarks of aging. Cell. 153:1194–1217. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Burova E, Borodkina A, Shatrova A and Nikolsky N: Sublethal oxidative stress induces the premature senescence of human mesenchymal stem cells derived from endometrium. Oxid Med Cell Longev. 2013:4749312013. View Article : Google Scholar : PubMed/NCBI

15 

Acosta JC, Banito A, Wuestefeld T, Georgilis A, Janich P, Morton JP, Athineos D, Kang TW, Lasitschka F, Andrulis M, et al: A complex secretory program orchestrated by the inflammasome controls paracrine senescence. Nat Cell Biol. 15:978–990. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Burton DG and Faragher RG: Cellular senescence: From growth arrest to immunogenic conversion. Age. 37:272015. View Article : Google Scholar : PubMed/NCBI

17 

Xu M, Tchkonia T, Ding H, Ogrodnik M, Lubbers ER, Pirtskhalava T, White TA, Johnson KO, Stout MB, Mezera V, et al: JAK inhibition alleviates the cellular senescence-associated secretory phenotype and frailty in old age. Proc Natl Acad Sci USA. 112:6301–6310. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Zou J, Lei T, Guo P, Yu J, Xu Q, Luo Y, Ke R and Huang D: Mechanisms shaping the role of ERK1/2 in cellular senescence (Review). Mol Med Rep. 19:759–770. 2019.PubMed/NCBI

19 

Senturk S, Mumcuoglu M, Gursoy-Yuzugullu O, Cingoz B, Akcali KC and Ozturk M: Transforming growth factor-beta induces senescence in hepatocellular carcinoma cells and inhibits tumor growth. Hepatology. 52:966–974. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Hubackova S, Krejcikova K, Bartek J and Hodny Z: IL1- and TGFβ-Nox4 signaling, oxidative stress and DNA damage response are shared features of replicative, oncogene-induced, and drug-induced paracrine ‘bystander senescence’. Aging. 4:932–951. 2012. View Article : Google Scholar : PubMed/NCBI

21 

Li ZY, Chen ZL, Zhang T, Wei C and Shi WY: TGF-β and NF-κB signaling pathway crosstalk potentiates corneal epithelial senescence through an RNA stress response. Aging (Albany NY). 8:2337–2354. 2016. View Article : Google Scholar : PubMed/NCBI

22 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

23 

Debacq-Chainiaux F, Erusalimsky JD, Campisi J and Toussaint O: Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat Protoc. 4:1798–1806. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Velarde MC, Flynn JM, Day NU, Melov S and Campisi J: Mitochondrial oxidative stress caused by Sod2 deficiency promotes cellular senescence and aging phenotypes in the skin. Aging (Albany NY). 4:3–12. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Seo BM, Miura M, Gronthos S, Bartold PM, Batouli S, Brahim J, Young M, Robey PG, Wang CY and Shi S: Investigation of multipotent postnatal stem cells from human periodontal ligament. Lancet. 364:149–155. 2004. View Article : Google Scholar : PubMed/NCBI

26 

Wang P, Wang Y, Tang W, Wang X, Pang Y, Yang S, Wei Y, Gao H, Wang D and Cao Z: Bone morphogenetic protein-9 enhances osteogenic differentiation of human periodontal ligament stem cells via the JNK pathway. PLoS One. 12:e01691232017. View Article : Google Scholar : PubMed/NCBI

27 

Wada N, Menicanin D, Shi S, Bartold PM and Gronthos S: Immunomodulatory properties of human periodontal ligament stem cells. J Cell Physiol. 219:667–676. 2009. View Article : Google Scholar : PubMed/NCBI

28 

Gronthos S, Mrozik K, Shi S and Bartold PM: Ovine periodontal ligament stem cells: Isolation, characterization, and differentiation potential. Calcif Tissue Int. 79:310–317. 2006. View Article : Google Scholar : PubMed/NCBI

29 

Nagata M, Iwasaki K, Akazawa K, Komaki M, Yokoyama N, Izumi Y and Morita I: Conditioned medium from periodontal ligament stem cells enhances periodontal regeneration. Tissue Eng Part A. 23:367–377. 2017. View Article : Google Scholar : PubMed/NCBI

30 

Iwasaki K, Komaki M, Yokoyama N, Tanaka Y, Taki A, Honda I, Kimura Y, Takeda M, Akazawa K, Oda S, et al: Periodontal regeneration using periodontal ligament stem cell-transferred amnion. Tissue Eng Part A. 20:693–704. 2014.PubMed/NCBI

31 

Nair PN: Pathogenesis of apical periodontitis and the causes of endodontic failures. Crit Rev Oral Biol Med. 15:348–381. 2004. View Article : Google Scholar : PubMed/NCBI

32 

Kim AR, Ahn KB, Kim HY, Seo HS, Kum KY, Yun CH and Han SH: Streptococcus gordonii lipoproteins induce IL-8 in human periodontal ligament cells. Mol Immunol. 91:218–224. 2017. View Article : Google Scholar : PubMed/NCBI

33 

Wang F, Guan M, Wei L and Yan H: IL18 promotes the secretion of matrix metalloproteinases in human periodontal ligament fibroblasts by activating NF-κB signaling. Mol Med Rep. 19:703–711. 2019.PubMed/NCBI

34 

Bottinger EP, Letterio JJ and Roberts AB: Biology of TGF-beta in knockout and transgenic mouse models. Kidney Int. 51:1355–1360. 1997. View Article : Google Scholar : PubMed/NCBI

35 

Nokhbehsaim M, Winter J, Rath B, Jäger A, Jepsen S and Deschner J: Effects of enamel matrix derivative on periodontal wound healing in an inflammatory environment in vitro. J Clin Periodontol. 38:479–490. 2011. View Article : Google Scholar : PubMed/NCBI

36 

Bosshardt DD, Stadlinger B and Terheyden H: Cell-to-cell communication-periodontal regeneration. Clin Oral Implants Res. 26:229–239. 2015. View Article : Google Scholar : PubMed/NCBI

37 

Rodier F and Campisi J: Four faces of cellular senescence. J Cell Biol. 192:547–556. 2011. View Article : Google Scholar : PubMed/NCBI

38 

Coppé JP, Desprez PY, Krtolica A and Campisi J: The senescence-associated secretory phenotype: The dark side of tumor suppression. Annu Rev Pathol. 5:99–118. 2010. View Article : Google Scholar : PubMed/NCBI

39 

Coppé JP, Patil CK, Rodier F, Sun Y, Muñoz DP, Goldstein J, Nelson PS, Desprez PY and Campisi J: Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6:2853–2868. 2008. View Article : Google Scholar : PubMed/NCBI

40 

Serra MP, Marongiu F, Sini M and Laconi E: Hepatocyte senescence in vivo following preconditioning for liver repopulation. Hepatology. 56:760–768. 2012. View Article : Google Scholar : PubMed/NCBI

41 

Sculean A, Chapple IL and Giannobile WV: Wound models for periodontal and bone regeneration: The role of biologic research. Periodontol 2000. 68:7–20. 2015. View Article : Google Scholar : PubMed/NCBI

42 

Li ZY, Liu T, Ma JW, Guo Q, Ma L, Lv QL, Jiang Y, Wei C and Zhang JS: TGF-β induces corneal endothelial senescence via increase of mitochondrial reactive oxygen species in chronic corneal allograft failure. Aging (Albany NY). 10:3474–3485. 2018. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Fan C, Ji Q, Zhang C, Xu S, Sun H and Li Z: TGF‑β induces periodontal ligament stem cell senescence through increase of ROS production. Mol Med Rep 20: 3123-3130, 2019.
APA
Fan, C., Ji, Q., Zhang, C., Xu, S., Sun, H., & Li, Z. (2019). TGF‑β induces periodontal ligament stem cell senescence through increase of ROS production. Molecular Medicine Reports, 20, 3123-3130. https://doi.org/10.3892/mmr.2019.10580
MLA
Fan, C., Ji, Q., Zhang, C., Xu, S., Sun, H., Li, Z."TGF‑β induces periodontal ligament stem cell senescence through increase of ROS production". Molecular Medicine Reports 20.4 (2019): 3123-3130.
Chicago
Fan, C., Ji, Q., Zhang, C., Xu, S., Sun, H., Li, Z."TGF‑β induces periodontal ligament stem cell senescence through increase of ROS production". Molecular Medicine Reports 20, no. 4 (2019): 3123-3130. https://doi.org/10.3892/mmr.2019.10580
Copy and paste a formatted citation
x
Spandidos Publications style
Fan C, Ji Q, Zhang C, Xu S, Sun H and Li Z: TGF‑β induces periodontal ligament stem cell senescence through increase of ROS production. Mol Med Rep 20: 3123-3130, 2019.
APA
Fan, C., Ji, Q., Zhang, C., Xu, S., Sun, H., & Li, Z. (2019). TGF‑β induces periodontal ligament stem cell senescence through increase of ROS production. Molecular Medicine Reports, 20, 3123-3130. https://doi.org/10.3892/mmr.2019.10580
MLA
Fan, C., Ji, Q., Zhang, C., Xu, S., Sun, H., Li, Z."TGF‑β induces periodontal ligament stem cell senescence through increase of ROS production". Molecular Medicine Reports 20.4 (2019): 3123-3130.
Chicago
Fan, C., Ji, Q., Zhang, C., Xu, S., Sun, H., Li, Z."TGF‑β induces periodontal ligament stem cell senescence through increase of ROS production". Molecular Medicine Reports 20, no. 4 (2019): 3123-3130. https://doi.org/10.3892/mmr.2019.10580
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team