Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
May-2019 Volume 19 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2019 Volume 19 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

The role of ethanol in the pathogenesis of non‑bacterial prostatitis

  • Authors:
    • Feng Liu
    • Lintao Liu
    • Zhong Wang
    • Lin Chen
    • Jianjun Yu
    • Xiaolin Xu
  • View Affiliations / Copyright

    Affiliations: Department of Urology, Shanghai Fengxian District Central Hospital, Shanghai 201499, P.R. China
  • Pages: 3848-3854
    |
    Published online on: February 27, 2019
       https://doi.org/10.3892/mmr.2019.9991
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Chronic prostatitis (CP) is a common disease within the field of urology, and it is difficult to treat. Prostatitis mainly occurs in young men and presents with various clinical symptoms, manifested as urinary frequency, urinary urgency, urinary pain, prolonged urination, dysuria and other urinary abnormalities. There are various forms of the syndrome that can cause discomfort or pain in the perineum, the lower abdomen, the penis, the scrotum and the lumbosacral area. To investigate CP in more detail, animal models are necessary to determine the etiology of prostatitis and develop new, specific drug therapies. In the present study, Sprague Dawley rats that were induced to develop a model of chronic and non‑bacterial prostatitis drank ethanol or water to determine the effects of ethanol on prostatitis. Total antioxidant capacity, the concentration of inflammatory factors, such as tumor necrosis factor‑α and interleukin‑1β, and the expression changes of α1‑adrenoreceptor were measured. The susceptibility of ethanol‑drinking rats to CP was confirmed and some simple mechanism of this susceptibility was investigated to further guide the diagnosis and treatment of patients with prostatitis.

Introduction

With the rapid development of social economies, standards are increasing and drinking alcohol has become a common social activity (1). In this a social environment, drinking behavior is continuously increasing, and if an individual drinker suffers from a psychopathological condition, drinking can easily develop into alcohol abuse and dependence. Alcohol consumption has resulted in a series of far-reaching social and medical issues (2). Diseases caused by alcohol abuse are attracting increasing attention from the medical community (3,4). Alcohol-associated diseases are often reported, and alcoholism is associated serious systemic system damage and causes social dysfunction and mental health disorders, resulting in a series of social and medical problems (5,6).

Chronic prostatitis (CP) is a common urological disease in men. Patients typically present with pain in the lower abdomen, perineum, scrotum, penis, lumbosacral area and other areas of discomfort (7). Numerous patients also experience different degrees of sexual dysfunction, neuropsychiatric symptoms, fatigue and insomnia. Although CP does not cause a significant threat to life, it can seriously affect the quality of life of patients, particularly for patients with mental health issues (8,9). However, the pathogenesis and pathophysiological changes that cause CP remain unclear (10,11). Currently, there are no effective drugs or methods to treat the disease, and it is imperative to identify safe and cost-effective treatments. A previous study reported that CP may be caused by changes in hormone secretion levels and immunological dysfunction (12).

Drinking is a habit closely associated with male patients. Moderate drinking is able to promote blood circulation to improve the function of the human body but a high degree of drinking can affect human health. Alcohol can also increase the severity of prostate congestion. In addition to the direct effects of alcohol on the nervous system, the prostate is also very sensitive to alcohol, and it is prone to prostate disease (13). Currently, there is limited research on the effect of alcohol on prostatitis.

In the present study, it was attempted to investigate the association of ethanol consumption and CP, where rats with CP were treated with or without ethanol, to explore the mechanism and role of alcohol CP (14). A chronic non-bacterial prostatitis model was successfully established in rats. In conclusion, ethanol increased the inflammatory responses in the prostate of rats with non-bacterial prostatitis.

Materials and methods

Animals

Healthy male Sprague Dawley (SD) rats (n=24; age, 6–7 weeks; weight, 180–200 g), were purchased from the Animal Experimental Center of Shanghai Jiaotong University (Shanghai, China). Animal room temperature control was at 25°C, humidity control was at 60%, and 12-h light cycle was used to simulate the normal circadian physiology. Drinking water and standard food were available to animals following sterilization. The establishment of non-bacterial prostatitis model was performed as reported in a previous study (15). The rats were injected intraperitoneally with 3 mg/ml complete Freund's adjuvant, 1mg purified prostaglandin and 0.1 ml DPT vaccine to induce non-bacterial prostatitis in rats (16,17). The Bioethics Committee of Shanghai Jiaotong University approved all animal experiments, which were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (https://grants.nih.gov/grants/olaw/guide-for-the-care-and-use-of-laboratory-animals.pdf), the Ethical Certificate number was SYXK (Shanghai) 2011–0128. Rats were divided into four groups (6 rats/group): A (normal SD rats), B (ethanol-drinking rats), C (chronic non-bacterial prostatitis rats) and D (ethanol-drinking chronic non-bacterial prostatitis rats).

Blood tests

Blood was collected from heart by cardiocentesis. The white blood cells (WBC), and concentrations of IgG, serum testosterone (serum T) and dihydrotestosterone (DHT) were analyzed by Animal blood routine detector (Acon, Shanghai, China).

Preparation of rat prostate protein purification solution

A total of 10 SD rats were sacrificed, the body weight of each rat having been recorded. Following disinfection and dissection, the prostate was exposed, removed and put into iced saline. The weight of the prostate was recorded. The prostate index was the weight of prostate/body weight. The tissue was cleansed and diced, followed by homogenization. Samples were centrifuged for 30 min (20,000 × g) at 4°C. A suction tube was used to remove the upper adipose tissue, and then 3 ml supernatant was placed in cryopreservation storage. Bicinchoninic protein assay was used for protein concentration quantification (Beyotime Institute of Biotechnology, Haimen, China) and the protein was diluted to a concentration of 50 mg/ml (18).

Hematoxylin and eosin (H&E) staining

After the rats were sacrificed, a sample of prostate was fixed in 4% formalin for 24 h then placed in 70–100% graded ethanol series the subsequent day. The prostate was embedded in paraffin followed by dehydration and was sectioned at 4 µm of thickness. The prostate sections were deparaffinized and rehydrated (100–70%), then stained with hematoxylin (15 min) and eosin (2 min) at room temperature, and observed under an inverted microscope (Nikon TS-100-F; Nikon Corporation, Tokyo, Japan) (19).

Measurement of inflammatory factors

The prostate tissue of each group was immersed in a physiological saline solution containing 0.5% Triton X-100 and homogenized in a glass homogenizer on an ice-water bath. The prostate tissue was equilibrated into 10% prostate tissue homogenate and centrifuged at 300 × g for 15 min at 4°C. The supernatant was collected according to the ELISA kit instructions to measure tumor necrosis factor (TNF)-α (catalog number ab46070; Abcam, Cambridge, UK), inducible nitric oxide synthase (iNOS) (catalog number: MBS263618; MyBioSource, Inc., San Diego, CA, USA) and total antioxidant capacity (T-AOC) kit (catalog number STA-360; Cell Biolabs, Inc., San Diego, CA, USA).

Evaluation of prostatic inflammation

Inflammatory scores (20) were given to the prostatic tissue of rats in each group. The standard of evaluation was the ratio of the area of the lesion to the total area (5 visual fields were randomly selected from each slice). No lesion present was denoted as 0, 25% was denoted as 1 point, 50% was denoted as 2 points, 75% was denoted as 3 points and 100% was denoted as 4 points (21).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

RT-qPCR was performed as previously described (9), followed by the use of SYBR Premix Ex Taq II kit (catalog number RR82LR; Takara Bio, Inc., Otsu, Japan). mRNA was extracted from the prostate tissue of rats using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). PCR was performed with the following thermocycling conditions: 5 min at 95°C, followed by 40 cycles of 95°C for 30 sec, 55°C for 30 sec and 72°C for 30 sec, with a final holding step at 4C. The thermocycler used in the present study was the StepOnePlus™ Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The primers were obtained from Funengbio Co. (Shanghai, China). Primers sequences were as follows: α1a-adrenoreceptor (AR), forward, TAGCCTFTCACCGACACCTG and reverse, GGAGGTCGGCCACCG; α1b-AR, forward, CTCAACCCCATCATCTACCCA and reverse, CTCAACCCCATCATCTACCCA; α1d-AR, forward, AGCGCTTCTGCGGTATCA and reverse, CAGGTAGAAGGAGCACACGG; GAPDH, forward, TCTAGACGGCAGGTCAGGTCCAC and reverse, CCACCCATGGCAAATTCCATGGCA. RT-qPCR was performed using an Applied Biosystems 7500 real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The results were analyzed using Light Cycler Software version 3.5 (Idaho Technology Inc., Salt Lake City, UT, USA). The 2−ΔΔCq method was performed to calculate the relative expression (22).

Statistical analysis

The data are presented as the mean ± standard deviation and analyzed using GraphPad prim 6.0 (GraphPad Software, Inc., La Jolla, CA, USA). The statistical significance was determined by one-way analysis of variance followed by the least significant difference post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Body weight in each group of SD rats

As shown in Fig. 1, there were no significant differences in body weight among the groups.

Figure 1.

Body weight of group A (normal rats), group B (ethanol-drinking rats), group C (chronic non-bacterial prostatitis rats) and group D (ethanol-drinking chronic non-bacterial prostatitis rats) at different time-points. No significant differences were observed among groups at each time-point.

Blood tests were performed on all rats

Compared with the normal control group A, there was no significant difference in the blood parameters of group B (P>0.05; Fig. 2).

Figure 2.

Blood parameters in group A (normal rats), group B (ethanol-drinking rats), group C (chronic non-bacterial prostatitis rats) and group D (ethanol-drinking chronic non-bacterial prostatitis rats). *P<0.05. WBC, white blood cells; IgG, immunoglobulin G; serum T, serum testosterone; DHT, dihydrotestosterone.

There were significant differences in blood parameters between groups C, D and A, B. The total count of white blood cells (WBC), and concentrations of IgG, serum testosterone (serum T) in group C and Group D were higher compared with Group A and Group B (P<0.05). No difference in the expression of DHT, important for development and maintenance of the prostate gland and seminal vesicles, was observed among the 4 groups.

Prostate morphology in each group of rats

There was no difference in the morphology of the prostate between groups A and B. The surface of the organ was smooth, the capsules were intact without edema, there were no glandular congestions and prostatic fluids were clear (Fig. 3A and B). In groups C and D, prostates exhibited edema and adhesions, had enlarged volume and local congestion of glands. The congestion and volume of the prostate in group D was higher than in group C (Fig. 3C and D).

Figure 3.

Morphology of the prostate gland. Differences in the morphology of (A) normal rats, (B) ethanol-drinking rats, (C) chronic non-bacterial prostatitis rats and (D) ethanol-drinking chronic non-bacterial prostatitis rats.

Pathological examination of the prostate

H&E staining indicated that the cells in groups A and B sections were neatly arranged, with no obvious infiltration of inflammatory cells. The epithelial cells were arranged in rows as either cubic or columnar epithelium (Fig. 4A and B). In group C, there was hyperplasia of the prostate epithelium, infiltration of interstitial inflammatory cells, and a certain degree of interstitial edema and enlargement. Group D exhibited infiltration of inflammatory cells, while the expansion of the prostate capsule and interstitial blood vessels was marked and accompanied by glandular injury (Fig. 4C and D).

Figure 4.

Morphology of the prostate gland evaluated by hematoxylin and eosin staining. Histological observation of prostate in (A) normal rats, (B) ethanol-drinking rats, (C) chronic non-bacterial prostatitis rats and (D) ethanol-drinking chronic non-bacterial prostatitis rats. Magnification, ×10.

Wet weight and index of the prostate

There were no significant differences in prostate wet weight and prostate index among the groups (Fig. 5).

Figure 5.

Prostate wet weight and index in group A (normal rats), group B (ethanol-drinking rats), group C (chronic non-bacterial prostatitis rats) and group D (ethanol-drinking chronic non-bacterial prostatitis rats). No significant differences were observed among groups.

Evaluation of prostatic inflammation

Inflammatory scores (20) were given to the prostatic tissue of rats in each group (Fig. 6). The results demonstrated that there was no significant difference in inflammation between groups A and B. The inflammation scores of groups C and D were significantly higher than those of group A, and the inflammation scores of group D were significantly higher than that of group C.

Figure 6.

Evaluation of prostatic inflammation in rats of group A (normal rats), group B (ethanol-drinking rats), group C (chronic non-bacterial prostatitis rats) and group D (ethanol-drinking chronic non-bacterial prostatitis rats). ***P<0.001, #P<0.05.

Expression of inflammatory factors in prostate

The expression of TNF-α and iNOS in groups C and D were significantly higher than those in groups A and B. The T-AOC levels in groups C and D was significantly lower than that in group A, while the expression of T-AOC in group D was significantly lower than that in group C (P<0.05; Fig. 7), which indicated that the total antioxidant capacity of group C was higher compared with group D.

Figure 7.

Expression levels of proinflammatory cytokines in the prostate of group A (normal rats), group B (ethanol-drinking rats), group C (chronic non-bacterial prostatitis rats) and group D (ethanol-drinking chronic non-bacterial prostatitis rats). ***P<0.001, #P<0.05. TNF-α, tumor necrosis factor-α; iNOS, inducible nitric oxide synthase; T-AOC, total antioxidant capacity.

mRNA expression levels of α1a-AR, α1b-AR and α1d-AR in the prostate

The mRNA expression levels of α1a-AR, α1b-AR, and α1d-AR in the prostate of each group were detected by RT-qPCR (Fig. 8). The results demonstrated that there was no significant difference in mRNA expression of α1a-AR, α1b-AR, and α1d-AR between groups A and B. While the expression of α1a-AR, α1b-AR, and α1d-AR in group C and group D were higher compared with group A and group B. Among the expression of α1a-AR, α1b-AR, and α1d-AR, the fold change of α1a-AR was most significant, which indicated that the expression of α1a-AR may be the most important subtype among the 3 genes for inflammation.

Figure 8.

mRNA expression levels of α1a-AR, α1b-AR and α1d-AR in the prostate of group A (normal rats), group B (ethanol-drinking rats), group C (chronic non-bacterial prostatitis rats) and group D (ethanol-drinking chronic non-bacterial prostatitis rats). *P<0.05, **P<0.01, #P<0.05. AR, adrenoreceptor.

Discussion

In the present study, SD rats were injected intraperitoneally with purified prostaglandin with double immunoadjuvant to induce non-bacterial prostatitis in rats (16,17). This rat model is a good model for analyzing the effects of ethanol (23,24). The weight of the rats did not significantly differ among the groups, indicating that the body weight of the rats was stable during the experiment. However, internal changes were observed. The number of WBC, the concentration of serum T and the concentration of IgG in groups C and D were increased compared with the control (group A).

Additionally, when the prostates of ethanol-exposed rats with prostatitis were removed, the prostates were damaged, and enlarged with local congestion of glands and edema. H&E staining revealed that blood vessels were outstretched and glands were damaged in group D. These results indicated that there was inflammation in rats treated with ethanol. Significant glandular changes, severe inflammatory infiltration and hyperplasia of fibrous tissue was observed in the prostates of group D. The expression of TNF-α, iNOS in group D rats were the highest, while the expression of T-AOC was much lower in group D group compared with group A. To further analyze inflammation levels, the mRNA expression levels of α1a-AR, α1b-AR, and α1d-AR were investigated via RT-qPCR (25,26). α1a-AR expression was highest in groups D, which indicated that α1a-AR may be the most important mRNA subtype in these rats.

In the present study, the association between ethanol and non-bacterial prostatitis in rats was explored. The findings indicated that ethanol may accelerate the inflammatory response in arts with prostatitis, which may provide some useful information for clinical research.

However, this study has limitations. For example, the detailed signaling pathways involved remain unclear, and potential target molecules that could be exploited to prevent non-bacterial prostatitis also need to be identified. Future studies should investigate the underlying mechanism and target molecules involved in non-bacterial prostatitis.

Acknowledgements

Not applicable.

Funding

The present study was supported by Youth Fund of Shanghai Municipal Commission of Health and Family Planning (grant no. 2011-Y132). Clinical research and cultivation fund of Renji Hospital (grant no. PYXJS16-009).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

JY designed this study. FL and XX performed all of the experiments. LL helped to collect the data. ZW produced the figures. LC helped with the analysis and interpretation of data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The Bioethics Committee of Shanghai Jiaotong University approved all animal experiments.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Rehm J, Samokhvalov AV and Shield KD: Global burden of alcoholic liver diseases. J Hepatol. 59:160–168. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Lee JH, Friso S and Choi SW: Epigenetic mechanisms underlying the link between non-alcoholic fatty liver diseases and nutrition. Nutrients. 6:3303–3325. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Liu YJ, Song GH and Liu GT: Investigation of the effect of traditional Chinese medicine on pain and inflammation in chronic nonbacterial prostatitis in rats. Andrologia. 48:714–722. 2016. View Article : Google Scholar : PubMed/NCBI

4 

Zhao HF, Li X and Jiang XZ: Heat shock protein 9-mediated inflammation reaction in patients with chronic prostatitis with erectile dysfunction. Eur Rev Med Pharmacol Sci. 20:4185–4189. 2016.PubMed/NCBI

5 

Testino G: Alcoholic diseases in hepato-gastroenterology: A point of view. Hepatogastroenterology. 55:371–377. 2008.PubMed/NCBI

6 

Zhang DF, Zhang F, Zhang J, Zhang RM and Li R: Protection effect of trigonelline on liver of rats with non-alcoholic fatty liver diseases. Asian Pac J Trop Med. 8:651–654. 2015. View Article : Google Scholar : PubMed/NCBI

7 

Anderson RU, Wise D, Sawyer T, Glowe P and Orenberg EK: 6-day intensive treatment protocol for refractory chronic prostatitis/chronic pelvic pain syndrome using myofascial release and paradoxical relaxation training. J Urol. 185:1294–1299. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Sahin S, Bicer M, Eren GA, Tas S, Tugcu V, Tasci AI and Cek M: Acupuncture relieves symptoms in chronic prostatitis/chronic pelvic pain syndrome: A randomized, sham-controlled trial. Prostate Cancer Prostatic Dis. 18:249–254. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Zibara K, Awada Z, Dib L, El-Saghir J, Al-Ghadban S, Ibrik A, El-Zein N and El-Sabban M: Anti-angiogenesis therapy and gap junction inhibition reduce MDA-MB-231 breast cancer cell invasion and metastasis in vitro and in vivo. Sci Rep. 5:125982015. View Article : Google Scholar : PubMed/NCBI

10 

Iwamura H, Koie T, Soma O, Matsumoto T, Imai A, Hatakeyama S, Yoneyama T, Hashimoto Y and Ohyama C: Eviprostat has an identical effect compared to pollen extract (Cernilton) in patients with chronic prostatitis/chronic pelvic pain syndrome: A randomized, prospective study. BMC Urol. 15:1202015. View Article : Google Scholar : PubMed/NCBI

11 

Jin JX, Wang HZ, Zhai ZX, Ma BL, Li QF, Xiao N, Wang ZP and Rodriguez R: Transrectal microwave thermotherapy causing a short-time influence on sperm quality in Chinese chronic nonbacterial prostatitis patients. Asian J Androl. 19:548–553. 2016.

12 

Krsmanovic A, Tripp DA, Nickel JC, Shoskes DA, Pontari M, Litwin MS and McNaughton-Collins MF: Psychosocial mechanisms of the pain and quality of life relationship for chronic prostatitis/chronic pelvic pain syndrome (CP/CPPS). Can Urol Assoc J. 8:403–408. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Zijoo R, Dirweesh A, Ordonez FM and Kaji A: Spontaneous Rupture of Urinary Bladder in a Young Alcoholic Male. J Med Cases. 7:245–247. 2016. View Article : Google Scholar

14 

Yatkin E, Bernoulli J, Lammintausta R and Santti R: Fispemifene (Z-2-{2-(4-(4-chloro-1,2-diphenylbut-1-enyl)-phenoxy)ethoxy}-ethanol), a novel selective estrogen receptor modulator, attenuates glandular inflammation in an animal model of chronic nonbacterial prostatitis. J Pharmacol Exp Ther. 327:58–67. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Keetch DW, Humphrey P and Ratliff TL: Development of a mouse model for nonbacterial prostatitis. J Urol. 152:247–250. 1994. View Article : Google Scholar : PubMed/NCBI

16 

Cui D, Han G, Shang Y, Mu L, Long Q and Du Y: The effect of chronic prostatitis on zinc concentration of prostatic fluid and seminal plasma: A systematic review and meta-analysis. Curr Med Res Opin. 31:1763–1769. 2015. View Article : Google Scholar : PubMed/NCBI

17 

Lee G: Chronic Prostatitis: A possible cause of hematospermia. World J Mens Health. 33:103–108. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Magistro G, Wagenlehner FM, Grabe M, Weidner W, Stief CG and Nickel JC: Contemporary management of chronic prostatitis/chronic pelvic pain syndrome. Eur Urol. 69:286–297. 2016. View Article : Google Scholar : PubMed/NCBI

19 

Lai C, Yu X, Zhuo H, Zhou N, Xie Y, He J, Peng Y, Xie X, Luo G, Zhou S, et al: Anti-tumor immune response of folate-conjugated chitosan nanoparticles containing the IP-10 gene in mice with hepatocellular carcinoma. J Biomed Nanotechnol. 10:3576–3589. 2014. View Article : Google Scholar : PubMed/NCBI

20 

Zdrodowska-Stefanow B, Ostaszewska-Puchalska I, Badyda J and Galewska Z: The evaluation of markers of prostatic inflammation and function of the prostate gland in patients with chronic prostatitis. Arch Immunol Ther Exp (Warsz). 56:277–282. 2008. View Article : Google Scholar : PubMed/NCBI

21 

Delongchamps NB, de la Roza G, Chandan V, Jones R, Sunheimer R, Threatte G, Jumbelic M and Haas GP: Evaluation of prostatitis in autopsied prostates-is chronic inflammation more associated with benign prostatic hyperplasia or cancer? J Urol. 179:1736–1740. 2008. View Article : Google Scholar : PubMed/NCBI

22 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

23 

Kutch JJ, Yani MS, Asavasopon S, Kirages DJ, Rana M, Cosand L, Labus JS, Kilpatrick LA, Ashe-McNalley C, Farmer MA, et al: Altered resting state neuromotor connectivity in men with chronic prostatitis/chronic pelvic pain syndrome: A MAPP: Research Network Neuroimaging Study. Neuroimage Clin. 8:493–502. 2015. View Article : Google Scholar : PubMed/NCBI

24 

Thakur V, Talwar M and Singh PP: Low free to total PSA ratio is not a good discriminator of chronic prostatitis and prostate cancer: An Indian experience. Indian J Cancer. 51:335–337. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Giannantoni A and Proietti S: Chronic prostatitis: How to give our best without apposite vagueness. BJU Int. 116:499–500. 2015. View Article : Google Scholar : PubMed/NCBI

26 

Zhang Y, Zheng T, Tu X, Chen X, Wang Z, Chen S, Yang Q, Wan Z, Han D, Xiao H, et al: Erectile dysfunction in chronic prostatitis/chronic pelvic pain syndrome: Outcomes from a multi-center study and risk factor analysis in a single center. PLoS One. 11:e01530542016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu F, Liu L, Wang Z, Chen L, Yu J and Xu X: The role of ethanol in the pathogenesis of non‑bacterial prostatitis. Mol Med Rep 19: 3848-3854, 2019.
APA
Liu, F., Liu, L., Wang, Z., Chen, L., Yu, J., & Xu, X. (2019). The role of ethanol in the pathogenesis of non‑bacterial prostatitis. Molecular Medicine Reports, 19, 3848-3854. https://doi.org/10.3892/mmr.2019.9991
MLA
Liu, F., Liu, L., Wang, Z., Chen, L., Yu, J., Xu, X."The role of ethanol in the pathogenesis of non‑bacterial prostatitis". Molecular Medicine Reports 19.5 (2019): 3848-3854.
Chicago
Liu, F., Liu, L., Wang, Z., Chen, L., Yu, J., Xu, X."The role of ethanol in the pathogenesis of non‑bacterial prostatitis". Molecular Medicine Reports 19, no. 5 (2019): 3848-3854. https://doi.org/10.3892/mmr.2019.9991
Copy and paste a formatted citation
x
Spandidos Publications style
Liu F, Liu L, Wang Z, Chen L, Yu J and Xu X: The role of ethanol in the pathogenesis of non‑bacterial prostatitis. Mol Med Rep 19: 3848-3854, 2019.
APA
Liu, F., Liu, L., Wang, Z., Chen, L., Yu, J., & Xu, X. (2019). The role of ethanol in the pathogenesis of non‑bacterial prostatitis. Molecular Medicine Reports, 19, 3848-3854. https://doi.org/10.3892/mmr.2019.9991
MLA
Liu, F., Liu, L., Wang, Z., Chen, L., Yu, J., Xu, X."The role of ethanol in the pathogenesis of non‑bacterial prostatitis". Molecular Medicine Reports 19.5 (2019): 3848-3854.
Chicago
Liu, F., Liu, L., Wang, Z., Chen, L., Yu, J., Xu, X."The role of ethanol in the pathogenesis of non‑bacterial prostatitis". Molecular Medicine Reports 19, no. 5 (2019): 3848-3854. https://doi.org/10.3892/mmr.2019.9991
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team