Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
March-2020 Volume 21 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2020 Volume 21 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article

Schwann cell‑derived exosomes induce bone marrow‑derived mesenchymal stem cells to express Schwann cell markers in vitro

  • Authors:
    • Hui Wang
    • Yanjun Jia
    • Jiamou Li
    • Qingsong Liu
  • View Affiliations / Copyright

    Affiliations: Department of Otolaryngology Head and Neck Surgery, Beijing Luhe Hospital, Capital Medical University, Beijing 101199, P.R. China, Medical Research Center, Beijing Chaoyang Hospital, Capital Medical University, Beijing 100043, P.R. China, Department of Orthopedics, Beijing Tiantan Hospital, Capital Medical University, Beijing 100070, P.R. China
  • Pages: 1640-1646
    |
    Published online on: January 24, 2020
       https://doi.org/10.3892/mmr.2020.10960
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Following peripheral nerve injury, factors in the local microenvironment can induce the differentiation of bone marrow‑derived mesenchymal stem cells (BMSCs) into Schwann cells; however, the specific factors that participate in this process remain unclear. The present study aimed to investigate the role of Schwann cell‑derived exosomes in the differentiation of BMSCs into Schwann cells. Exosomes were extracted from Schwann cells or fibroblasts and co‑cultured with BMSCs. The morphology, as well as gene and protein expressions of the BMSCs were measured to determine the effect of exosomes on cell differentiation. The levels of Schwann cell‑specific markers in BMSCs were significantly increased by Schwann cell‑derived exosomes compared with untreated BMSCs; however, fibroblast‑derived exosomes did not demonstrate the same effects. In conclusion, Schwann cell‑derived exosomes may be involved in the differentiation of BMSCs into Schwann cells, which may provide a novel target for promoting nerve regeneration following injury.

Introduction

Bone marrow-derived mesenchymal stem cells (BMSCs) can differentiate into Schwann cells (key factors for nerve regeneration) under different conditions, such as during sciatic nerve transection and nerve regeneration chamber to promote the regeneration of damaged nerves (1–4). BMSCs transplanted in vivo to damaged areas can differentiate into the corresponding Schwann cells (1,2,4–6), which suggested that following injury, multiple factors may be produced in the local in vivo microenvironment that can induce BMSCs to differentiate into Schwann cells to repair the injured tissue; however, the factors involved in this process are unclear.

Exosomes are small cell-derived vesicles that commonly are found in human body fluids, including blood, urine and tissue fluids (7,8). Exosomes serve different functions in the body, including participating in intercellular signaling transduction, cell waste secretion and cell fusion (8). Following nerve injury, Wallerian degeneration and Schwann cell proliferation occurs at the distal end of the nerve, forming a regenerative Büngner zone that promotes and guides proximal nerve regeneration (9). During this process, exosomes secreted by Schwann cells promote the regeneration of peripheral nerves and guide the direction of growth of regenerating axons (10,11); thus, there are large numbers of exosomes in the microenvironment following injury, which serve an important role in the recovery of nerve damage. In addition, previous studies have demonstrated that BMSCs participate in the myelination of spinal axons after being cultured with rat dorsal root ganglion cells, and Schwann cell co-culture can induce BMSCs to differentiate into Schwann cells (12–14). These studies suggest that during nerve regeneration within the microenvironment, in which Schwann cells are present, certain factors can induce BMSCs to differentiate into Schwann cells and participate in axonal regeneration. Due to exosomes being involved in the repair of nerve damage, it was hypothesized that exosomes may also have an important role in stem cell differentiation following injury. In the present study, the effect of Schwann cell-derived exosomes on the differentiation of BMSCs into Schwann cells was investigated.

Materials and methods

Animal studies

All animal procedures were conducted in accordance with The Guidelines for Ethical Conduct in the Care and Use of Animals of the Chinese National Health and Medical Research Council, and were approved by the Animal Experimentation Ethics Committee of Capital Medical College (Beijing, China; protocol no. AEEI-2016-135).

BMSC culture and differentiation into Schwann cells

Rat BMSCs were obtained from the bone marrow of one eight-week-old male Wistar rat, which weighed between 230–270 g, as previously described (3,15). The rat was housed in a pathogen-free climate-controlled facility with food and water available ad libitum. BMSCs were cultured in α-MEM growth media (HyClone; GE Healthcare Life Sciences) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.). The third passage of cells was used for subsequent experiments. Rat Schwann cells (RSC96) and fibroblasts were purchased from Shanghai Fuxiang Company (www.xiangbio.com/timemodel/product/2010-03-08/8421285.html). BMSCs were subsequently divided into three experimental groups: i) BMSCs induced to differentiate into Schwann cells using the Dezawa's induction method, as previously described (3); ii) BMSCs induced to differentiate into Schwann cells by Schwann cell-derived exosomes, in which BMSCs were cultured and passaged for 7 days prior to the addition of 200 µg Schwann cell-derived exosomes to the media (the media was changed every 3 days, with the exosomes being replenished each time); iii) BMSCs induced to differentiate into Schwann cells by fibroblast-derived exosomes, in which BMSCs were cultured and passaged for 7 days prior to the addition of 200 µg fibroblast-derived exosomes to the media (the media was changed every 3 days, with the exosomes being replenished each time). RSC96 cells were used as the positive control group, and untreated BMSCs were used as the negative control group. A preliminary study was conducted to predetermine the dosage of Schwann cell-derived exosomes required to induce BMSCs; out of 50, 100 or 200 µg, 200 µg in 10 ml culture media induced fusiform shape change, in BMSCs. Therefore, the present study used 200 µg exosomes for the induction of BMSCs (Fig. S1).

Exosome extraction, identification and quantification

Exosomes were extracted from fibroblasts (fb exo) and RSC96 (RSC96 exo) cells using the ExoQuick-TC kit (System Biosciences, LLC). The culture media containing the BMSCs was centrifuged (3,000 × g; 15 min; 4°C) to remove apoptotic cells and cell debris. A total of 3.3 ml exosome precipitation solution was added to 10 ml culture supernatant and incubated at 4°C overnight. The mixture was centrifuged (10,000 × g; 30 min; 4°C) and the supernatant was discarded. The isolated exosomes were re-suspended in PBS and the protein concentration was quantified using a bicinchoninic assay kit. Briefly, the standards were diluted to different concentrations (0, 0.2, 0.4, 0.6, 0.8 or 1.0 µg/µl). The samples and standards were loaded separately and incubated with the working solution for 30 min at 37°C in the dark. The optical density values were measured using a microplate reader and the sample concentration was determined according to the standard curve generated. The amount of culture medium and exosomes required was calculated to a final concentration of 20 µg/ml and used in the subsequent experiments. CD63, CD81 and calnexin were detected by western blotting to confirm the isolation of exosomes.

Transmission electron microscopy (TEM) of exosomes

A total volume of 50 µl exosomes were plated onto red wax. The polyvinyl acetate/carbon-coated copper mesh was placed in the droplets and allowed to stand at room temperature for 20 min. The copper mesh was fixed with 2% paraformaldehyde for 2 min at room temperature, washed three times with double-distilled H2O, and counterstained with 2% phosphotungstic acid (XiYa Reagent; http://m.xiyashiji.com/product/info/id/4724.html) for 1 min at room temperature. Filter paper was used to remove excess liquid from the copper mesh, which was subsequently dried overnight at room temperature. The extracted exosomes were observed using TEM (magnification, ×25,000).

Cellular morphology observation

After 2, 4 and 7 days of cell differentiation, cellular morphology was observed using a CX41 light microscope (magnification, ×200; Olympus Corporation).

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was extracted from the BMSCs using TRIzol® reagent (cat. no. R0016; Beyotime Institute of Biotechnology) according to the manufacturer's protocol. Total RNA was reverse transcribed into cDNA using the TransScript First-Strand cDNA Synthesis kit (Beijing Transgen Biotech Co., Ltd.). The RT reaction conditions were as follows: 25°C for 10 min, 42°C for 30 min, and 85°C for 5 min. qPCR was subsequently performed using the SYBR® Green Realtime PCR Master mix (Toyobo Life Science; QPK-201) and the ABI PRISM™ 7500 system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The following primer pairs for each marker gene are presented in Table I. The following thermocycling conditions were used for the qPCR: Initial denaturation at 50°C for 2 min, 94°C for 2 min, 40 cycles of 94°C for 5 sec, 60°C for 30 sec of denaturation, annealing and elongation, 72°C for 5 min of final extension Expression levels were quantified using the 2−ΔΔCq method (16).

Table I.

Primer sequences for reverse transcription-quantitative PCR.

Table I.

Primer sequences for reverse transcription-quantitative PCR.

GenePrimer sequence (5′→3′)
S100F: GGTTGCCCTCATTGATGTCTTCC
R: ACCACTTCCTGCTCTTTGATTTCC
Sox10F: GGGCAAGGTCAAGAAGGAACAG
R: ACCAGCGTCCAGTCGTAGC
EGR2F: CTACCCCCTACAATCCGCAC
R: GATTCGGATGTGCCTGGTCA
GFAPF: CAAGAAACAGAAGAGTGGTATCGGT
R: ACTCAAGGTCGCAGGTCAAGG
NGFRF: CCTGCTGCTGCTGCTGATTC
R: GTTCACACACGGTCTGGTTGG
GAPDHF: TCAAGAAGGTGGTGAAGCAGG
R: TCAAGAAGGTGGTGAAGCAGG

[i] EGR2, early growth response protein 2; GFAP, glial fibrillary acidic protein; NGFR, low-affinity nerve growth factor receptor.

Western blotting

Total protein was lysed from cells using lysis buffer (Beijing Solarbio Science & Technology Co., Ltd.) and the lysate was collected using a cell scraper. The lysate was centrifuged (13,523 × g; 5 min; 4°C) and the supernatant was collected and transferred to a 0.5 ml centrifuge tube. Protein samples were mixed with 5X loading buffer, incubated at 95°C for 5 min, rapidly cooled on ice and stored at −80°C until required for further experimentation. Total protein was quantified using a bicinchoninic acid assay kit and 40 µg protein samples and markers (cat. no. SM1811; Fermentas; Thermo Fisher Scientific, Inc.) were separated via 12% SDS-PAGE. The separated proteins were subsequently transferred onto a nitrocellulose membrane (Merck KGaA) and blocked for 2 h at room temperature with 5% non-fat milk diluted in TBS-Tween-20 (TBST). The membranes were incubated with the following primary antibodies overnight at 4°C: Anti-Sox10 (1:1,000; cat. no. DF8009; Affinity Biosciences), anti-early growth response 2 (EGR2; 1:500; cat. no. AF0480; Affinity Biosciences), anti-S100 (1:1,000; cat. no. AF0251; Affinity Biosciences), anti-glial fibrillary acidic protein (GFAP; 1:1,000; cat. no. AF6166; Affinity Biosciences), anti-low-affinity nerve growth factor receptor (NGFR; 1:2,000; cat. no. OM267104; Omnimabs), anti-GADPH (1:1,000; cat. no. AB-P-R 001; Hangzhou Goodhere Biotechnology Co., Ltd.), anti-CD63 (1:1,000; cat. no. DF2305; Affinity Biosciences), anti-CD81 (1:1,000; cat. no. DF2306; Affinity Biosciences) and anti-Calnexin (1:1,000; cat. no. AF5362; Affinity Biosciences). Membranes were washed three times (10 min each) with 0.1% TBST at room temperature. Following the primary antibody incubation, membranes were incubated with a horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (1:5,000; cat. no. BA1054; Boster Biological Technology) for 2 h at 37°C on a shaker. The membrane was thoroughly washed three times (10 min each) with 0.05% TBST. Protein bands were visualized using an ECL kit (CWBio), according to the manufacturer's protocol. Images of the membrane were captured using a chemiluminescence imager (ChemiDoc™ MP Imaging System; Bio-Rad Laboratories).

Immunofluorescence assay

BMSCs (2×104 cells/well) were seeded into 24-well plates; cells were divided into three groups, cultured with different media as described above, and collected after differentiation for 7 days. Following the removal of the culture media, cells were washed twice with PBS and fixed with 4% paraformaldehyde for 15 min at room temperature. Cells were washed three times with PBS and blocked with 1% BSA (CWBio) at 37°C for 30 min and subsequently incubated with the following primary antibodies overnight at 4°C: Anti-Sox10 (1:250), anti-EGR2 (1:100), anti-NGFR (1:50), anti-S100 (1:100) and anti-GFAP (1:100). Cells were washed three times with PBS for 5 min each and incubated with goat anti-rabbit IgG H&L (Alexa Fluor® 488; 1:500; cat. no. ab150077; Abcam) at 37°C for 30 min. The cells were washed three times with PBS for 5 min each and incubated at room temperature with DAPI for 5 min in the dark. The plate was mounted with the Fluoromount-G® blocking solution containing anti-fluorescence quencher (cat. no. 0100-01; SouthernBiotech). Cells were visualized using an Olympus BX53 fluorescence microscope (magnification, ×100; Olympus Corporation). To calculate the positive rate: 5 fields were randomly selected in each plate, all cells were counted and the expression rate of positive cells was calculated.

Statistical analysis

Statistical analysis was performed using SPSS version 17.2 (SPSS, Inc.) software. The data was presented as the mean ± SD; n=3. RT-qPCR, western blotting and immunofluorescence results were analyzed using one-way ANOVA followed by Newman-Keuls Multiple Comparison test. P<0.05 was considered to indicate a statistically significant difference.

Results

Exosome extraction, isolation and identification

Schwann cell- and fibroblast-derived exosomes were visualized using TEM. Observed exosomes presented as irregular discoid vesicles with a diameter of ~50–80 nm (Fig. 1A). The concentration of protein extracted from the exosomes of RSC96 cells and fibroblasts was 1.22 and 1.10 µg/µl, respectively. The exosomal marker proteins CD81 and CD63 were detected by western blotting in both RSC96 cells and fibroblasts, whereas the endoplasmic reticulum marker protein Calnexin was not detected (Fig. 1B). Overall, this indicated that exosomes were successfully extracted from RSC96 cells and fibroblasts.

Figure 1.

Extraction of exosomes from fibroblasts and RSC96 cells. (A) Transmission electron microscopy images of exosomes (yellow arrows) extracted from fibroblasts or RSC96 Schwann cells (magnification, ×25,000). Scale bar, 200 nm. (B) Protein expression of exosome marker proteins CD81 and CD63, and the endoplasmic reticulum marker Calnexin were assessed by western blotting.

Cell morphology of BMSCs

The differentiation of BMSCs was induced according to the experimental design aforementioned, and the morphological features of BMSCs were evaluated 4 days post-induction. The morphology of BMSCs gradually changed from fibroblast-like morphology to a more fusiform shape, and the length/width ratio significantly increased in induced BMSCs compared with control BCSCs (Fig. 2A and B). Following the addition of Schwann cell- or fibroblast-derived exosomes to the cultured BMSCs, the length/width ratio of the BMSCs in these two groups (BMSCs + RSC96 exo and BMSCs + Fb exo, respectively) significantly increased compared with control BMSCs (Fig. 2A and B); however, there was no significant difference in cell morphology between BMSCs + RSC96 exo and BMSCs + Fb exo (Fig. 2B).

Figure 2.

Cell morphology of BMSCs. (A) Cell morphology of control BMSCs, induced BMSCs, BMSCs + RSC96 exo, BMSCs + Fb exo or RSC96 cells after 4 days of induction (magnification, ×200). Scale bar, 100 µm. (B) Quantitative analysis of the BMSC length/width ratio. **P<0.01. BMSCs, bone marrow-derived mesenchymal stem cells; Fb ex, fibroblast-derived exosomes; induced BMSCs, Dezawa's induction method; RSC96 exo, Schwann cell-derived exosomes.

mRNA and protein expression levels of Schwann cell markers in BMSCs

mRNA and protein expression levels of S100, GFAP, Sox10, NGFR and EGR2 in induced BMSCs were significantly increased compared with the control BMSCs (Fig. 3A-G). In addition, the expression levels of S100, GFAP, Sox10, NGFR and EGR2 in the BMSCs + RSC96 exo group were significantly increased compared with control BMSCs and BMSCs + Fb exo groups (Fig. 3A-G); however, expression levels were not significantly different compared with induced BMSCs. The expression levels of Schwann cell markers in the BMSCs + Fb exo group were not significantly different compared with control BMSCs (Fig. 3A-G).

Figure 3.

mRNA and protein expression levels of Schwann cell markers in differentially-induced BMSCs. (A-E) mRNA expression levels of (A) S100, (B) GFAP, (C) Sox10, (D) EGR2 and (E) NGFR in control BMSCs, induced BMSCs, BMSCs + RSC96 exo, BMSCs + Fb exo or RSC96 cells. (F and G) Representative immunoblot of protein expression levels of S100, GFAP, NGRF, Sox10, EGR2 and GAPDH in control BMSCs, induced BMSCs, BMSCs + RSC96 exo, BMSCs + Fb exo or RSC96 cells. Data are presented as mean ± SD; *P<0.05, **P<0.01 and ***P<0.001. BMSCs, bone marrow mesenchymal stem cells; EGR2, early growth response 2; Fb exo, fibroblast-derived exosomes; GFAP, glial fibrillary acidic protein; induced BMSCs, Dezawa's induction method; NGFR, low-affinity nerve growth factor receptor; RSC96 exo, Schwann cell-derived exosomes.

Results from immunofluorescence investigations demonstrated that the positive expression rates of S100, GFAP, NGFR, Sox10 and EGR2 were significantly increased in induced BMSCs compared with control BMSCs (Fig. 4); the expression levels of these Schwann cell markers were also significantly increased in the BMSCs + RSC96 exo group compared to the control BMSCs. In addition, the protein expression levels of all Schwann cell markers were significantly increased in the BMSCs + RSC96 exo group compared with the BMSCs + Fb exo group, which did not display significantly altered expression levels compared with control BMSCs (Fig. 4). This was consistent with the RT-qPCR and western blotting results (Fig. 3). These results suggested that Schwann cell-derived exosomes may promote the differentiation of BMSCs into Schwann cells because the expression levels of Schwann cell marker proteins and transcription factors increased following the induction, whereas fibroblast-derived exosomes were not observed to promote the same function.

Figure 4.

Protein expression of Schwann cell markers in differentially-induced BMSCs. (A) Representative immunofluorescence micrographs of Schwann cell-associated marker expressions (S100, GFAP, NGRF, Sox10 and EGR2) in control BMSCs, induced BMSCs, BMSCs + RSC96 exo, BMSCs + Fb exo or RSC96 cells (magnification, ×100). Scale bar, 50 µm. (B) Quantitative analysis of the expression of Schwann cell-associated markers from (A) Data are presented as mean ± SD; *P<0.05 and **P<0.01. BMSCs, bone marrow mesenchymal stem cells; EGR2, early growth response 2; Fb exo, fibroblast-derived exosomes; GFAP, glial fibrillary acidic protein; induced BMSCs, Dezawa's induction method; NGFR, low-affinity nerve growth factor receptor; RSC96 exo, Schwann cell-derived exosomes.

Discussion

Results from the present study demonstrated that Schwann cell-derived exosomes may induce BMSCs to differentiate into Schwann cells. During induction, BMSCs express Schwann cell surface markers at multiple developmental stages; these include S100, GFAP, NGRF, Sox10 and EGR2 (17–19). Sox10 and EGR2 are transcription factors that serve crucial roles in Schwann cell differentiation (20,21); Sox10 is expressed in neural crest cells and is required for the Schwann cell phenotype and progression beyond the immature stage (20); EGR2 is closely related to the differentiation of myelinating Schwann cells (21). Exosomes derived from fibroblasts were not observed to have increased expression levels of these markers, indicating that Schwann cell-derived exosomes may be widely involved in the differentiation of stem cells into Schwann cells.

Previous studies have used stem cell-induced differentiation with diverse induction methods to obtain Schwann-like cells, including the use of cytokines (3,22) and small molecule chemical reprogramming induction (23). BMSCS can differentiate and participate in nerve regeneration at lesion sites (3,22,23), suggesting that there might be a natural in vivo stem cell induction mechanism; however, this mechanism remains relatively unknown. Currently, the most accepted hypothesis is that BMSCs can differentiate into Schwann cells under the control of cytokines in the local microenvironment, which enables the newly differentiated Schwann cells to secrete corresponding neuronal factors that promote nerve regeneration or directly participate in the regeneration of the myelin sheath (24,25). It is also hypothesized that BMSCs can interact with local cells instead of differentiating into Schwann cells to promote these functions (26). However, to the best of our knowledge, previous studies have not investigated whether exosomes serve a role in the induction process. Our previous study reported that degenerative nerve distal tissue fluid may promote the differentiation of BMSCs into Schwann cells following nerve injury (15), suggesting that the source of the induced components in the microenvironment following nerve damage may be related to Wallerian degeneration. The present study demonstrated that exosomes derived from Schwann cells may be involved in the differentiation of BMSCs into Schwann cells. These results led to the hypothesis that exosomes may induce the differentiation of BMSCs into Schwann cells in a similar manner to cytokines, through interacting with microRNAs, mRNAs and proteins in the exosomes. Moreover, exosomes may also serve an important role in multiple developmental stages of Schwann cells.

The underlying mechanisms behind exosome-induced differentiation of BMSCs into Schwann cells remains unclear and further investigations are required; transcriptome sequencing and analysis may reveal the differences in the transcriptional profiles of BMSC-derived Schwann cells and Schwann cells. In addition, Schwann cell-derived exosomes are complex and versatile, but most research on exosomes focuses on their role in nerve regeneration (10,27–30). The exosomes produced by the newly dedifferentiated Schwann cells following nerve injury may differ from the exosomes derived from normal Schwann cells under healthy physiological conditions. Therefore, their function regarding the induction of Schwann cell differentiation needs to be further investigated. In addition, it could be that the exosome purity can affect MSCs induction, thus the failure to evaluate the exosome purity may impact the accuracy of the conclusions drawn from this study. In conclusion, the present study suggested that the role of exosomes in the differentiation of BMSCs into Schwann cells may represent a novel target for neural regeneration; however, these results were not validated in in vivo studies; thus, the efficiency of this induction method requires further study.

Supplementary Material

Supporting Data

Acknowledgements

Not applicable.

Funding

This study was supported by The National Natural Science Foundation of China (grant. no. 81470682).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

HW and YJ designed and performed the research. HW, YJ, JL and QL analyzed the data and were involved in writing the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

All animal procedures were conducted in accordance with The Guidelines for Ethical Conduct in the Care and Use of Animals of the Chinese National Health and Medical Research Council, and were approved by the Animal Experimentation Ethics Committee of Capital Medical College (Beijing, China; protocol no. AEEI-2016-135).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Chen X, Wang XD, Chen G, Lin WW, Yao J and Gu XS: Study of in vivo differentiation of rat bone marrow stromal cells into Schwann cell-like cells. Microsurgery. 26:111–115. 2006. View Article : Google Scholar : PubMed/NCBI

2 

Cuevas P, Carceller F, Dujovny M, Garcia-Gómez I, Cuevas B, González-Corrochano R, Diaz-González D and Reimers D: Peripheral nerve regeneration by bone marrow stromal cells. Neurol Res. 24:634–638. 2002. View Article : Google Scholar : PubMed/NCBI

3 

Dezawa M, Takahashi I, Esaki M, Takano M and Sawada H: Sciatic nerve regeneration in rats induced by transplantation of in vitro differentiated bone-marrow stromal cells. Eur J Neurosci. 14:1771–1776. 2001. View Article : Google Scholar : PubMed/NCBI

4 

Ladak A, Olson J, Tredget EE and Gordon T: Differentiation of mesenchymal stem cells to support peripheral nerve regeneration in a rat model. Exp Neurol. 228:242–252. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Shen J, Duan XH, Cheng LN, Zhong XM, Guo RM, Zhang F, Zhou CP and Liang BL: In vivo MR imaging tracking of transplanted mesenchymal stem cells in a rabbit model of acute peripheral nerve traction injury. J Magn Reson Imaging. 32:1076–1085. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Tohill M, Mantovani C, Wiberg M and Terenghi G: Rat bone marrow mesenchymal stem cells express glial markers and stimulate nerve regeneration. Neurosci Lett. 362:200–203. 2004. View Article : Google Scholar : PubMed/NCBI

7 

Keller S, Sanderson MP, Stoeck A and Altevogt P: Exosomes: From biogenesis and secretion to biological function. Immunol Lett. 107:102–108. 2006. View Article : Google Scholar : PubMed/NCBI

8 

van der Pol E, Boing AN, Harrison P, Sturk A and Nieuwland R: Classification, functions, and clinical relevance of extracellular vesicles. Pharmacol Rev. 64:676–705. 2012. View Article : Google Scholar : PubMed/NCBI

9 

van Niel G, Porto-Carreiro I, Simoes S and Raposo G: Exosomes: A common pathway for a specialized function. J Biochem. 140:13–21. 2006. View Article : Google Scholar : PubMed/NCBI

10 

Ching RC and Kingham PJ: The role of exosomes in peripheral nerve regeneration. Neural Regen Res. 10:743–747. 2015. View Article : Google Scholar : PubMed/NCBI

11 

Lopez-Leal R and Court FA: Schwann cell exosomes mediate neuron-glia communication and enhance axonal regeneration. Cell Mol Neurobiol. 36:429–436. 2016. View Article : Google Scholar : PubMed/NCBI

12 

Ravasi M, Scuteri A, Pasini S, Bossi M, Menendez VR, Maggioni D and Tredici G: Undifferentiated MSCs are able to myelinate DRG neuron processes through p75. Exp Cell Res. 319:2989–2999. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Zhu S, Li J, Zhu Q, Dai T, He B, Zhou X, Xiang J and Liu X: Differentiation of human amniotic epithelial cells into Schwann-like cells via indirect co-culture with Schwann cells in vitro. Mol Med Rep. 11:1221–1227. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Wei Y, Gong K, Zheng Z, Liu L, Wang A, Zhang L, Ao Q, Gong Y and Zhang X: Schwann-like cell differentiation of rat adipose-derived stem cells by indirect co-culture with Schwann cells in vitro. Cell Prolif. 43:606–616. 2010. View Article : Google Scholar : PubMed/NCBI

15 

Wang H, Zhang H, Liu M and Wang N: Distal segment extracts of the degenerated rat sciatic nerve induce bone marrow stromal cells to express Schwann cell markers in vitro. Neurosci Lett. 544:89–93. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

17 

Finzsch M, Schreiner S, Kichko T, Reeh P, Tamm ER, Bösl MR, Meijer D and Wegner M: Sox10 is required for Schwann cell identity and progression beyond the immature Schwann cell stage. J Cell Biol. 189:701–712. 2010. View Article : Google Scholar : PubMed/NCBI

18 

Bremer M, Frob F, Kichko T, Reeh P, Tamm ER, Suter U and Wegner M: Sox10 is required for Schwann-cell homeostasis and myelin maintenance in the adult peripheral nerve. Glia. 59:1022–1032. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Jaegle M and Meijer D: Role of Oct-6 in Schwann cell differentiation. Microsc Res Tech. 41:372–378. 1998. View Article : Google Scholar : PubMed/NCBI

20 

Britsch S, Goerich DE, Riethmacher D, Peirano RI, Rossner M, Nave KA, Birchmeier C and Wegner M: The transcription factor Sox10 is a key regulator of peripheral glial development. Genes Dev. 15:66–78. 2001. View Article : Google Scholar : PubMed/NCBI

21 

Zorick TS, Syroid DE, Brown A, Gridley T and Lemke G: Krox-20 controls SCIP expression, cell cycle exit and susceptibility to apoptosis in developing myelinating Schwann cells. Development. 126:1397–1406. 1999.PubMed/NCBI

22 

Cai S, Tsui YP, Tam KW, Shea GK, Chang RS, Ao Q, Shum DK and Chan YS: Directed differentiation of human bone marrow stromal cells to fate-committed schwann cells. Stem Cell Reports. 9:1097–1108. 2017. View Article : Google Scholar : PubMed/NCBI

23 

Thoma EC, Merkl C, Heckel T, Haab R, Knoflach F, Nowaczyk C, Flint N, Jagasia R, Jensen Zoffmann S, Truong HH, et al: Chemical conversion of human fibroblasts into functional Schwann cells. Stem Cell Reports. 3:539–547. 2014. View Article : Google Scholar : PubMed/NCBI

24 

Keilhoff G, Goihl A, Stang F, Wolf G and Fansa H: Peripheral nerve tissue engineering: Autologous Schwann cells vs. transdifferentiated mesenchymal stem cells. Tissue Eng. 12:1451–1465. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Choi BH, Zhu SJ, Kim BY, Huh JY, Lee SH and Jung JH: Transplantation of cultured bone marrow stromal cells to improve peripheral nerve regeneration. Int J Oral Maxillofac Surg. 34:537–542. 2005. View Article : Google Scholar : PubMed/NCBI

26 

Weimann JM, Charlton CA, Brazelton TR, Hackman RC and Blau HM: Contribution of transplanted bone marrow cells to Purkinje neurons in human adult brains. Proc Natl Acad Sci USA. 100:2088–2093. 2003. View Article : Google Scholar : PubMed/NCBI

27 

Lopez-Leal R, Alvarez J and Court FA: Origin of axonal proteins: Is the axon-schwann cell unit a functional syncytium? Cytoskeleton (Hoboken). 73:629–639. 2016. View Article : Google Scholar : PubMed/NCBI

28 

De Gregorio C, Diaz P, Lopez-Leal R, Manque P and Court FA: Purification of exosomes from primary Schwann cells, RNA extraction, and next-generation sequencing of exosomal RNAs. Methods Mol Biol. 1739:299–315. 2018. View Article : Google Scholar : PubMed/NCBI

29 

Qing L, Chen H, Tang J and Jia X: Exosomes and their MicroRNA cargo: New players in peripheral nerve regeneration. Neurorehabil Neural Repair. 32:765–776. 2018. View Article : Google Scholar : PubMed/NCBI

30 

Simeoli R, Montague K, Jones HR, Castaldi L, Chambers D, Kelleher JH, Vacca V, Pitcher T, Grist J, Al-Ahdal H, et al: Exosomal cargo including microRNA regulates sensory neuron to macrophage communication after nerve trauma. Nat Commun. 8:17782017. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang H, Jia Y, Li J and Liu Q: Schwann cell‑derived exosomes induce bone marrow‑derived mesenchymal stem cells to express Schwann cell markers in vitro. Mol Med Rep 21: 1640-1646, 2020.
APA
Wang, H., Jia, Y., Li, J., & Liu, Q. (2020). Schwann cell‑derived exosomes induce bone marrow‑derived mesenchymal stem cells to express Schwann cell markers in vitro. Molecular Medicine Reports, 21, 1640-1646. https://doi.org/10.3892/mmr.2020.10960
MLA
Wang, H., Jia, Y., Li, J., Liu, Q."Schwann cell‑derived exosomes induce bone marrow‑derived mesenchymal stem cells to express Schwann cell markers in vitro". Molecular Medicine Reports 21.3 (2020): 1640-1646.
Chicago
Wang, H., Jia, Y., Li, J., Liu, Q."Schwann cell‑derived exosomes induce bone marrow‑derived mesenchymal stem cells to express Schwann cell markers in vitro". Molecular Medicine Reports 21, no. 3 (2020): 1640-1646. https://doi.org/10.3892/mmr.2020.10960
Copy and paste a formatted citation
x
Spandidos Publications style
Wang H, Jia Y, Li J and Liu Q: Schwann cell‑derived exosomes induce bone marrow‑derived mesenchymal stem cells to express Schwann cell markers in vitro. Mol Med Rep 21: 1640-1646, 2020.
APA
Wang, H., Jia, Y., Li, J., & Liu, Q. (2020). Schwann cell‑derived exosomes induce bone marrow‑derived mesenchymal stem cells to express Schwann cell markers in vitro. Molecular Medicine Reports, 21, 1640-1646. https://doi.org/10.3892/mmr.2020.10960
MLA
Wang, H., Jia, Y., Li, J., Liu, Q."Schwann cell‑derived exosomes induce bone marrow‑derived mesenchymal stem cells to express Schwann cell markers in vitro". Molecular Medicine Reports 21.3 (2020): 1640-1646.
Chicago
Wang, H., Jia, Y., Li, J., Liu, Q."Schwann cell‑derived exosomes induce bone marrow‑derived mesenchymal stem cells to express Schwann cell markers in vitro". Molecular Medicine Reports 21, no. 3 (2020): 1640-1646. https://doi.org/10.3892/mmr.2020.10960
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team