Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
July-2020 Volume 22 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2020 Volume 22 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

MicroRNA‑19b inhibitors can attenuate the STAT3 signaling pathway in NPC C666‑1 cells

  • Authors:
    • Li‑Hui Bian
    • Jing‑Ling Duan
    • Chen Zhou
    • Guo‑Wen Shen
    • Xiao‑Yu Wang
    • Yang Yang
    • Xiao‑Ling Zhang
    • Sheng‑Jun Xiao
  • View Affiliations / Copyright

    Affiliations: Department of Pathology, The Second Affiliated Hospital, Guilin Medical University, Guilin, Guangxi 541199, P.R. China, Department of Pathology and Pathophysiology, Graduate School of Guilin Medical University, Guilin, Guangxi 541004, P.R. China, Department of Physiology, Faculty of Basic Medical Sciences, Guilin Medical University, Guilin, Guangxi 541004, P.R. China
    Copyright: © Bian et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 51-56
    |
    Published online on: May 4, 2020
       https://doi.org/10.3892/mmr.2020.11112
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

MicroRNA (miR)-19b is expressed in various types of tumors and may serve as a potential therapeutic target. The miR‑17‑92 cluster is upregulated in nasopharyngeal carcinoma (NPC) tissues and cells. miR‑19b is a member of the miR‑17‑92 cluster; however, its expression and function in NPC are largely unknown. The present study aimed to investigate the expression and function of miR‑19b in NPC cells. The miRCURY LNATM miRNA Inhibitor (miR‑19b inhibitor and negative control) were transfected into C666‑1 cells. The proliferation, apoptosis and migration of the cells were subsequently detected by the Cell Counting Kit‑8 assay, flow cytometry and Transwell assay, respectively. Additionally, the expression of STAT3 signaling pathway‑associated proteins [STAT3, pSTAT3 and suppressor of cytokine signaling 1 (SOCS1)] and the transcriptional targets of pSTAT3 [Bcl‑2, myeloid leukemia protein 1 (Mcl‑1) and cyclin D1] were detected by western blotting. The miR‑19b inhibitor inhibited proliferation and migration and induced apoptosis of C666‑1 cells. Furthermore, the miR‑19b inhibitor upregulated the expression of SOCS1, a predicted target gene of miR‑19b, and decreased the phosphorylation of STAT3 at Tyr705 and Ser727. These data indicated that upregulation of SOCS1, an endogenous inhibitor of STAT3 phosphorylation, attenuated the STAT3 signaling pathway in C666‑1 cells. Moreover, the expression level of the proproliferative protein cyclin D1 and antiapoptotic proteins Mcl‑1 and Bcl‑2 was significantly decreased following transfection with the miR‑19b inhibitor. The aforementioned three proteins are downstream transcriptional targets of the activated STAT3 signaling pathway. The results of the present study revealed that inhibition of miR‑19b negatively modulated the malignant behavior of NPC cells via the STAT3 signaling pathway. Therefore, miR‑19b inhibition may serve as a novel therapeutic target for the treatment of NPC.

Introduction

Nasopharyngeal carcinoma (NPC) is a type of head and neck cancer endemic in Southeast Asia, and is closely related to Epstein-Barr virus (EBV) infection (1). Despite the improvement in local tumor control achieved by more precise imaging modalities and radiotherapy, the 5-year survival rate of patients with NPC remain unsatisfactory, primarily due to distant metastasis (2). Therefore, there is a requirement for the elucidation of the molecular mechanisms underlying the pathogenesis of NPC as well as the development of novel therapeutic strategies.

MicroRNAs (miRNA/miR) are a class of small, non-protein-coding RNAs that function in RNA silencing and post-transcriptional regulation of gene expression (3). miRNAs are also known to play key roles in cancer, where they serve as oncomirs or tumor suppressors (4). miRNAs have been found to regulate genes involved in multiple cellular processes, including development, differentiation, proliferation and apoptosis (5). The modulation of miRNAs, based on two major approaches (miRNA mimics and miRNA antagonists/inhibitors), is currently being investigated for the clinical development of therapeutic miRNAs (6,7).

miR-19b, also termed miR-19b-1 or miR-19b-1-5p, is upregulated in several types of cancer and has been reported to serve as an oncomir (8). miR-19b serves as a prognostic biomarker for breast cancer and promotes tumor progression through the PI3K/AKT signaling pathway (9). A previous study reported that miR-19b decreases apoptosis, promotes proliferation and induces tumorigenicity in multiple myeloma cells by targeting phosphatase and tensin homolog (10). The miR-17-92 cluster, which includes miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92-1, was reported to be upregulated in NPC (11). However, the role of miR-19b in NPC has not been fully elucidated. Therefore, the present study investigated the function of miR-19b, as well as the therapeutic effect of miR-19b inhibitors, in NPC cells.

Materials and methods

Cell lines and culture

EBV-positive cells C666-1 and HK1-EBV were kindly provided by Professor Sai Wah Tsao (The University of Hong Kong, Hong Kong, China) (12). 5-8F, SUNE1 and SXSW-1489 were kindly provided by Professor Xiao Dong (Southern Medical University, Guangzhou, China) (13) and Professor Weiyi Fang (Southern Medical University) (14). NPC cell lines (C666-1, HK1-EBV, 5-8F, SUNE1) and the immortalized nasopharyngeal epithelial cell line (SXSW-1489) were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.). C666-1 cells were cultured with the addition of 10 µg/ml streptomycin (Gibco; Thermo Fisher Scientific, Inc.). The cells lines were maintained in a humidified atmosphere at 37°C and 5% CO2.

Reverse transcription-quantitative PCR analysis for miR-19b expression

Total RNA from cultured (C666-1, HK1-EBV, 5-8F, SUNE1, SXSW-1489) cells and lenses was extracted using TRIzol® reagent (cat. no. 15596026, Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Genomic DNA was subsequently removed using DNase I. cDNA was synthesized using the Mir-X miRNA First-Strand Synthesis kit (Clontech Laboratories, Inc.) and the following primers: U6, AACGCTTCACGAATTTGCGT; and miR-19b, GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAGT. The expression levels of miR-19b and the internal control U6 were quantified by qPCR using a SYBR Premix Ex Taq II kit (Takara Bio, Inc.) and an ABI Prism 7,000 sequence detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The following primer pairs were used: U6 forward, CTCGCTTCGGCAGCACA and reverse, AACGCTTCACGAATTTGCGT; and mir-19b forward, TGTGCAAATCCATGCAAA and reverse, GTGCAGGGTCCGAGGTATTC. miRNA levels were quantified using the 2−ΔΔCq method and normalized to the internal control U6.

Transient transfection of miRNA-19b inhibitors

The miRCURY LNA™ miRNA Inhibitor [consisting of an miR-19b inhibitor and a negative control (NC)] was obtained from Qiagen, Inc. The sequences of the miRNA are proprietary information. The miRNAs were transiently transfected into C666-1 cells at a working concentration of 15 µM using X-tremeGENE siRNA Transfection Reagent (Roche Diagnostics) following the manufacturer's protocol.

Cell Counting Kit-8 (CCK-8) proliferation assay

A total of 2×103 C666-1 cells per well were seeded in a 96-well plate in a final volume of 100 µl and transfected with miRNAs. The effect of the miR-19b inhibitor on cell proliferation was subsequently determined using the CCK-8 assay at 6, 12, 24 and 48 h post-transfection. A total of 10 µl CCK-8 solution (Dojindo Molecular Technologies, Inc.) was added to each well and incubated for 4 h at 37°C. The optical densities of the resultant purple solutions were measured at a wavelength of 450 nm (15).

Transwell migration assay

Transwell chambers (24-well insert; Corning, Inc.) were used to analyze cell migration. At 48 h post-transfection, a total of 2×104 C666-1 cells in serum-free RPMI-1640 medium were seeded into the upper chamber of the insert. RPMI-1640 medium containing 10% FBS was added to the lower chamber to serve as a chemo-attractant. Cells were allowed to migrate for 24 h. The cells on the upper membrane surface were removed using a cotton bud and the cells on the lower membrane surface were fixed with 4% formaldehyde. The cells were subsequently stained with 0.1% crystal violet (Amresco, LLC) and the migrated cells were counted in three random-selected fields. The result of migrated cells was observed and photographed under light microscope (Olympus, Japan).

Flow cytometry assay

C666-1 cells were harvested 48 h post-transfection by trypsin digestion without EDTA and stained using the APC-Annexin V/7-AAD Dual Staining Cell Apoptosis Detection kit (BD Biosciences) according to the manufacturer's instructions. The cells were subsequently analyzed with a flow cytometer. The cells in Q2 (late-stage apoptosis) and Q4 (early-stage apoptosis) were considered to be apoptotic cells.

Western blot analysis

At 48 h post-transfection, cell lysates were harvested. The lysis buffer used RIPA buffer and PMSF (cat. no. R0020, 1:100, Beijing Solarbio Science & Technology, Inc.). Proteins were separated by 10% SDS-PAGE separating gel and 5% SDS-PAGE stacking gel, and then electrophoretically transferred onto a polyvinylidene difluoride membrane. The membrane was subsequently incubated with primary antibodies against β-actin (cat. no. TA-09; 1:5,000; OriGene Technologies, Inc.), STAT3 (cat. no. sc-8019; 1:2,000; Santa Cruz Biotechnology, Inc.), suppressor of cytokine signaling (SOCS) 1 (cat. no. PA5-27239; 1:2,000; Thermo Fisher Scientific, Inc.), p-STAT3 (Tyr705; cat. no. G.374.10; 1:2,000; Thermo Fisher Scientific, Inc.), p-STAT3 (Ser727; cat. no. PS727.2; 1:2,000; Thermo Fisher Scientific, Inc.), cyclin D1 (cat. no. OTI1F7; 1:1,000; OriGene Technologies, Inc.), Bcl-2 (cat. no. OTI2E5; 1:1,000; ZSGB-BIO), myeloid leukemia protein 1 (Mcl-1; cat. no. OTI3A12; 1:1,000; OriGene Technologies, Inc.) overnight at 4°C in Primary Antibodies Dilution Buffer (cat. no. P0023A; Beyotime Institute of Biotechnology). Following primary antibody incubation, the membrane was incubated with peroxidase-conjugated goat anti-mouse IgG (H+L; cat. no. ZB-2305; 1:5,000; ZSGB-BIO) and peroxidase-conjugated goat anti-rabbit IgG (H+L; cat. no. ZB-2301; 1:5,000; OriGene Technologies, Inc.) secondary antibodies for 1 h at room temperature. The protein bands were visualized using the ECL Western Blot Kit detection system (Thermo Fisher Scientific, Inc.). Protein expression was quantified with β-actin as the loading control at least three times and analyzed by Image-J (version1.50i, National Institutes of Health).

Statistical analysis

Data are presented as the mean ± SEM of three independent experiments. One-way ANOVA test was used to analyze the groups. Multiple comparisons were made using the Tukey's post hoc test. Statistical analysis was performed using SPSS software (version 20; IBM Corp). P<0.05 were considered to indicate a statistically significant difference.

Results

miR-19b is upregulated in the majority of NPC cell lines

RT-qPCR revealed that miR-19b was upregulated NPC cells (C666-1, 5-8F and SUNE1) compared with the nasopharyngeal epithelial cell line SXSW-1489. However, no statistical difference in miR-19b expression was observed between HK1-EBV and SXSW-1489 cells (Fig. 1). As C666-1 is the only NPC cell line consistently harboring EBV during in vitro propagation (16), this cell line was selected for subsequent miR-19b interference.

Figure 1.

miR-19b expression in NPC and immortalized nasopharyngeal epithelial cells was detected by reverse transcription-quantitative PCR. miR-19b was upregulated in three NPC cell lines (C666-1, 5-8F, and SUNE1) compared with the immortalized nasopharyngeal epithelial cell line SXSW-1489. *P<0.05; ***P<0.001 vs. SXSW-1489. miR, microRNA; NPC, nasopharyngeal carcinoma.

miR-19b inhibitor inhibits the proliferation of C666-1 cells

The miR-19b inhibitor or NC were transiently transfected into C666-1 cells and the effect on proliferation was subsequently investigated. As shown in Fig. 2, the miR-19b inhibitor inhibited the proliferation of C666-1 cells compared with the NC.

Figure 2.

miR-19b inhibitor inhibited the proliferation of C666-1 cells. C666-1 cells were transfected with the miR-19b inhibitor for 6, 12, 24 and 48 h. The Cell Counting Kit-8 assay revealed that C666-1 cells transfected with the miR-19b inhibitor exhibited decreased proliferation compared with cells transfected with the NC. **P<0.01 vs. NC. miR, microRNA; NC, negative control.

miR-19b inhibitor promotes the apoptosis of C666-1 cells

The miR-19b inhibitor or NC were transiently transfected into C666-1 cells and the effect on apoptosis was subsequently investigated. As shown in Fig. 3, flow cytometry revealed that the miR-19b inhibitor promoted the apoptosis of C666-1 cells compared with the NC.

Figure 3.

miR-19b inhibitor increased the apoptosis of C666-1 cells. (A) At 48 h post-transfection, C666-1 cells transfected with the miR-19b inhibitor exhibited increased apoptosis compared with the NC, as demonstrated by flow cytometry. (B) Bar graphs show percentages of apoptotic cells. **P<0.01 vs. NC. miR, microRNA; NC, negative control.

miR-19b inhibitor inhibits the migration of C666-1 cells

The effect on the migration of C666-1 cells was investigated 48 h post-transfection using a Transwell assay. As shown in Fig. 4, the migration of C666-1 cells was significantly inhibited following transfection with the miR-19b inhibitor, compared with the NC group.

Figure 4.

miR-19b inhibitor inhibited the migration of C666-1 cells. (A) At 48 h post-transfection, C666-1 cells transfected with the miR-19b inhibitor exhibited decreased migration compared with the NC, as demonstrated by the Transwell assay. (B) Number of migrated cells. **P<0.01 vs. NC. miR, microRNA; NC, negative control.

miR-19b inhibitor attenuates STAT3 signaling in C666-1 cells

Western blotting revealed that the expression levels of pSTAT3-Tyr705 and pSTAT3-Ser727 in C666-1 cells decreased following transfection with the miR-19b inhibitor compared with the NC. Furthermore, the expression level of SOCS1, an endogenous inhibitor of STAT3 phosphorylation (17), increased following transfection with the miR-19b inhibitor compared with the NC (Fig. 5). Collectively, these results suggested that the miR-19b inhibitor specifically targeted the STAT3 signaling pathway.

Figure 5.

miR-19b inhibitors upregulated the expression of SOCS1 and decreased the expression of pSTAT3. (A) C666-1 cells were transfected with the miR-19b inhibitor or NC and the protein levels were determined by western blotting 48 h post-transfection. (B) Protein expression was semi-quantified. *P<0.05. miR, microRNA; NC, negative control. SOCS, suppressor of cytokine signaling 1; p, phosphorylated.

miR-19b inhibitor downregulates the expression of the STAT3 signaling pathway downstream effectors

To explore the effect of the miR-19b inhibitor on the expression of the downstream effector genes of the STAT3 signaling pathway, the expression levels of the proliferation-associated gene cyclin D1 and the apoptosis-associated genes Mcl-1 and Bcl-2 were detected by western blotting. These three proteins were downregulated following transfection with the miR-19b inhibitor compared with the NC (Fig. 6), further suggesting that the STAT3 signaling pathway was impaired. Furthermore, the change in malignant biological behaviors such as proliferation, apoptosis and migration may have been mediated by the downstream effectors of the STAT3 signaling pathway.

Figure 6.

miR-19b inhibitor downregulated the expression of cyclin D1, Mcl-1 and Bcl-2. (A) C666-1 cells were transfected with the miR-19b inhibitor or NC and western blotting revealed that transcriptional targets of pSTAT3 (cyclin D1, Mcl-1 and Bcl-2) were downregulated by the miR-19b inhibitor compared with the NC 48 h post-transcription. (B) Protein expression was semi-quantified. *P<0.05. miR, microRNA; Mcl-1; NC, negative control; p, phosphorylated; Mcl-1, myeloid leukemia protein 1.

Discussion

miR-19b, as a member of the miR-17-92 cluster, has been revealed to serve as an oncomir in several types of tumors (18,19). miR-19b promotes cell proliferation, migration and angiogenesis and inhibits cell apoptosis in several malignancies (20,21). The miR-17-92 cluster has been reported to be upregulated in NPC tissues and cell lines (22). Furthermore, the miR-17-92 cluster facilitates malignant biological processes and modulates cancer-related pathways in NPC (11,21,22).

The results of the present study indicated that miR-19b was upregulated in the majority of the NPC cell lines investigated compared with the nasopharyngeal epithelial cell line SXSW-1489. However, the role of miR-19b in NPC remains largely unknown. Therefore, in order to elucidate the functions of miR-19b in NPC cells, an miR-19b inhibitor was introduced into the NPC cell line C666-1. This decreased the proliferation, increased apoptosis and inhibited migration of C666-1 cells compared with the NC. These data are consistent with studies in several other malignancies (8,9,22).

STAT3 is a member of the STAT protein family. STAT3 is phosphorylated by receptor-associated Janus kinases (JAK) when stimulated by cytokines and growth factors and forms homodimers or heterodimers, which are translocated into the cell nucleus where they act as transcriptional activators (23). STAT3 mediates the expression of a variety of genes in response to extracellular or intracellular stimuli (24), and thus plays a key role in cell growth, apoptosis, invasion and metastasis, immune escape and angiogenesis (25). The STAT3 signaling pathway was revealed to be constitutively activated in NPC (26). The involvement of STAT3 in cancer cell growth and invasion has been previously documented in NPC (27). Furthermore, STAT3 has been identified as a therapeutic target in NPC (27).

SOCS1 is a member of the STAT-induced STAT inhibitor (SSI) family, also known as the SOCS family (28). SSI family members are cytokine-inducible negative regulators of cytokine signaling (29). SOCS1 takes part in a negative feedback loop that involves the JAK/STAT3 signaling pathway to attenuate cytokine signaling (30). Additionally, SOCS1 is reported to be a target of miR-19b (31). The aforementioned studies suggest that miR-19b positively modulates the STAT3 signaling pathway by inhibiting SOCS1 expression. The results obtained in the present study showed that SOCS1 expression was upregulated following miR-19b inhibition in C666-1 cells. In addition, upregulation of SOCS1 was accompanied by the downregulation of pSTAT3, including both pSTAT3-Tyr705 and pSTAT3-Ser727, in C666-1 cells. The data implied that miR-19b plays a key role in STAT3 activation in NPC. STAT3 is activated through phosphorylation of Tyr705 in response to a number of factors, including interleukin-6 (32), platelet derived growth factor (10) and epidermal growth factor (33). STAT3 Ser727 is phosphorylated by various kinases (34). Phosphorylation at Tyr-705 leads to an increase in the transcriptional activity of STAT3. Serine phosphorylation is important for the formation of stable DNA-binding STAT3 homodimers and maximal transcriptional activity (35).

Phosphorylated STAT3 increases the expression of multiple downstream genes, which include cyclin D1, Bcl-2 and Mcl-1 (36). Cyclin D1 is proto-oncogene since it serves as a cell cycle regulator and is involved in the G1/S transition (37). Bcl-2 encodes an integral outer mitochondrial membrane protein that prevents apoptosis (38). Mcl-1 is a member of the Bcl-2 family, and is involved in the regulation of apoptosis and cell survival (39). In the present study, the expression of cyclin D1, Bcl-2 and Mcl-1 was downregulated in C666-1 cells following transfection with the miR-19b inhibitor. However, the downstream target genes of the STAT3 signaling pathway requires further investigation.

In conclusion, the present study revealed that inhibition of miR-19b attenuates the STAT3 signaling pathway and decreases the malignant biological behavior of the NPC cell line C666-1. Therefore, miR-19b may serve as potential therapeutic target for patients with NPC.

Acknowledgements

Not applicable.

Funding

The present study was supported by grants from the National Natural Science Foundation of China (grant nos. 81560441 and 81760491 to S.J. Xiao), the Natural Science Foundation of Guangxi Province of China (grant no. 2015GXNSFAA139131 to S.J. Xiao), and Innovation Project of Guangxi Graduate Education (grant no. YCSW2017211 to L.H. Bian).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

SX and XZ contributed to the conception and design of the study. LB, XZ and SX drafted this manuscript. LB, JD, CZ, GS, XW, YY and XZ performed the experiments and analyzed the data. SX and XZ were involved in revising the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Chua MLK, Wee JTS, Hui EP and Chan ATC: Nasopharyngeal carcinoma. Lancet. 387:1012–1024. 2016. View Article : Google Scholar : PubMed/NCBI

2 

Prawira A, Oosting SF, Chen TW, Delos Santos KA, Saluja R, Wang L, Siu LL, Chan KKW and Hansen AR: Systemic therapies for recurrent or metastatic nasopharyngeal carcinoma: A systematic review. Br J Cancer. 117:1743–1752. 2017. View Article : Google Scholar : PubMed/NCBI

3 

Ambros V: The functions of animal microRNAs. Nature. 431:350–355. 2004. View Article : Google Scholar : PubMed/NCBI

4 

Jansson MD and Lund AH: MicroRNA and cancer. Mol Oncol. 6:590–610. 2012. View Article : Google Scholar : PubMed/NCBI

5 

Chen HC, Chen GH, Chen YH, Liao WL, Liu CY, Chang KP, Chang YS and Chen SJ: MicroRNA deregulation and pathway alterations in nasopharyngeal carcinoma. Br J Cancer. 100:1002–1011. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Chen Y, Gao DY and Huang L: In vivo delivery of miRNAs for cancer therapy: Challenges and strategies. Adv Drug Deliv Rev. 81:128–141. 2015. View Article : Google Scholar : PubMed/NCBI

7 

Braicu C, Calin GA and Berindan-Neagoe I: MicroRNAs and cancer therapy-from bystanders to major players. Curr Med Chem. 20:3561–3573. 2013. View Article : Google Scholar : PubMed/NCBI

8 

Li J, Yang S, Yan W, Yang J, Qin YJ, Lin XL, Xie RY, Wang SC, Jin W, Gao F, et al: MicroRNA-19 triggers epithelial-mesenchymal transition of lung cancer cells accompanied by growth inhibition. Lab Invest. 95:1056–1070. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Li C, Zhang J, Ma Z, Zhang F and Yu W: miR-19b serves as a prognostic biomarker of breast cancer and promotes tumor progression through PI3K/AKT signaling pathway. Onco Targets Ther. 11:4087–4095. 2018. View Article : Google Scholar : PubMed/NCBI

10 

Vij N, Sharma A, Thakkar M, Sinha S and Mohan RR: PDGF-driven proliferation, migration, and IL8 chemokine secretion in human corneal fibroblasts involve JAK2-STAT3 signaling pathway. Mol Vis. 14:1020–1027. 2008.PubMed/NCBI

11 

Ma F, Wang Z, Wang J, Liu X and Hu C: MicroRNA-19a promotes nasopharyngeal carcinoma by targeting transforming growth factor β receptor 2. Exp Ther Med. 14:1419–1426. 2017. View Article : Google Scholar : PubMed/NCBI

12 

Hsu CY, Yi YH, Chang KP, Chang YS, Chen SJ and Chen HC: The epstein-barr virus-encoded MicroRNA MiR-BART9 Promotes Tumor Metastasis by Targeting E-Cadherin in nasopharyngeal carcinoma. PLoS Pathog. 10:e10039742014. View Article : Google Scholar : PubMed/NCBI

13 

Lin TY, Chen Y, Jia JS, Zhou C, Lian M, Wen YT, Li XY, Chen HW, Lin XL, Zhang XL, et al: Loss of Cirbp expression is correlated with the malignant progression and poor prognosis in nasopharyngeal carcinoma. Cancer Manag Res. 11:6959–6969. 2019. View Article : Google Scholar : PubMed/NCBI

14 

Zhao M, Luo R, Liu Y, Gao L, Fu Z, Fu Q, Luo X, Chen Y, Deng X, Liang Z, et al: MiR-3188 regulates nasopharyngeal carcinoma proliferation and chemosensitivity through a FOXO1-modulated positive feedback loop with mTOR-p-PI3K/AKT-c-JUN. Nat Commun. 7:11309–11322. 2016. View Article : Google Scholar : PubMed/NCBI

15 

Li X, Zhao Z, Zhang X, Yang S, Lin X, Yang X, Lin X, Shi J, Wang S, Zhao W, et al: Klf4 reduces stemness phenotype, triggers mesenchymal-epithelial transition (MET)-like molecular changes, and prevents tumor progression in nasopharygeal carcinoma. Oncotarget. 8:93924–93941. 2017. View Article : Google Scholar : PubMed/NCBI

16 

Xiao K, Yu Z, Li X, Li X, Tang K, Tu C, Qi P, Liao Q, Chen P, Zeng Z, et al: Genome-wide analysis of epstein-barr virus (EBV) integration and strain in C666-1 and raji cells. J Cancer. 7:214–224. 2016. View Article : Google Scholar : PubMed/NCBI

17 

Davey GM, Heath WR and Starr R: SOCS1: A potent and multifaceted regulator of cytokines and cell-mediated inflammation. Tissue Antigens. 67:1–9. 2006. View Article : Google Scholar : PubMed/NCBI

18 

Liu M, Yang R, Urrehman U, Ye C, Yan X, Cui S, Hong Y, Gu Y, Liu Y, Zhao C, et al: MiR-19b suppresses PTPRG to promote breast tumorigenesis. Oncotarget. 7:64100–64108. 2016. View Article : Google Scholar : PubMed/NCBI

19 

Wang H, Xiong M, Hu Y, Sun Y and Ma Q: MicroRNA-19b inhibits proliferation of gastric cancer cells by targeting B-cell CLL/lymphoma 3. Oncol Rep. 36:2079–2086. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Li X, Wang FS, Wu ZY, Lin JL, Lan WB and Lin JH: MicroRNA-19b targets Mfn1 to inhibit Mfn1-induced apoptosis in osteosarcoma cells. Neoplasma. 61:265–273. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Fan Y, Yin S, Hao Y, Yang J, Zhang H, Sun C, Ma M, Chang Q and Xi JJ: miR-19b promotes tumor growth and metastasis via targeting TP53. RNA. 20:765–772. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Luo Z, Dai Y, Zhang L, Jiang C, Li Z, Yang J, McCarthy JB, She X, Zhang W, Ma J, et al: MiR-18a promotes malignant progression by impairing microRNA biogenesis in nasopharyngeal carcinoma. Carcinogenesis. 34:415–425. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Cheng GZ, Zhang W, Sun M, Wang Q, Coppola D, Mansour M, Xu LM, Costanzo C, Cheng JQ and Wang LH: Twist is transcriptionally induced by activation of STAT3 and mediates STAT3 oncogenic function. J Biol Chem. 283:14665–14673. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Ferguson SD, Srinivasan VM and Heimberger AB: The role of STAT3 in tumor-mediated immune suppression. J Neurooncol. 123:385–394. 2015. View Article : Google Scholar : PubMed/NCBI

25 

Teng Y, Ross JL and Cowell JK: The involvement of JAK-STAT3 in cell motility, invasion, and metastasis. JAKSTAT. 3:e280862014.PubMed/NCBI

26 

Lo AK, Lo KW, Tsao SW, Wong HL, Hui JW, To KF, Hayward DS, Chui YL, Lau YL, Takada K and Huang DP: Epstein-barr virus infection alters cellular signal cascades in human nasopharyngeal epithelial cells. Neoplasia. 8:173–180. 2006. View Article : Google Scholar : PubMed/NCBI

27 

Ho Y, Tsao SW, Zeng M and Lui VW: STAT3 as a therapeutic target for Epstein-Barr virus (EBV): Associated nasopharyngeal carcinoma. Cancer Lett. 330:141–149. 2013. View Article : Google Scholar : PubMed/NCBI

28 

Naka T, Narazaki M, Hirata M, Matsumoto T, Minamoto S, Aono A, Nishimoto N, Kajita T, Taga T, Yoshizaki K, et al: Structure and functionof a new STAT-induced STAT inhibitor. Nature. 387:924–929. 1997. View Article : Google Scholar : PubMed/NCBI

29 

Hamanaka I, Saito Y, Yasukawa H, Kishimoto I, Kuwahara K, Miyamoto Y, Harada M, Ogawa E, Kajiyama N, Takahashi N, et al: Induction of JAB/SOCS-1/SSI-1 and CIS3/SOCS-3/SSI-3 is involved in gp130 resistance in cardiovascular system in rat treated with cardiotrophin-1 in vivo. Circ Res. 88:727–732. 2001. View Article : Google Scholar : PubMed/NCBI

30 

Ben-Zvi T, Yayon A, Gertler A and Monsonego-Ornan E: Suppressors of cytokine signaling (SOCS) 1 and SOCS3 interact with and modulate fibroblast growth factor receptor signaling. J Cell Sci. 2:380–387. 2006. View Article : Google Scholar

31 

Mignacca L, Saint-Germain E, Benoit A, Bourdeau V, Moro A and Ferbeyre G: Sponges against miR-19 and miR-155 reactivate the p53-Socs1 axis in hematopoietic cancers. Cytokine. 82:80–86. 2016. View Article : Google Scholar : PubMed/NCBI

32 

Huang TQ, Willis MS and Meissner G: IL-6/STAT3 signaling in mice with dysfunctional type-2 ryanodine receptor. JAKSTAT. 4:e11583792016.PubMed/NCBI

33 

Wang Y, van Boxel-Dezaire AH, Cheon H, Yang J and Stark GR: STAT3 activation in response to IL-6 is prolonged by the binding of IL-6 receptor to EGF receptor. Proc Natl Acad Sci USA. 110:16975–16980. 2013. View Article : Google Scholar : PubMed/NCBI

34 

Parys JB: The multifaceted STAT3: How a transcription factor regulates Ca2+ signaling via a degradative pathway. Cell Calcium. 76:137–139. 2018. View Article : Google Scholar : PubMed/NCBI

35 

Yokogami K, Wakisaka S, Avruch J and Reeves SA: Serine phosphorylation and maximal activation of STAT3 during CNTF signaling is mediated by the rapamycin target mTOR. Curr Biol. 10:47–50. 2000. View Article : Google Scholar : PubMed/NCBI

36 

Banerjee K and Resat H: Constitutive activation of STAT3 in breast cancer cells: A review. Int J Cancer. 138:2570–2578. 2016. View Article : Google Scholar : PubMed/NCBI

37 

Pardee AB: G1 events and regulation of cell proliferation. Science. 246:603–608. 1989. View Article : Google Scholar : PubMed/NCBI

38 

Lam M, Dubyak G, Chen L, Nuñez G, Miesfeld RL and Distelhorst CW: Evidence that BCL-2 represses apoptosis by regulating endoplasmic reticulum-associated Ca2+ fluxes. Proc Natl Acad Sci USA. 91:6569–6573. 1994. View Article : Google Scholar : PubMed/NCBI

39 

Liu Q and Gehring K: Heterodimerization of BAK and MCL-1 Activated by Detergent Micelles. J Biol Chem. 285:41202–41210. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Bian LH, Duan JL, Zhou C, Shen GW, Wang XY, Yang Y, Zhang XL and Xiao SJ: MicroRNA‑19b inhibitors can attenuate the STAT3 signaling pathway in NPC C666‑1 cells. Mol Med Rep 22: 51-56, 2020.
APA
Bian, L., Duan, J., Zhou, C., Shen, G., Wang, X., Yang, Y. ... Xiao, S. (2020). MicroRNA‑19b inhibitors can attenuate the STAT3 signaling pathway in NPC C666‑1 cells. Molecular Medicine Reports, 22, 51-56. https://doi.org/10.3892/mmr.2020.11112
MLA
Bian, L., Duan, J., Zhou, C., Shen, G., Wang, X., Yang, Y., Zhang, X., Xiao, S."MicroRNA‑19b inhibitors can attenuate the STAT3 signaling pathway in NPC C666‑1 cells". Molecular Medicine Reports 22.1 (2020): 51-56.
Chicago
Bian, L., Duan, J., Zhou, C., Shen, G., Wang, X., Yang, Y., Zhang, X., Xiao, S."MicroRNA‑19b inhibitors can attenuate the STAT3 signaling pathway in NPC C666‑1 cells". Molecular Medicine Reports 22, no. 1 (2020): 51-56. https://doi.org/10.3892/mmr.2020.11112
Copy and paste a formatted citation
x
Spandidos Publications style
Bian LH, Duan JL, Zhou C, Shen GW, Wang XY, Yang Y, Zhang XL and Xiao SJ: MicroRNA‑19b inhibitors can attenuate the STAT3 signaling pathway in NPC C666‑1 cells. Mol Med Rep 22: 51-56, 2020.
APA
Bian, L., Duan, J., Zhou, C., Shen, G., Wang, X., Yang, Y. ... Xiao, S. (2020). MicroRNA‑19b inhibitors can attenuate the STAT3 signaling pathway in NPC C666‑1 cells. Molecular Medicine Reports, 22, 51-56. https://doi.org/10.3892/mmr.2020.11112
MLA
Bian, L., Duan, J., Zhou, C., Shen, G., Wang, X., Yang, Y., Zhang, X., Xiao, S."MicroRNA‑19b inhibitors can attenuate the STAT3 signaling pathway in NPC C666‑1 cells". Molecular Medicine Reports 22.1 (2020): 51-56.
Chicago
Bian, L., Duan, J., Zhou, C., Shen, G., Wang, X., Yang, Y., Zhang, X., Xiao, S."MicroRNA‑19b inhibitors can attenuate the STAT3 signaling pathway in NPC C666‑1 cells". Molecular Medicine Reports 22, no. 1 (2020): 51-56. https://doi.org/10.3892/mmr.2020.11112
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team