Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
December-2020 Volume 22 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2020 Volume 22 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Mechanisms of miR‑128‑3p in inhibiting osteoblast differentiation from bone marrow‑derived mesenchymal stromal cells

  • Authors:
    • Wen Zhang
    • Yu Zhu
    • Junsheng Chen
    • Jiaxing Wang
    • Chen Yao
    • Chen Chen
  • View Affiliations / Copyright

    Affiliations: Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People's Hospital, Shanghai Jiao Tong University, Shanghai 200233, P.R. China, Engineering Research Center of Cell and Therapeutic Antibody, Ministry of Education, School of Pharmacy, Shanghai Jiao Tong University, Shanghai 200240, P.R. China
    Copyright: © Zhang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 5041-5052
    |
    Published online on: October 14, 2020
       https://doi.org/10.3892/mmr.2020.11600
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The authors' previous study demonstrated that miR‑128 may exert an inhibitory effect on the osteogenic differentiation of bone marrow‑derived mesenchymal stem cells (BM‑MSCs), but its downstream mechanisms remain to be elucidated. The aim of the present study was to investigate the microRNA (miRNA/miR) and mRNA profiles of differentiated and undifferentiated BM‑MSCs and explore new downstream targets for miR‑128. The sequencing datasets of GSE107279 (miRNA) and GSE112318 (mRNA) were downloaded from the Gene Expression Omnibus database. The differentially expressed miRNAs (DEMs) and genes (DEGs) were identified using the DESeq2 method. The target genes of DEMs were predicted by the miRwalk 2.0 database. The hub target genes of miR‑128 were screened by constructing the protein‑protein interaction (PPI) network and module analysis. The expression levels of miR‑128 and crucial target genes were validated by reverse transcription‑quantitative (RT‑q) PCR before or after transfection of miR‑128 mimics to BM‑MSCs. The miRNA expression profile analysis identified miR‑128 as one of the significantly downregulated DEMs (total 338) in differentiated BM‑MSCs compared with the undifferentiated control. A total of 103 predicted target genes of miR‑128‑3p were overlapped with upregulated DEGs. By calculating the topological properties of each protein in the PPI network, 6 upregulated genes (KIT, NTRK2, YWHAB, GAB1, AXIN1 and RUNX1; fold change was the highest for NTRK2) were considered to be hub genes. Of these, 4 were enriched in module 4 (RUNX1, KIT, GAB1 and AXIN1; RUNX1 was particularly crucial as it can interact with the others), while one was enriched in module 7 (YWHAB). The expression levels of miR‑128 and these 6 target genes during the osteogenic differentiation were experimentally confirmed by RT‑qPCR. In addition, the expression levels of these 6 genes were significantly reversed after transfection of miR‑128‑3p mimics into rat BM‑MSCs compared with the miR‑control group. These findings indicated that miR‑128‑3p may inhibit the osteoblast differentiation of BM‑MSCs by downregulation of these 6 genes, particularly RUNX1, YWHAB and NTRK2.

Introduction

There has been a consensus that bone marrow-derived mesenchymal stem cells (BM-MSCs) are an ideal cell source for cell-based therapy of various bone-related diseases (1,2) because they can differentiate into osteoblasts, which are the most important cells responsible for bone development and remodeling (3). However, their clinical application remains not widely accepted and treatment outcomes still require additional confirmation with larger sample sizes and control experiments (4). These highlight the need to further understand the molecular mechanisms of osteogenic differentiation in order to improve the differentiation and therapeutic efficiency of BM-MSCs.

microRNAs (miRNAs) are a class of small, non-coding RNAs of approximately 22 nt in length that exert roles by negatively regulating the expression of target mRNAs via specific binding to their 3′-untranslated region (3′-UTR). Recently, several miRNAs have been found to be associated with the differentiation of BM-MSCs. For example, Zhang et al (5) revealed that miR-664a-5p was upregulated in osteoblast-differentiated human BM-MSCs compared with control and this upregulation was positively correlated with the expression of osteogenic genes (RUNX2, ALP and OCN). Overexpression of miR-664a-5p stimulated the osteogenic differentiation of BM-MSCs, whereas an opposite effect was observed when it was knocked down. Luciferase reporting assay revealed that HMGA2 mRNA was a direct target of miR-664a-5p. Overexpression of HMGA2 rescued the effects of miR-664a-5p on osteogenic differentiation (5). Ge et al (6) reported that overexpression of miR-374b significantly induced the osteogenic differentiation of mouse BM-MSCs, showing increased ALP activity and the expression of RUNX2, OPN and OCN. Further analysis of the mechanism revealed that miR-374b may bind to PTEN to mediate its functions (6). Huang et al (7) demonstrated that overexpression of miR-320a downregulated HOXA10 and then significantly inhibited osteogenesis of BM-MSCs, as determined by the downregulation of the osteogenic markers RUNX2, ALP and OCN and the inhibition of ALP activity and matrix mineralization; while ectopic expression of HOXA10 attenuated miR-320a-induced inhibitory effects on osteogenic differentiation of BM-MSCs. miR-125a-3p and miR-125b have been revealed to specifically regulate the expression of GIT ArfGAP 1 (GIT1) and BMPR1b to inhibit the osteoblastic proliferation and differentiation from BM-MSCs, respectively (8,9). miR-223 was identified to be gradually downregulated during osteogenic differentiation of BM-MSCs, accompanied by the upregulated expression of its target gene DHRS3 (10). These findings revealed the importance of investigating the miRNAs and their target genes to explain the osteogenic differentiation mechanisms of BM-MSCs.

In our previous study, it was demonstrated that miR-128 was downregulated by 58.8% in osteogenic treatment for human BM-MSCs and that miR-128 may inhibit the osteogenic differentiation through suppression of the vascular endothelial growth factor pathway (11). However, studies on miR-128 remain rare and its downstream mechanisms for osteogenic differentiation are still not well understood. The present study aimed to further elucidate the molecular mechanisms of miR-128 during the osteogenic differentiation of BM-MSCs by bioinformatic analyses of miRNA (12) and mRNA sequencing datasets which were collected from a public database. The predicted target genes were also validated by in vitro experiments in which miR-128 mimics were introduced. The present study may provide new insights for elucidating the mechanisms of miR-128 and identifying potential therapeutic targets to promote bone anabolism.

Materials and methods

High-throughput datasets

The high-throughput datasets of miRNAs and mRNAs in BM-MSCs before or after osteoblast differentiation were available from the Gene Expression Omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo/) under accession number GSE107279 (platform: GPL11154, Illumina HiSeq 2000) (12) and GSE112318 (platform: GPL20795, HiSeq X Ten) (13), respectively. GSE107279 (12) included 3 undifferentiated human BM-MSC samples and 21 differentiated samples which were collected after induction for 12, 24 h, 3, 10 and 13 days in osteogenic medium. GSE112318 (13) contained one undifferentiated human BM-MSC sample and one differentiated sample which was induced for 2 weeks in osteogenic medium. To identify the link between miRNAs and mRNAs, the present study only used the 13-day data of GSE107279 dataset (12). Another reason for selecting this time-point was that osteoblast differentiation was induced in 13 days in the in vitro experiments of the present study.

Differential analysis for miRNAs and mRNAs

The reads data of GSE107279 (12) and GSE112318 (13) were downloaded from the GEO repository and mean-normalized. The differentially expressed miRNAs (DEMs) and genes (DEGs) between differentiated and undifferentiated samples were identified using DESeq2 (http://www.bioconductor.org/packages/release/bioc/html/DESeq2.html.). package (14) in R (15). |log2fold change (FC)| >0.5 and false discovery rate (FDR)-adjusted P<0.05 represented the statistical threshold for DEMs and DEGs. A heat map was created using the ‘pheatmap’ package (version: 1.0.8; http://cran.r-project.org/web/packages/pheatmap) based on the Euclidean distance.

Target gene prediction for miR-128-3p

The BLAST server (blast.ncbi.nlm.nih.gov/Blast.cgi) was used to identify the nucleotide sequence similarity of human and rat miR-128-3p. The target genes of miR-128-3p were predicted using the miRwalk database (version 2.0; zmf.umm.uni-heidelberg.de/apps/zmf/mirwalk2) (16). The miRwalk database included 12 algorithms and the genes that were predicted in at least 5 databases were collected. A Venn diagram (http://bioinformatics.psb.ugent.be/webtools/Venn/) was drawn to screen the common genes predicted using the human and rat as the species parameters (since rat BM-MSCs were used in validation experiments) in miRwalk database and the shared genes between predicted genes and DEGs, which were considered to be possibly crucial targets of miR-128-3p. The miRNA-mRNA regulatory network was visualized using the Cytoscape software (version 3.4; www.cytoscape.org/) (17).

Protein-protein interaction (PPI) network

The interactions between two target genes of miR-128-3p were predicted using the STRING (Search Tool for the Retrieval of Interacting Genes; version 10.0; http://stringdb.org/) database (18), with the relationship pairs having a combined score >0.4 being used to construct the PPI network. Several topological features of the nodes (proteins) in the PPI network were calculated using the CytoNCA plugin in the Cytoscape software (http://apps.cytoscape.org/apps/cytonca) (19) to screen hub genes, including degree centrality (DC), eigenvector centrality (EC) and closeness centrality (CC). In addition, several function-related modules were also extracted from the PPI network using the Molecular Complex Detection (MCODE; version, 1.4.2; http://apps.cytoscape.org/apps/mcode) plugin of the Cytoscape software.

Function enrichment analysis for target genes of miR-128-3p

Kyoto Encyclopedia of Genes and Genomes (KEGG; version Release 92.0, October 1, 2019; genome.jp/kegg/) pathway enrichment analysis was performed for target genes of DEMs using the enricher tool (https://amp.pharm.mssm.edu/Enrichr/) (20). FDR<0.05 was considered to be statistically significant.

Function validation of miR-128-3p for the osteoblast differentiation from BM-MSCs

BM-MSCs of Wistar rats were purchased from the Chinese Academy of Science Cell Bank and cultured in Alpha Minimum Essential Medium (α-MEM; Gibco, Thermo Fisher Scientific, Inc.) supplemented with GlutaMAX™-I, 10% fetal bovine serum and 1% penicillin/streptomycin (all Gibco; Thermo Fisher Scientific, Inc.) at 37°C in a humidified atmosphere of 5% CO2 in air.

Transfection

miR-128-3p mimics and miR-normal control (miR-NC) were obtained from Shanghai GenePharma Co., Ltd. On the day before the transient transfections, the cells were seeded into 6-well plates and incubated (37°C) to reach 65% confluency. Then, miR-128-3p mimics (15, 30, 40 and 50 pmol) and the scrambled control were transfected into BM-MSCs of Wistar rats using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol.

After 48 h of transfection, the cells were collected to detect proliferation ability and the expression of miR-128-3p, in order to screen the optimal treatment concentration of miR-128-3p mimics. Subsequently, the cells were treated with this concentration of miR-128-3p mimics for 13 days to observe its functions on the osteoblast differentiation and the expression of target genes.

Cell proliferation

Cell proliferation ability of BM-MSCs was determined using Cell Counting Kit-8 (CCK-8; Dojindo Molecular Technologies, Inc.). Briefly, cells were seeded into a 96-well plate at a density of 2×103/well and cultured at 37°C, 5% CO2. Then, 10 µl of CCK-8 solution was added to assay the cell growth status. At 2 h following CCK-8 treatment, the absorbance of each well at 450 nm wavelengths was measured by a microplate reader.

Reverse transcription-quantitative (RT-q) PCR

RT-qPCR was used for the analysis of gene expression according to the manufacturer's protocols. Briefly, total RNA was extracted from 2×103 cells using TRIzol® reagent (Thermo Fisher Scientific, Inc.). The high-purity and intact RNA (OD260/OD280>1.9) was converted into cDNA by the GoScript Reverse Transcription System (Promega Corporation). RT-qPCR was then performed on a CFX96 Real-Time System/C1000 Thermal Cycler (Bio-Rad Laboratories, Inc.) using AceQ® RT-qPCR SYBR-Green Master Mix (Vazyme Biotech Co., Ltd.). The reaction conditions for RT-qPCR were pre-incubation at 95°C for 10 min, followed by amplification with 39 cycles of 10 sec denaturation at 95°C, 20 sec annealing at 65°C and 10 sec elongation at 72°C. U6 and actin were used as the internal reference for miRNA and mRNA detection, respectively. Relative expression levels were analyzed using the 2−ΔΔCq method (21). The primers used are listed in Table I.

Table I.

Primers used in the present study.

Table I.

Primers used in the present study.

GenePrimer sequence (5′-3′)
ACTINF: GAGACCTTCAACACCCCAGC
R: ATGTCACGCACGATTTCCC
RUNX1-ratF: GGTTTCGCAGCGTGGTAAAA
R: GCACTGTGGGTACGAAGGAA
KIT-ratF: TACTTGGAGCCTGCACCATT
R: TATCGCTGCAGGAAGACTCC
AXIN1-ratF: GTGCCCCTACCTCACATTCC
R: CTCACCTTCCTCCTCCATGC
YWHAB-ratF: GTCTCCAGAGATTTGGGCCG
R: CCATTGTCATTCCCTGACTCCA
GAB1-ratF: GAGAGCTAGGTTCTCGCCAC
R: TCCTCTTCCATGCATAACGCT
NTRK2-ratF: TTACGGTTTGTCACCCGACC
R: GTGCTTGGTTCAGCTCTTGC
RUNX2-ratF: GCCAATCCCTGAGTGTGACT
R: CCTGGTGGTGTCACTGAATG
BGLAP-ratF: CACCGTTTAGGGCATGTGTT
R: TCCTGGAGAGTAGCCAAAGC
miR-128-3p-ratF: CGCGTCACAGTGAACCGGT
R: AGTGCAGGGTCCGAGGTATT
U6 AACGCTTCACGAATTTGCGT

[i] F, forward; R, reverse; miR, microRNA.

Osteogenic differentiation

Osteogenic differentiation of BM-MSCs was induced using standard osteogenic medium consisting of phenol red-free α-MEM, 10% FBS, ascorbic acid (50 µg/ml), dexamethasone (10−8 M) and β-glycerophosphate (10−2 M). The medium was changed twice every week. The osteoblastic differentiation potency of BM-MSCs was determined by Alizarin red staining: After induction culture for 2 weeks, the cells were washed with PBS and fixed with 4% paraformaldehyde for 10 min and then stained using 2% Alizarin red for 20 min at room temperature to evaluate calcium nodule formation.

Statistical analysis

All experiments were performed for at least three biological repeats. Statistical analysis was performed using SPSS 18.0 (SPSS, Inc.) and graphs were prepared in GraphPad Prism 5.0 (GraphPad Software, Inc.). All data were expressed as the mean ± standard deviation. Statistical differences between two groups were determined using two-tailed paired Student's t-test; while statistical comparisons among more than two groups were performed using one-way ANOVA followed by post hoc Tukey's test. P<0.05 was considered to indicate a statistically significant difference.

Results

Identification of miR-128 as a DEM in osteoblast-differentiated BM-MSCs

Among the 654 miRNAs included in the GSE107279 dataset, 338 of them were found to be differentially expressed between differentiated and undifferentiated BM-MSCs under the stated threshold, including 295 downregulated and 43 upregulated DEMs (Fig. 1A and B). miR-128 was one of the significantly downregulated DEMs in differentiated BM-MSCs, with a log2FC of −0.77 and an FDR-adjusted P-value of 1.93×10−12.

Figure 1.

(A and C) Volcano plot and (B and D) heat maps of differentially expressed miRNAs and mRNAs between differentiated and undifferentiated BM-MSCs. (A and B) miRNA sequencing datasets of GSE107279; (C and D) mRNA sequencing datasets of GSE112318. Colors shading to red; high expression; colors shading to light blue, low expression. Intensity of color reflects degree of expression. miRNA, microRNA; BM-MSCs, bone marrow-derived mesenchymal stem cells.

Identification of the crucial target genes of miR-128 for osteoblast-differentiated BM-MSCs

Among the 19,652 genes included in the GSE112318 dataset, 14,894 of them were revealed to be differentially expressed between differentiated and undifferentiated BM-MSCs under the stated threshold, including 9,571 downregulated and 5,323 upregulated DEGs (Fig. 1C and D).

The sequence of has-miR-128-3p and Rno-miR-128-3p was 100% identical (Fig. 2A). Thus, the targets of miR-128-3p were predicted using human and rat as species, respectively. Using the miRwalk 2.0 database, 4,443 target genes were predicted to interact with human miR-128-3p in the 3′UTR, while 1,331 were predicted to be regulated by rat miR-128-3p via the 3′UTR. Among them, 582 were shared between the two species (Fig. 2B). Furthermore, 332 of 582 genes were overlapped with the DEGs (Fig. 2C), including 103 upregulated and 229 downregulated (which were used for establishing the miRNA-mRNA network, as shown in Fig. 3), suggesting these 103 upregulated DEGs may be underlying target genes of downregulated miR-128-3p.

Figure 2.

Identification of target genes of miR-128. (A) The BLAST results of human and rat miR-128-3p. (B) Venn diagram to screen the common genes regulated by human and rat miR-128-3p. (C) Venn diagram of predicted target genes of miR-128-3p and differentially expressed genes shared by differentiated and undifferentiated BM-MSCs. miRNA, microRNA; BM-MSCs, bone marrow-derived mesenchymal stem cells; Has, human; Rno, rat.

Figure 3.

miR-128-3p-mRNA regulatory network. Red, upregulated differentially expressed mRNAs; blue, downregulated differentially expressed mRNAs. miRNA, microRNA.

In order to further screen crucial targets for miR-128-3p, the PPI network and function modules were analyzed. A total of 264 DEGs were identified to interact with other genes to form 539 interaction pairs (such as NTRK2-GAB1, GAB1-IRS1, YWHAB-PPP1CC, AXIN1-GYS1 and GYS1-IRS1, which was used for constructing the PPI network. After calculating the topological properties, 26 DEGs (including 6 upregulated: KIT, NTRK2, YWHAB, GAB1, AXIN1 and RUNX1) were found to be shared in the top 40 genes ranking for DC, CC and EC (Table II). In addition, 11 modules were extracted from the PPI network. Among them, only module 4 (RUNX1, KIT, GAB1 and AXIN1; in which RUNX1 may be especially key since it could interact with KIT and AXIN1) and module 7 (YWHAB) included the shared upregulated DEGs identified by topological ranking (Fig. 4; Table III). These findings indicated that these 5 upregulated genes may be particularly crucial targets of miR-128-3p.

Figure 4.

Protein-protein interaction modules including the hub target genes of miR-128-3p. (A) Module 4; (B) module 7. Red, upregulated differentially expressed mRNAs; blue, downregulated differentially expressed mRNAs. miRNA, microRNA.

Table II.

Topological properties of genes in the PPI network.

Table II.

Topological properties of genes in the PPI network.

Expression

GeneDCGeneCCGeneECCommonlogFCFDR
EGFR39EGFR0.068059EGFR0.39794025TGOLN2−1.080
IL632IL60.067039IL60.34596485KIT1.88 2.43×10−209
AR22AR0.066937AR0.23498377PPP1CC−0.640
ABL118IRS10.066785IRS10.2286748FURIN−2.450
PPP1CC18ABL10.066667ABL10.20841703PPP4C−1.000
IRS117MAPK140.066348CXCL120.19866262CANX−0.550
CXCL1216YWHAB0.066265KIT0.18829939EGFR−1.680
KIT14TGFBR10.066033MAPK140.1772947NTRK24.770
PXN14PPP1CC0.065885PXN0.16721927CXCL1−3.060
CANX14PPP2R1B0.065852GAB10.1594914TGFBR1−0.790
MAPK1412PXN0.06577NANOG0.14420108IRS1−0.960
ADCY312PPP4C0.065753CXCL10.14116184PPP2R1B−2.080
ADCY612NANOG0.065737RET0.1360971MAPK14−0.690
TGFBR111CXCL120.065721TGFBR10.12943284ATP2A2−2.000
YWHAB11KIT0.065606CANX0.12310072ABL1−1.990
GNB211CANX0.065557KLF40.12178243YWHAB0.510
CXCL110AXIN10.065557NTRK20.116883084GAB10.53 6.04×10−81
NTRK210YWHAQ0.06546YWHAB0.112461776NANOG−2.66 2.03×10−51
GABBR210OCLN0.065379IL6R0.11212979CXCL12−9.140
PPP2R1B10SMURF10.06525OCLN0.11207541AXIN10.78 4.50×10−27
AXIN110NTRK20.065234GRB100.10549404AR−1.010
SMURF110KLF40.065169PPP1CC0.09967908RET−10.3 6.15×10−99
GAB19CXCL10.065137CXCL20.098889045IL6−1.150
NANOG9ATP2A20.065105TGOLN20.09819438RUNX10.710
OCLN9TGOLN20.065057ATG50.0979064OCLN−10.2 1.76×10−94
PPP4C9GAB10.065009GNB20.093786895PXN−0.970
KMT2A9 DYNC1LI20.064993TIMP30.09199475
GYS19RUNX10.064977ITGA50.09169616
RUVBL29ATG50.064929ITPKC0.08899418
RET8GYS10.064897GABBR20.08424522
CXCL28RDX0.064865RUNX10.08272818
TGOLN28RET0.064865PPP2R1B0.08233988
GABBR18FURIN0.064833ADCY30.08222689
FURIN8ITPKC0.064769ADCY60.08222689
ATP2A28KMT2A0.064753YWHAQ0.082175
DYNC1LI28GRB100.064753PPP4C0.08180887
PYGB8TIMP30.064722AXIN10.080903396
BET1L8SEC61A10.06469FURIN0.07912381
RUNX17PHB0.064674ATP2A20.07898864
CACNB27IL6R0.064643ITIH40.07645497

[i] DC, degree centrality; EC, eigenvector centrality; CC, closeness centrality; PPI, protein-protein interaction; FC, fold change; FDR, false discovery rate.

Table III.

Modules extracted from the PPI network.

Table III.

Modules extracted from the PPI network.

ClusterScore (density × number of nodes)NodesEdgesNode IDs
18828CXCL12, GABBR2, GABBR1, ADCY3, CXCL1, CXCL2, GNB2, ADCY6
25.21126PXN, AR, IL6R, TGFBR1, IL6, EGFR, RET, ABL1, NANOG, OCLN, KLF4
3446TRMT61A, WDR43, RRP8, MAK16
43.5381423GAB1, KIT, PPME1, RUNX1, PYGB, AGL, AXIN1, ITPKC, PPP4C, TIPRL, PPP1R3B, GYS1, IRS1, PFKM
5333STMN2, FAIM2, CNTN2
6333BET1L, SEC22A, STX7
7356YWHAB, PAPD7, PPP2R1B, RUVBL2, PPP1CC
8333FAM160B1, IGSF3, POGLUT1
9333RHOT2, ARHGAP28, DEPDC1B
10333ANO6, ATP11A, CD47
11333SGMS1, SMPD3, UGCG

[i] PPI, protein-protein interaction.

Function enrichment analysis of the genes in the PPI network revealed that 30 KEGG pathways were enriched, including Insulin resistance (PPP1CC and IRS1), Hippo signaling pathway (PPP1CC, YWHAB and AXIN1), Pathways in cancer (RUNX1, AXIN1 and KIT), PI3K-Akt signaling pathway (YWHAB, KIT and NTRK2), Tight junction (RUNX1), Proteoglycans in cancer (GAB1) and Rap1 signaling pathway (KIT) (Table IV).

Table IV.

KEGG pathways enriched for the genes in the PPI network.

Table IV.

KEGG pathways enriched for the genes in the PPI network.

TermP-valueGenes
Insulin resistance 4.22×10−3PPP1CC, PYGB, GYS1, SLC27A1, PRKAB2, IL6, IRS1, PPP1R3B, CREB5
Vasopressin-regulated water reabsorption 3.64×10−3DYNC2LI1, DYNC2H1, DYNC1LI2, ADCY3, ADCY6, CREB5
Adrenergic signaling in cardiomyocytes 2.48×10−3PPP1CC, CACNB2, PPP2R1B, TPM3, ATP2A2, ADCY3, SCN5A, MAPK14, ADCY6, CREB5
Hippo signaling pathway 4.32×10−3MOB1B, PPP1CC, PARD6B, RASSF2, PPP2R1B, YWHAQ, YWHAB, ID2, AXIN1, TGFBR1
TNF signaling pathway 6.73×10−3IL6, TRAF3, DAB2IP, MAP3K8, CXCL1, MAPK14, CXCL2, CREB5
Morphine addiction 1.07×10−2GABBR2, GABBR1, GNB2, PDE3B, ADCY3, PDE8B, ADCY6
Pathways in cancer 1.18×10−2RET, ARNT2, TPM3, AXIN1, ADCY3, ADCY6, EGFR, TGFBR1, RUNX1, AR, IL6, CXCL12, TRAF3, GNB2, KIT, ABL1, IL6R, IFNAR1
PI3K-Akt signaling pathway 1.10×10−2NTRK2, IRS1, YWHAB, EGFR, GYS1, IL6, PPP2R1B, YWHAQ, GNB2, KIT, ITGA5, IL6R, IFNAR1, CREB5
Tight junction 1.55×10−2CLDN22, PRKAB2, OCLN, PARD6B, PPP2R1B, RDX, ARHGEF18, RAPGEF2, RUNX1
Human cytomegalovirus infection 2.69×10−2IL6, CXCL12, GNB2, PXN, ADCY3, MAPK14, IL6R, ADCY6, EGFR, CREB5
Hypertrophic cardiomyopathy 2.61×10−2CACNB2, PRKAB2, IL6, TPM3, ATP2A2, ITGA5
Salmonella infection 2.55×10−2DYNC2H1, DYNC1LI2, IL6, CXCL1, MAPK14, CXCL2
Hepatitis C 2.61×10−2CLDN22, OCLN, PPP2R1B, YWHAQ, YWHAB, TRAF3, EGFR, IFNAR1
AMPK signaling pathway 2.43×10−2GYS1, PRKAB2, PPP2R1B, IRS1, MLYCD, PFKM, CREB5
Dilated cardiomyopathy2.73× 10−2CACNB2, TPM3, ATP2A2, ADCY3, ITGA5, ADCY6
mRNA surveillance pathway 2.56×10−2PPP1CC, UPF1, NXF1, RNGTT, PPP2R1B, NXT2
Oocyte meiosis 2.54×10−2PPP1CC, AR, PPP2R1B, YWHAQ, YWHAB, ADCY3, ADCY6
Proteoglycans in cancer 2.55×10−2PPP1CC, RDX, PXN, GAB1, TIMP3, NANOG, ITGA5, MAPK14, EGFR
Hepatitis B 2.46×10−2IL6, YWHAQ, YWHAB, TRAF3, MAPK14, TGFBR1, IFNAR1, CREB5
Central carbon metabolism in cancer 2.62×10−2RET, SLC7A5, KIT, PFKM, EGFR
cGMP-PKG signaling pathway 2.50×10−2PPP1CC, IRS1, PDE3B, PPIF, ATP2A2, ADCY3, ADCY6, CREB5
Relaxin signaling pathway 2.46×10−2GNB2, ADCY3, MAPK14, TGFBR1, EGFR, ADCY6, CREB5
Rap1 signaling pathway 2.36×10−2PARD6B, ADORA2B, KIT, RAPGEF2, ADCY3, MAPK14, SIPA1L3, ADCY6, EGFR
FoxO signaling pathway 2.46×10−2PRKAB2, IL6, IRS1, PLK2, MAPK14, TGFBR1, EGFR
Insulin signaling pathway 2.91×10−2PPP1CC, PYGB, GYS1, PRKAB2, IRS1, PPP1R3B, PDE3B
Longevity regulating pathway 2.82×10−2PRKAB2, IRS1, ADCY3, ADCY6, ATG5, CREB5
Glucagon signaling pathway 2.86×10−2PYGB, GYS1, PRKAB2, PPP4C, PDE3B, CREB5
Thyroid hormone synthesis 3.31×10−2CANX, GPX8, ADCY3, ADCY6, CREB5
Phagosome 4.47×10−2DYNC2H1, SEC61A1, DYNC1LI2, STX7, CANX, ITGA5, TUBB4B
Cushing syndrome 4.80×10−2KMT2A, AXIN1, ADCY3, PDE8B, EGFR, ADCY6, CREB5

[i] KEGG, Kyoto Encyclopedia of Genes and Genomes; PPI, protein-protein interaction; TNF, tumor necrosis factor; AMPK 5′ AMP-activated protein kinase; cGMP, cyclic GMP; PKG, protein kinase G; Rap1, Ras-proximate-1; FOX, forkhead box.

Validation of the function on the osteoblast differentiation of miR-128-3p and the expression of target genes

To confirm the differential characteristics of miR-128-3p and their target genes during the osteoblast differentiation, RT-qPCR was performed. As anticipated, the results demonstrated that osteogenic induction can lead to a reduction in the expression of miR-128-3p and an increase in the expression of its potential target genes (KIT, NTRK2, YWHAB, GAB1, AXIN1 and RUNX1; Fig. 5A).

Figure 5.

Validation experiments. (A) The expression of miR-128-3p and its target genes in BM MSCs before and after osteoblast differentiation, as determined by RT-qPCR. (B) After transfection of miR-128-3p into rat BM MSCs for 48 h, the expression of miR-128-3p was detected. (C) The effects of miR-128-3p overexpression on the viability of BM MSCs, as evaluated by Cell Counting Kit-8 assay. (D) The effects of miR-128-3p overexpression on osteoblast differentiation, as determined by Alizarin red staining (magnification, ×100). (E) The effects of miR-128-3p overexpression on the expression of its target genes, as assessed via RT-qPCR. *P<0.05 vs. before differentiation or miR-normal control (miR-NC). #P<0.05 vs. 15 pmol miR-128-3p mimics. &P<0.05 vs. 30 pmol miR-128-3p mimics. $P<0.05 vs. 40 pmol miR-128-3p mimics. miRNA, microRNA; RT-qPCR, reverse transcription- quantitative PCR; BM MSCs, bone marrow derived mesenchymal stem cells; miR NC, miR normal control.

To further validate the regulatory relationship between miR-128-3p and its target genes, miR-128-3p mimic transfection experiments were carried out. After transfection of miR-128-3p into rat BM-MSCs for 48 h, the expression of miR-128-3p (Fig. 5B) and the cell proliferation (Fig. 5C) of BM-MSCs were revealed to be the highest in the group with the treatment concentration of 50 pmol, indicating the successful overexpression of miR-128-3p. Thus, this concentration was used to investigate the influence of miR-128-3p overexpression on the osteoblast differentiation of BM-MSCs. In line with the sequencing data analysis results and our previous study on human BM-MSCs (11), overexpression of miR-128-3p clearly decreased calcium deposition (Fig. 5D) and significantly weakened the expression levels of osteogenic specific markers Runx2 (22) and bone γ-carboxyglutamate protein (BGLAP) (23) (Fig. 5E), further suggesting its inhibitory effects on the osteoblast differentiation. Notably, the expression levels of 6 target genes as aforementioned were significantly decreased in the miR-128-3p-mimics group compared with the miR-NC group (Fig. 5E).

Discussion

The present study, using an integrated analysis of miRNA and mRNA sequencing datasets and in vitro verification, revealed that miR-128-3p may inhibit the osteoblast differentiation of BM-MSCs by targeted downregulation of RUNX1, NTRK2 and YWHAB. Subsequently, these target genes may respectively regulate the expression of downstream AXIN1, KIT, GAB1 and PPP1CC to mediate Insulin resistance, Hippo, PI3K-Akt and Rap1 signaling pathways.

There is evidence that RUNX1 plays an important role in mediating the osteogenic differentiation of stem cells and this was associated with miR-128 (24). For example, Luo et al (25) revealed that knockdown of RUNX1 in murine BM-MSCs significantly inhibited osteogenesis (as evaluated by lower ALP activity and reduced calcium nodule formation) and decreased the expression levels of osteogenic-related genes (RUNX2, OCN and OPN) compared with control cells. Ji et al (26) also reported that overexpression of RUNX1 enhanced bone morphogenetic protein 9-induced osteogenic differentiation of murine mesenchymal stem cell line (C3H10T1/2), whereas inhibitory effects were observed after knockdown of RUNX1. Saito et al (27) demonstrated that RUNX1 was a downstream effector of Nanog to promote the osteogenic differentiation of C3H10T1/2. In accordance with these studies, the present study also screened RUNX1 as an upregulated gene in differentiated BM-MSCs and its expression was decreased after miR-128 mimic treatment. Further mechanism studies indicated that RUNX1 may exert its promoting roles in osteogenic differentiation by activating the canonical Wnt signaling pathway (including upregulation of β-catenin, Lef1, Tcf1 and Wnt10b) (25). AXIN1 was previously considered as a negative regulator of the canonical Wnt/β-catenin signaling pathway via degradation of β-catenin with adenomatous polyposis coli (APC), glycogen synthase kinase-3β (GSK-3β) and Casein kinase 1 (28). Thus, theoretically, upregulated RUNX1 may lead to the downregulation of AXIN1 in the osteogenic differentiation of BM-MSCs (29,30). However, the results of the present study revealed that the expression of AXIN1 was higher in differentiated compared with undifferentiated BM-MSCs. These controversial findings may be associated with the dual roles of AXIN1 similar to the reports of its homologous gene AXIN2 in cancers (31). Furthermore, the study of Chimge et al (32) reported that silencing of RUNX1 resulted in the downregulation of AXIN1, indicating their synergetic expression trend, which appears to be in agreement with the results of the present study. The present study predicted that RUNX1-AXIN1 may downregulate GYS1 and then IRS1 to participate in the osteogenic differentiation. This hypothesis can be indirectly demonstrated by the fact that overexpression of GSK-3β (an AXIN1 complex component) decreased the mRNA expression level of GYS1 (33), while pharmacological inhibition of GSK-3 induced the formation of glycogen bodies (34). Also, an increase in the IRS-1 protein level was revealed to inhibit the osteoblastic differentiation of MSCs (35). In addition, insulin-deficiency may trigger the lower expression of its downstream signaling molecule insulin receptor substrate 1, which is reported to increase the activity of glutaminase (36) and then stimulate osteoblast differentiation from stem cells (37). Accordingly, the miR-128-RUNX1-AXIN1-GYS1-IRS1 axis may be a credible mechanism to explain the osteoblast differentiation processes. In addition to AXIN1, RUNX1 was also observed to interact with KIT/GAB1 to influence the osteogenic differentiation. KIT is a type 3 transmembrane receptor for stem cell factor (SCF) (38). Activation of the SCF-c-KIT signaling pathway has been revealed to promote the recruitment of stem cells and osteogenesis, which establishes a favorable environment for bone healing and remodeling (38). As an adaptor protein of KIT, GAB1 A complex of α-subunits of the G proteins (Gαi1/3) and Gab1 can mediate the activation of PI3K-Akt signaling (39), which is suggested to be related with enhanced osteogenesis of MSCs (40).

NTRK2, also known as TRKB, can bind with the TrkB receptor to phosphorylate the downstream Erk1/2, which promotes the expression of transcription factors, such as Runx2 and Osterix that are associated with the osteoblast differentiation of BM-MSCs (41). In accordance with these findings, the present study also revealed that NTRK2 was upregulated in differentiated BM-MSCs and downregulated after miR-128-mimic transfection, indicating that miR-128-NTRK2 may represent a crucial mechanism for the osteoblast differentiation of BM-MSCs. In addition, the present study also hypothesized that NTRK2 may interact with GAB1 to become involved in osteogenesis of MSCs.

No studies, to the best of the authors' knowledge, have investigated the roles of YWHAB in the osteogenic differentiation and the regulatory relationship between YWHAB and miR-128, implying that miR-128-YWHAB interaction may be a novel mechanism for explaining the osteogenic differentiation process of BM-MSCs. The present study predicted PPP1CC may be one of the downstream targets of YWHAB. PPP1CC is a member of the serine/threonine protein phosphatase families. A previous study revealed that a reduction in PP2A promoted the bone formation and the osteoblast differentiation of MSCs through the regulation of bone-related transcription factors such as Osterix (42). Mice deficient in PP5 phosphatase were observed to have increased osteoblast numbers and high bone formation, which is associated with a substantial increase in osteoblast differentiation of MSCs (43). Similar to other members, downregulated PPP1CC by miR-128-YWHAB may also contribute to the osteoblast differentiation.

However, there were some limitations to the present study. First, the target genes of miR-128-3p and their possible interactive downstream genes were predicted, however, the connection between them and their associations with the proliferation and osteoblast differentiation of BM-MSCs still requires additional wet experiments (luciferase reporter assay, co-immunoprecipitation, co-overexpression or co-knockdown) to verify the conclusions. Second, the expression levels and functions of target genes of miR-128-3p should be further tested in human BM-MSCs. Third, in vivo studies should be performed to investigate the differentiation and therapeutic efficiency of BM-MSCs that were transfected with miR-128-3p inhibitors or target genes of miR-128-3p. Fourth, the sample size of our included sequencing datasets was small and thus, it may also be necessary to launch a high-throughput analysis with a larger sample size in order to identify more underlying targets for the osteoblast differentiation of BM-MSCs.

The findings of the present study indicated that miR-128-3p may inhibit the osteoblast differentiation of BM-MSCs by targeted downregulation of RUNX1, YWHAB and NTRK2.

Acknowledgements

Not applicable.

Funding

The present study was sponsored by the Interdisciplinary Program of Shanghai Jiao Tong University (Shanghai, China; grant no. YG2017QN21).

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

WZ, YZ and CC contributed to the conception and design of this study. WZ and YZ performed the experiments. WZ, YZ, JC and JW performed the statistical analyses. CY was involved in the interpretation of the data. WZ and YZ drafted the manuscript. CC edited and revised the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Confalonieri D, Schwab A, Walles H and Ehlicke F: Advanced therapy medicinal products: A guide for bone marrow-derived MSC application in bone and cartilage tissue engineering. Tissue Eng Part B Rev. 24:155–169. 2018. View Article : Google Scholar : PubMed/NCBI

2 

Gopal K, Amirhamed HA and Kamarul T: Advances of human bone marrow-derived mesenchymal stem cells in the treatment of cartilage defects: A systematic review. Exp Biol Med (Maywood). 239:663–669. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Guntur AR and Rosen CJ: The skeleton: A multi-functional complex organ. New insights into osteoblasts and their role in bone formation: The central role of PI3Kinase. J Endocrinol. 211:123–130. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Shin YS, Yoon JR, Kim HS and Lee SH: Intra-articular injection of bone marrow-derived mesenchymal stem cells leading to better clinical outcomes without difference in MRI outcomes from baseline in patients with knee osteoarthritis. Knee Surg Relat Res. 30:206–214. 2018. View Article : Google Scholar : PubMed/NCBI

5 

Zhang Y, Liu Y, Wu M, Wang H, Wu L, Xu B, Zhou W, Fan X, Shao J and Yang T: MicroRNA-664a-5p promotes osteogenic differentiation of human bone marrow-derived mesenchymal stem cells by directly downregulating HMGA2. Biochem Biophys Res Commun. 521:9–14. 2020. View Article : Google Scholar : PubMed/NCBI

6 

Ge JB, Lin JT, Hong HY, Sun YJ, Li Y and Zhang CM: MiR-374b promotes osteogenic differentiation of MSCs by degrading PTEN and promoting fracture healing. Eur Rev Med Pharmacol Sci. 22:3303–3310. 2018.PubMed/NCBI

7 

Huang J, Meng Y, Liu Y, Chen Y, Yang H, Chen D, Shi J and Guo Y: MicroRNA-320a regulates the osteogenic differentiation of human bone marrow-derived mesenchymal stem cells by targeting HOXA10. Cell Physiol Biochem. 38:40–48. 2016. View Article : Google Scholar : PubMed/NCBI

8 

Tu XM, Gu YL and Ren GQ: miR-125a-3p targetedly regulates GIT1 expression to inhibit osteoblastic proliferation and differentiation. Exp Ther Med 2016. 12:4099–4106. 2016. View Article : Google Scholar

9 

Wang H, Xie Z, Hou T, Li Z, Huang K, Gong J, Zhou W, Tang K, Xu J and Dong S: MiR-125b regulates the osteogenic differentiation of human mesenchymal stem cells by targeting BMPR1b. Cell Physiol Biochem. 41:530–542. 2017. View Article : Google Scholar : PubMed/NCBI

10 

Zhang S, Liu Y, Zheng Z, Zeng X, Liu D, Wang C and Ting K: MicroRNA-223 suppresses osteoblast differentiation by inhibiting DHRS3. Cell Physiol Biochem. 47:667–679. 2018. View Article : Google Scholar : PubMed/NCBI

11 

Zhang W, Yao C, Wei Z and Dong Q: miR-128 promoted adipogenic differentiation and inhibited osteogenic differentiation of human mesenchymal stem cells by suppression of VEGF pathway. J Recept Signal Transduct Res. 37:217–223. 2017. View Article : Google Scholar : PubMed/NCBI

12 

Chang CC, Venø MT, Chen L, Ditzel N, Le D, Dillschneider P, Kassem M and Kjems J: Global microrna profiling in human bone marrow skeletal-stromal or mesenchymal-stem cells identified candidates for bone regeneration. Mol Ther. 26:593–605. 2017. View Article : Google Scholar : PubMed/NCBI

13 

Sun Y, Cai M, Zhong J, Yang L, Xiao J, Jin F, Xue H, Liu X, Liu H, Zhang Y, et al: The long noncoding RNA lnc-ob1 facilitates bone formation by upregulating Osterix in osteoblasts. Nat Metab. 1:485–496. 2019. View Article : Google Scholar : PubMed/NCBI

14 

Love MI, Huber W and Anders S: Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15:5502014. View Article : Google Scholar : PubMed/NCBI

15 

R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing; Vienna, Austria: 2012, simplehttp://www.R-project.org/

16 

Dweep H and Gretz N: miRWalk2.0: A comprehensive atlas of microRNA-target interactions. Nat Methods. 12:697. 2015. View Article : Google Scholar : PubMed/NCBI

17 

Kohl M, Wiese S and Warscheid B: Cytoscape: Software for visualization and analysis of biological networks. Methods Mol Biol. 696:291–303. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Szklarczyk D, Franceschini A, Wyder S, Forslund K, Heller D, Huerta-Cepas J, Simonovic M, Roth A, Santos A, Tsafou KP, et al: STRING v10: Protein-protein interaction networks, integrated over the tree of life. Nucleic Acids Res. 43((Database Issue)): D447–D452. 2015. View Article : Google Scholar : PubMed/NCBI

19 

Tang Y, Li M, Wang J, Pan Y and Wu FX: CytoNCA: A cytoscape plugin for centrality analysis and evaluation of protein interaction networks. Biosystems. 127:67–72. 2015. View Article : Google Scholar : PubMed/NCBI

20 

Kuleshov MV, Jones MR, Rouillard AD, Fernandez NF, Duan Q, Wang Z, Koplev S, Jenkins SL, Jagodnik KM, Lachmann A, et al: Enrichr: A comprehensive gene set enrichment analysis web server 2016 update. Nucleic Acids Res. 44:W90–W97. 2016. View Article : Google Scholar : PubMed/NCBI

21 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

22 

Zou W, Greenblatt MB, Brady N, Lotinun S, Zhai B, de Rivera H, Singh A, Sun J, Gygi SP, Baron R, et al: The microtubule-associated protein DCAMKL1 regulates osteoblast function via repression of Runx2. J Exp Med. 210:1793–1806. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Matta C, Szűcs-Somogyi C, Kon E, Robinson D, Neufeld T, Altschuler N, Berta A, Hangody L, Veréb Z and Zákány R: Osteogenic differentiation of human bone marrow-derived mesenchymal stem cells is enhanced by an aragonite scaffold. Differentiation. 107:24–34. 2019. View Article : Google Scholar : PubMed/NCBI

24 

Motohashi N, Alexander MS, Casar JC and Kunkel LM: Identification of a novel microRNA that regulates the proliferation and differentiation in muscle side population cells. Stem Cells Dev. 21:3031–3043. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Luo Y, Zhang Y, Miao G, Zhang Y, Liu Y and Huang Y: Runx1 regulates osteogenic differentiation of BMSCs by inhibiting adipogenesis through Wnt/β-catenin pathway. Arch Oral Biol. 97:176–184. 2019. View Article : Google Scholar : PubMed/NCBI

26 

Ji C, Xiaohua L, Li X, Tingting Y, Chaoqun D and Jinyong L: RUNX1 plays an important role in mediating BMP9-Induced osteogenic differentiation of mesenchymal stem cells line C3H10T1/2, murine multi-lineage cells lines C2C12 and MEFs. Int J Mol Sci. 18:13482017. View Article : Google Scholar

27 

Saito T, Ohba S, Yano F, Seto I, Yonehara Y, Takato T and Ogasawara T: Runx1 and Runx3 are downstream effectors of nanog in promoting osteogenic differentiation of the mouse mesenchymal cell line C3H10T1/2. Cell Reprogram. 17:227–234. 2015. View Article : Google Scholar : PubMed/NCBI

28 

Nakamura T, Hamada F, Ishidate T, Anai K, Kawahara K, Toyoshima K and Akiyama T: Axin, an inhibitor of the Wnt signalling pathway, interacts with beta-catenin, GSK-3beta and APC and reduces the beta-catenin level. Genes Cells. 3:395–403. 1998. View Article : Google Scholar : PubMed/NCBI

29 

Figeac N and Zammit PS: Coordinated action of Axin1 and Axin2 suppresses β-catenin to regulate muscle stem cell function. Cell Signal. 27:1652–1665. 2015. View Article : Google Scholar : PubMed/NCBI

30 

Gwak J, Hwang SG, Park HS, Choi SR, Park SH, Kim H, Ha NC, Bae SJ, Han JK, Kim DE, et al: Small molecule-based disruption of the Axin/β-catenin protein complex regulates mesenchymal stem cell differentiation. Cell Res. 22:237–247. 2012. View Article : Google Scholar : PubMed/NCBI

31 

Wu ZQ, Brabletz T, Fearon E, Willis AL, Hu CY, Li XY and Weiss SJ: Canonical Wnt suppressor, Axin2, promotes colon carcinoma oncogenic activity. Proc Natl Acad Sci USA. 109:11312–11317. 2012. View Article : Google Scholar : PubMed/NCBI

32 

Chimge NO, Little GH, Baniwal SK, Adisetiyo H, Xie Y, Zhang T, O'Laughlin A, Liu ZY, Ulrich P, Martin A, et al: RUNX1 prevents oestrogen-mediated AXIN1 suppression and β-catenin activation in ER-positive breast cancer. Nat Commun. 7:107512016. View Article : Google Scholar : PubMed/NCBI

33 

Wang Y, Wang Y, Zhong T, Guo J, Li L, Zhang H and Wang L: Transcriptional regulation of pig GYS1 gene by glycogen synthase kinase 3β (GSK3β). Mol Cell Biochem. 424:203–208. 2017. View Article : Google Scholar : PubMed/NCBI

34 

Chen RJ, Zhang G, Garfield SH, Shi YJ, Chen KG, Robey PG and Leapman RD: Variations in glycogen synthesis in human pluripotent stem cells with altered pluripotent states. PLoS One. 10:e01425542015. View Article : Google Scholar : PubMed/NCBI

35 

Contaldo C, Myers TJ, Zucchini C, Manara MC, Chiodoni C, Colombo MP, Nicoletti G, Lollini PL, Li T, Longobardi L, et al: Expression levels of insulin receptor substrate-1 modulate the osteoblastic differentiation of mesenchymal stem cells and osteosarcoma cells. Growth Factors. 32:41–52. 2014. View Article : Google Scholar : PubMed/NCBI

36 

Ardawi MS: The maximal activity of phosphate-dependent glutaminase and glutamine metabolism in the colon and the small intestine of streptozotocin-diabetic rats. Diabetologia. 30:109–114. 1987.PubMed/NCBI

37 

Yu Y, Newman H, Shen L, Sharma D, Hu G, Mirando AJ, Zhang H, Knudsen E, Zhang GF, Hilton MJ and Karner CM: Glutamine metabolism regulates proliferation and lineage allocation in skeletal stem cells. Cell Metab. 29:966–978.e4. 2019. View Article : Google Scholar : PubMed/NCBI

38 

Matsumoto T, Ii M, Nishimura H, Shoji T, Mifune Y, Kawamoto A, Kuroda R, Fukui T, Kawakami Y, Kuroda T, et al: Lnk-dependent axis of SCF-cKit signal for osteogenesis in bone fracture healing. J Exp Med. 207:2207–2223. 2010. View Article : Google Scholar : PubMed/NCBI

39 

Zhang YM, Zhang ZQ, Liu YY, Zhou X, Shi XH, Jiang Q, Fan DL and Cao C: Requirement of Gαi1/3-Gab1 signaling complex for keratinocyte growth factor-induced PI3K-Akt-mTORC1 activation. J Invest Dermatol. 135:181–191. 2015. View Article : Google Scholar : PubMed/NCBI

40 

Liu L, Shao L, Li B, Zong C, Li J, Zheng Q, Tong X, Gao C and Wang J: Extracellular signal-regulated kinase1/2 activated by fluid shear stress promotes osteogenic differentiation of human bone marrow-derived mesenchymal stem cells through novel signaling pathways. Int J Biochem Cell Biol. 43:1591–1601. 2011. View Article : Google Scholar : PubMed/NCBI

41 

Liu Q, Lei L, Yu T, Jiang T and Kang Y: Effect of brain-derived neurotrophic factor on the neurogenesis and osteogenesis in bone engineering. Tissue Eng Part A. 24:1283–1292. 2018. View Article : Google Scholar : PubMed/NCBI

42 

Hirohiko O, Kaya Y, Hiroyuki M, Jumpei T, Kazuhiko O, Tatsuji H and Akihito Y: Role of protein phosphatase 2A in osteoblast differentiation and function. J Clin Med. 6:232017. View Article : Google Scholar

43 

Stechschulte LA, Ge C, Hinds TD, Sanchez ER and Lecka-Czernik B: Protein phosphatase PP5 controls bone mass and the negative effects of rosiglitazone on bone through reciprocal regulation of PPARγ (peroxisome proliferator-activated receptor γ) and RUNX2 (runt-related transcription factor 2). J Biol Chem. 291:24475–24486. 2016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang W, Zhu Y, Chen J, Wang J, Yao C and Chen C: Mechanisms of miR‑128‑3p in inhibiting osteoblast differentiation from bone marrow‑derived mesenchymal stromal cells . Mol Med Rep 22: 5041-5052, 2020.
APA
Zhang, W., Zhu, Y., Chen, J., Wang, J., Yao, C., & Chen, C. (2020). Mechanisms of miR‑128‑3p in inhibiting osteoblast differentiation from bone marrow‑derived mesenchymal stromal cells . Molecular Medicine Reports, 22, 5041-5052. https://doi.org/10.3892/mmr.2020.11600
MLA
Zhang, W., Zhu, Y., Chen, J., Wang, J., Yao, C., Chen, C."Mechanisms of miR‑128‑3p in inhibiting osteoblast differentiation from bone marrow‑derived mesenchymal stromal cells ". Molecular Medicine Reports 22.6 (2020): 5041-5052.
Chicago
Zhang, W., Zhu, Y., Chen, J., Wang, J., Yao, C., Chen, C."Mechanisms of miR‑128‑3p in inhibiting osteoblast differentiation from bone marrow‑derived mesenchymal stromal cells ". Molecular Medicine Reports 22, no. 6 (2020): 5041-5052. https://doi.org/10.3892/mmr.2020.11600
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang W, Zhu Y, Chen J, Wang J, Yao C and Chen C: Mechanisms of miR‑128‑3p in inhibiting osteoblast differentiation from bone marrow‑derived mesenchymal stromal cells . Mol Med Rep 22: 5041-5052, 2020.
APA
Zhang, W., Zhu, Y., Chen, J., Wang, J., Yao, C., & Chen, C. (2020). Mechanisms of miR‑128‑3p in inhibiting osteoblast differentiation from bone marrow‑derived mesenchymal stromal cells . Molecular Medicine Reports, 22, 5041-5052. https://doi.org/10.3892/mmr.2020.11600
MLA
Zhang, W., Zhu, Y., Chen, J., Wang, J., Yao, C., Chen, C."Mechanisms of miR‑128‑3p in inhibiting osteoblast differentiation from bone marrow‑derived mesenchymal stromal cells ". Molecular Medicine Reports 22.6 (2020): 5041-5052.
Chicago
Zhang, W., Zhu, Y., Chen, J., Wang, J., Yao, C., Chen, C."Mechanisms of miR‑128‑3p in inhibiting osteoblast differentiation from bone marrow‑derived mesenchymal stromal cells ". Molecular Medicine Reports 22, no. 6 (2020): 5041-5052. https://doi.org/10.3892/mmr.2020.11600
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team