Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
December-2020 Volume 22 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2020 Volume 22 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Glycogene expression profiles from a HaCaT cell line stably transfected with HPV16 E5 oncogene

  • Authors:
    • Denisse Cisneros-Ramírez
    • Ygnacio Martínez-Laguna
    • Patricia Martínez-Morales
    • Adriana Aguilar-Lemarroy
    • Luis Felipe Jave-Suárez
    • Gerardo Santos-López
    • Julio Reyes-Leyva
    • Verónica Vallejo-Ruiz
  • View Affiliations / Copyright

    Affiliations: Laboratory of Molecular Biology, East Biomedical Research Center, Mexican Institute of Social Security, Metepec 74360, Mexico, Research Center of Microbiological Sciences, Institute of Sciences, Meritorious Autonomous University of Puebla, Puebla 72592, Mexico, Consejo Nacional de Ciencia y Tecnología-Centro de Investigación Biomédica de Oriente, Metepec 74360, Mexico, West Biomedical Research Center, Mexican Institute of Social Security, Guadalajara 44290, Mexico
    Copyright: © Cisneros-Ramírez et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 5444-5453
    |
    Published online on: October 23, 2020
       https://doi.org/10.3892/mmr.2020.11630
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The altered expression of glycan antigens has been reported during cervix transformation, demonstrating increased mRNA levels of certain glycogenes. Human papillomavirus (HPV) is the aetiological agent of cervical cancer. High risk HPV E5 is considered an oncogene and has been implicated in cell transformation. E6 and E7 HPV oncoproteins modify the expression of certain glycogenes. The role of the E5 HPV protein in glycogene expression changes has not yet been reported. The aim of the present study was to determine the effects of HPV16 E5 oncoprotein on glycogene expression. For these, a microarray assay was performed using the HaCaT cell line and altered glycogenes were identified. The mRNA levels of certain glycogenes were determined via reverse transcription‑quantitative PCR (RT‑qPCR). Using in silico analysis, the present study identified that glycosylation pathways were altered by E5. Microarray analysis revealed alterations in certain glycogenes, including the upregulation of ST6GAL1, ST3GAL3, CHST2 and MANBA, and the downregulation of UGT2B15, GALNT11, NDST2 and UGT1A10. Increased mRNA levels were confirmed via RT‑qPCR for sialyltransferases genes. Additionally, in silico analysis was performed to identify glycosylation networks altered in the presence of the E5 oncoprotein. The analysis revealed that E5 could modify glycan sialylation, the N‑glycosylation pathway, keratan sulfate and glycosaminoglycan synthesis. To the best of our knowledge, the current study was the first to determine the role of the HPV16 E5 oncoprotein in glycogene expression changes. The results indicated that increased sialyltransferase mRNA levels reported in pre‑malignant and malignant cervical tissues could be the result of E5 oncoprotein expression. The results provide a possible role of HPV infection on glycosylation changes reported during cervix transformation.

Introduction

Human papillomavirus (HPV) is the aetiological agent of cervical cancer (CC) (1). HPV16 is the most prevalent genotype and is responsible for greater than 50% of CC cases worldwide (2,3). The oncogenic potential of HPV is attributed to the following three viral proteins: E5, E6 and E7. E6 and E7, the best characterized viral proteins, promote cell transformation by several mechanisms; for example, they destabilize and induce the degradation of the tumour suppressor proteins p53 and pRB, respectively (4). Meanwhile, E5, a transmembrane protein present in the Golgi apparatus, endoplasmic reticulum and nuclear envelope (5), has several roles in cell transformation. For example, E5 can force cells through the cell cycle and promote the evasion of the immune response (6). Additionally, E5 can modify gene expression; HPV16 E5 induces the expression of prostaglandin E2 receptor by stimulating the binding of the cAMP-response element binding protein (CREB) to its promoter, which activates mitogenic activated protein kinase (MAPK) and increases C-FOS and C-JUN transcription (7,8). Moreover, E5 increases the expression of genes related to cell adhesion, cell motility, and mitogenic signalling, suggesting that the protein plays an important role in the events associated with cellular transformation (9).

Altered glycosylation is another characteristic of cancer cells (10), and it can be caused by the altered expression of different glycosyltransferases that can lead to changes in glycan structures. Increased mRNA levels of some sialyltransferases have been reported in different cancer types (11). Specifically, CC and premalignant lesions display increased mRNA levels of the sialyltransferases ST3GAL3 and ST6GAL1 (12,13), which are related to increased expression of sialic acid (14,15) and of sialylated antigens such as sTn and sLe(x) (16–18). Studies in the HeLa cell line show that E6/E7 HPV18 oncogene knockdown modified glycogene expression, some of which participate in the synthesis of O-glycans such as sTn (19). These results suggest that viral infection could modify glycogene expression and the glycosylation of the cervical epithelium.

The objective of this work was to identify glycogenes that displayed modified expression patterns in the presence of the HPV16 E5 oncoprotein. The results showed that the HPV16 E5 oncoprotein could increase the expression of the sialyltransferases ST3GAL3 and ST6GAL1, which have been reported to be altered in premalignant and malignant cervical tissues. The network interaction constructed with the altered glycogenes in the presence of E5 showed that not only the glycan sialylation but also some glycan structures, such keratan sulphate and glycosaminoglycans, could also be altered.

Materials and methods

Cell culture

The HaCaT cell line from human skin keratinocytes stably transfected with the HPV16 E5 oncogene (HaCaT-E5) (20) or the vector pMSG (HaCaT-pMSG) (kindly donated by Dr. A. Alonso from German Cancer Research Centre, University of Heidelberg, Germany) was cultured and maintained in Dulbecco's modified Eagle's medium (DMEM) containing Earle's salts and L-glutamine (DMEM; Sigma-Aldrich; Merck KGaA) and supplemented with 10% foetal bovine serum (Biowest), 100 µg/ml streptomycin (Sigma-Aldrich; Merck KGaA). The CasKi cell line from a squamous CC (kindly donated by Dr A. Aguilar-Lemarroy from Centro de Investigación Biomédica de Occidente, IMSS) was cultured and maintained in RPMI-1640 medium (Sigma-Aldrich; Merck KGaA) containing L-glutamine and supplemented with 10% foetal bovine serum, and 100 µg/ml streptomycin (Sigma-Aldrich; Merck KGaA). Cells were maintained at 37°C with an atmosphere of 5% CO2. The culture medium was replaced every two days. Sub-confluent cells were harvested using a mixture of trypsin (0.025%) and EDTA (0.02%; Sigma-Aldrich; Merck KGaA) and were washed with phosphate-buffered saline.

Microarray expression assay

The microarray expression assay was performed at the Cellular Physiology Institute of UNAM. The microarray contained 10,000 gene-specific oligonucleotide probes representing the best-annotated genes from human. For the probe preparation, total RNA from HaCaT/E5 and HaCaT/pGSM monocultures was obtained with the ReliaPrep™ RNA Cell Miniprep System (Promega Corporation) and 10 µg of each RNA was used for cDNA synthesis incorporating dUTP-Alexa555 or dUTP-Alexa647 and employing the First-Strand cDNA labelling kit (Invitrogen; Thermo Fisher Scientific, Inc.). Acquisition and quantification of the array images were performed in GenePix 4100A with its accompanying software GenePix from Molecular Devices. Microarray data analysis was performed with the free software GenArise developed at the Computing Unit of Cellular Physiology Institute of UNAM (http://www.ifc.unam.mx/genarise/). The software identifies differentially expressed genes by calculating an intensity-dependent z-score. The elements with a z-score >2 standard deviations would be the significantly differentially expressed genes. The analysed data were submitted to the NCBI Gene Expression Omnibus (access no. GSE118776).

Expression analysis of E5 and glycogenes

Total RNA from CasKi, HaCaT-E5 and HaCaT-pMSG monocultures was obtained with the NucleoSpin II RNA kit (Macherey-Nagel).

To determine the amplification efficiencies of E5, ST3GAL3 and ST6GAL1, standard curves were performed with the following RNA concentrations: 10, 1, 0.1, 0.01, and 0.001 ng/µl. HPRT was used as an endogenous gene. Based on these curves we determined the better concentration to perform the relative quantification assays, considering that these genes have different expression levels. cDNA was synthesized using random primers and the RevertAid First-Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.). qPCR reactions were performed in a final volume of 10 µl with the following components: 5 µl of 2X Maxima SYBR-Green/Rox qPCR Master Mix (Thermo Fisher Scientific, Inc.) and 0.5 µl of 10 mM forward and reverse primers (Table I). The reactions were performed with a StepOne Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.), and the cycling conditions were as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 30 sec, an annealing temperature for 30 sec, and 70°C for 30 sec. For HPV16 E5, the Tms for HPV16 E5, ST3GAL3 and ST6GAL1 were 55°C, 57°C and 60°C, respectively.

Table I.

Sequences of the oligonucleotides used in the reverse transcription-quantitative PCR assays.

Table I.

Sequences of the oligonucleotides used in the reverse transcription-quantitative PCR assays.

PrimerForward (5–3)Reverse (5–3)Length (bp) Product
HPRT CCTGGCGTCGTGATTAGTGATGAT CGAGCAAGACGTTCAGTCCTGTC150
HPV16 E5 CGCTGCTTTTGTCTGTGTCT GCGTGCATGTGTATGTATTAAAAA146
ST3GAL3 CATGTGAAGATGGGACTCTTGG CCTCCCACTGGAGTAAGTGTAG118
ST6GAL1 TATCGTAAGCTGCACCCCAATC TTAGCAGTGAATGGTCCGGAAG372

[i] HPRT, hypoxanthine-guanine phosphoribosyltransferase; HPV, human papilloma virus; ST3GAL3, ST3 β-galactoside α-2,3-sialyltransferase 3; ST6GAL1, β-galactoside α-2,6-sialyltransferase 1; bp, base pair.

Relative quantification was performed using the comparative CT method as follows: 2−ΔΔCT. The qPCR reaction was performed on a StepOne Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). The final 10 µl reaction volume included 1 µl of cDNA template (E5 VPH16-0.5 ng/µl; ST3GAL3−10 ng/µl, or ST6GAL1−3 ng/µl), 5 µl of 2X Maxima SYBR-Green/Rox qPCR Master Mix (Thermo Fisher Scientific, Inc.), 0.5 µl of forward and reverse primers (0.5 µM final concentration) and 3 µl of RNase free water. qPCR was performed under with following conditions: 95°C 10 min, followed 40 cycles of 95°C for 30 sec, the annealing temperature for 30 sec (60°C for ST6GAL1 and 57°C for ST3GAL3) and 70°C for 30 sec. The gene transcript levels were analysed and normalised to HPRT expression.

Identification of glycogenes

For the analysis of the glycogenes in the microarray displaying altered expression, we considered 336 glycogenes reported to date using the GlycoGene database (http://riodb.ibase.aist.go.jp/rcmg/ggdb/), the Consortium for Functional Glycomics-CAZy database (http://www.cazy.org/CAZY/) and the published reports on glycogenes not included in the databases, including DPY19L1 (21) and MANBAL (22). We identified glycogenes displaying altered expression in the microarray as those with a z-score >2.

Protein-protein interaction network

The downregulated or upregulated set of glycogenes in the HaCaT-E5 cells were submitted separately, to the STRING database (http://string-db.org/). The following parameter were applied for the analysis: text mining, experiments, databases, co-expression, neighbourhood, gene fusion and co-occurrence as interaction sources, no more than 5 interactor, minimum interaction score of 0.9 as confidence level, and a protein-protein enrichment P-value at least ≤0.05 and FDR at least <0.05.

Statistical analysis

Statistical analysis of the qPCR results was performed using the GraphPad program. The Students t-test was performed. A P-value <0.05 was considered statistically significant.

Results

E5 oncogene expression by RT-qPCR

RT-qPCR was performed to quantify E5 mRNA expression levels from HaCaT-E5 cells, as a positive control it was used mRNA of CasKi cells (a cell line that contains HPV16-integrated genomes and expresses E5) and as a negative control was used mRNA of HaCaT-pMSG. Fig. 1 shows the relative expression of E5, showing that E5 expression is greater in HaCaT-E5 than in CasKi cells.

Figure 1.

Human papillomavirus-16 E5 mRNA expression. E5 mRNA expression was 14.4 times higher in HaCaT-E5 cells compared with CasKi cells. HaCaT-pMSG was used as a negative control. Data are presented as the mean ± SEM (n=3).

Glycogene expression altered by the E5 oncoprotein

From a total of 336 glycogenes reported to date, we searched those altered in the HaCaT-E5 microarray with respect to HaCaT-pGSM. We identified four upregulated glycogenes, including ST3GAL3, CHST2 and MANBA with a z-score >2 and ST6GAL1 with a z-score of 1.8. The latter was included because of its importance in CC. We also identified four downregulated glycogenes, including GALNT11, NDST2, UGT2B15 and UGT1A10 with a z-score <2. The microarray data analysed herein are included in the NCBI Gene Expression Omnibus Database (accession no. GSE118776) and in the article text.

E5 increased the expression of the sialyltransferases ST3GAL3 and ST6GAL1

Because the microarray results showed that the presence of E5 can lead to an increase in sialyltransferases expression, we evaluated the mRNA levels of ST3GAL3 and ST6GAL1 by RT-qPCR in HaCaT-E5 and HaCaT-pMSG cells. ST3GAL3 and ST6GAL1 mRNA levels were increased in HaCaT-E5 cells (Fig. 2).

Figure 2.

Expression levels of sialyltransferases genes. (A) mRNA levels of ST3GAL3 in HaCaT-pMSG and HaCaT-E5 cells determined by RT-qPCR. (B) mRNA levels of ST6GAL1 in HaCaT-pMSG and HaCaT-E5 cells determined by RT-qPCR. The mRNA levels of sialyltransferases genes were increased in presence of E5. Data are presented as the mean ± SD of three independent experiments performed in triplicate assays. *P<0.05 and ***P<0.001. RT-qPCR, reverse transcription-quantitative PCR.

We next analysed literature data for E5-modified glycogenes that also have been previously reported as altered in cancerous tissues [Tables II and III; (11,12,22–45)]. First, we analysed the upregulated genes. As previously described, ST3GAL3 and ST6GAL1 were increased in CC and premalignant lesions; in contrast, CHST2 and MANBA have not been reported in CC, but display altered expression in other cancer types. The results showed that the four glycogenes are aberrantly expressed in several types of cancer and have clinical relevance (Table II).

Table II.

Upregulated glycogenes in HaCaT-E5 cells.

Table II.

Upregulated glycogenes in HaCaT-E5 cells.

Alteration of mRNA/enzyme in cancer

Gene/enzymeEnzyme functionmRNAEnzymeClinical relevance
ST3GAL3/ST3 β-galactoside α2,3-sialyltransferase 3Transfers sialic acid from CMP-sialic acid to the structure Galβ1→3/4GlcNAc- and is involved in the synthesis of sialyl Lewis(a) (NeuAcα2→3Galb1→3 (Fucα1→4) GlcNAc-).Upregulation in cervical cancer (12), breast cancer (23), extrahepatic bile duct carcinoma (24), colorectal carcinoma (25), glioblastoma, renal clear cell carcinoma and lung squamous carcinoma (26). Downregulation in breast invasive carcinoma, colon adenocarcinoma (26) and ovarian cancers (11).High levels of enzyme activity in the tumor tissue correlated with secondary local tumor recurrence in gastric cancer (27).In cervical carcinoma the overexpression of mRNA is associated with lymph node metastases (12). In breast cancer, high expression of mRNA is associated with poor prognosis (23).
ST6GAL1/ST6 β-galactoside α-2,6-sialyltransferase 1Transfers sialic acid from CMP-sialic acid to the Galβ1→4GlcNAc structure on glycoproteins.Upregulation in squamous cell carcinoma (12), breast cancer (23), extrahepatic bile duct carcinoma (24), ovarian cancer (11), and colorectal carcinoma and non-metastasic colorectal tumors (28).Increased enzyme expression in colon tumors (28), ovarian and pancreatic carcinomas (29,30). Increased enzyme activity in gastric and colorectal cancer (27,31).In breast cancer, high expression of mRNA is associated with poor prognosis (23). In pancreatic ductal adenocarcinoma promotes chemoresistance to gemcitabine (32).
CHST2/carbohydrate sulfotransferase 2Sulfotransferase that utilizes 3-phospho-5-adenylyl sulfate as donor to catalyze the transfer of sulfate to position 6 of non-reducing GlcNAc within keratan-like structures on N-glycans and mucin-associated glycans.Upregulation in breast cancer (33), osteosarcoma (34) and esophageal cancer (35). Increased enzyme in uterine cervical and corpus cancer (36).Increased enzyme expression in metastasic osteosarcoma (34).In osteosarcoma, weak protein expression is associated with improved survival (34).
MANBA/β-mannosidaseExoglycosidase that cleaves theUpregulation in dysplastic esophagealNo reportsCandidate for molecular
single β-linked mannose residuetissues and esophageal target for early detection
from the non-reducing end of N-glycoproteins oligosaccharides.squamous cell carcinoma (37). of esophageal cancer (37).

[i] ST3GAL3, ST3 β-galactoside α-2,3-sialyltransferase 3; ST6GAL1, β-galactoside α-2,6-sialyltransferase 1; bp, base pair.

Table III.

Downregulated glycogenes in HaCaT-E5 cells.

Table III.

Downregulated glycogenes in HaCaT-E5 cells.

Alteration of mRNA/enzyme in cancer

Gene/enzymeEnzyme functionmRNAEnzymeClinical relevance
UGT2B15/UDPAn enzyme of the glucuronidationUpregulation in castrationUpregulation of expressionIn gastric cancer, patients
glucuronosyltransferasepathway, involved in the metabolismresistant prostate cancer (38).in gastric cancer (39).with higher UGT2B15 mRNA
family 2 member B15and elimination of toxic compounds.Upregulation in gastricLow level of expression in aggressiveexpression have poor
Serves a role in the regulation of estrogens and androgens.cancer (39).prostate tumors and undetectable expression in prostate cancer with lymph node metastasis (40).prognosis (39).
GALNT11/polypeptideCatalyzes the initiation of proteinUpregulation in chronicNo reports.GALNT11 expression is
N-acetylgalactosaminyltransferase 11O-linked glycosylation andlymphocytic leukemia (41). associated with prognosis
is involved in left/right asymmetry by mediating O-glycosylation of NOTCH1. of chronic lymphocytic leukemia (41).
NDST2/N-deacetylaseEnzyme with dual functions:Moderately upregulatedNo reports.No reports.
and N-sulfotransferase 2Participates in processing glucosaminein hepatocellular cancer (42).
and heparin polymers, includingDecreased levels in II, III
N-deacetylation and N-sulfation.and IV stages of glioma (43).
UGT1A10/UDPAn enzyme of the glucuronidationUpregulated in stomach cancer (44).Downregulated in breastNo reports.
glucuronosyltransferasepathway that transforms smallDownregulated in breast cancer (45).cancer (45).
family 1 member A10lipophilic molecules, such as steroids, bilirubin, hormones and drugs, into water-soluble, excretable metabolites.

[i] ST3GAL3, ST3 β-galactoside α-2,3-sialyltransferase 3; ST6GAL1, β-galactoside α-2,6-sialyltransferase 1; bp, base pair.

We next compared the downregulated glycogenes in HaCaT-E5 cells with those reported in cancerous tissues. The four glycogenes have been reported in cancer. GALNT11 is overexpressed in chronic lymphocytic leukaemia (CLL), and UGT2B15 is downregulated in prostate cancer, but none of the downregulated glycogenes have been previously reported to be altered in CC (Table III).

E5 and glycosylation pathways

To identify possible functional associations among the enzymes identified as altered glycogenes under E5 regulation, we analysed the data with STRING software to generate predicted protein-protein interactions with a higher confidence level (0.9). For the analysis, we considered the altered glycogenes and five additional proteins with the goal of identifying possible glycosylation pathways.

For the upregulated glycogenes (ST3GAL3, CHST2, MANBA and ST6GAL1), the results displayed an interacting network with eight proteins where MANBA did not interact with any protein but participates in N-glycosylation (Fig. 3A). Specifically, we identified the keratan sulfate biosynthesis pathway, which includes CHST2 and ST3GAL3 (Fig. 3B); the N-glycosylation pathway, in which both the sialyltransferase genes are involved in the sialylation of N-glycans (Fig. 3C); and the glycosphingolipid biosynthesis pathway, where ST3GAL3 participates with fucosyltransferases and galactosyltransferases (Fig. 3D).

Figure 3.

Protein-protein interaction network of the upregulated glycogenes. (A) Network of upregulated glycogenes with five additional proteins that interacted with the altered glycogenes. (B) The red network indicates proteins that participate in the keratan sulfate biosynthetic process. (C) The red network indicates the proteins that participate in N-glycosylation. (D) The red network indicates the proteins that participate in glycosphingolipid biosynthesis.

For the downregulated glycogenes (UGT2B15, GALNT11, NDST2 and UGT1A10), the interaction analysis showed two different networks, among which GALNT11 was excluded from the first network and NDST2 establishes a separate network (Fig. 4A). The analysis showed that the latter is involved in glycosaminoglycan biosynthesis (Fig. 4B).

Figure 4.

Protein-protein interaction network of the downregulated glycogenes. (A) Network of downregulated glycogenes including five additional proteins that interacted with the altered glycogenes. (B) The red network indicates proteins that participate in glycosaminoglycan biosynthesis.

Discussion

Aberrant glycosylation is a characteristic of tumour cells. Changes in glycan structures in cancer have been related with altered glycogene expression (46). Increased sialylation is one of the most frequent alterations in cancer (47). Increased activity of sialyltransferases, enzymes that transfer sialic acid to glycoconjugates, has been reported during tumour transformation (11,48). Increased α2,3 and α2,6 sialic acid levels have been reported in premalignant lesions from the cervical epithelium (14). Increased expression of the sialylated antigens sLe(a) and sLe(x) have also been reported in CC and premalignant lesions (17,18). These findings could be the result of enhanced ST3GAL3 and ST6GAL1 (sialyltransferase genes) mRNA levels, which have been previously reported during cervical transformation (12,13). HPV is the aetiological agent of CC, and the HPV genome encodes three oncoproteins, E5, E6 and E7 (4); however, their roles in altering glycogene expression have been poorly investigated. Our research group is interested in the role of HPV infection and its relationship with glycogene expression changes in the cervical epithelium. Our group recently reported that the oncoproteins E6 and E7 from HPV18 modify the expression of some glycogenes, some of which participate in the glycosylation of the Notch receptor and O-glycosylation type mucin (19). However, similar reports focused on the E5 oncoprotein do not exist. E5 is a protein expressed during the early stages of viral infection, and this protein has different targets in the cell that promote cellular transformation (6,49).

With the aim of determining whether E5 modifies the expression of some glycogenes, we performed an expression microarray on the HaCaT cell line stably transfected with the HPV16 E5 oncoprotein. We identified four upregulated glycogenes (CHST2, MANBA, ST3GAL3 and ST6GAL1) and four downregulated glycogenes (UGT2B15, GALNT11, NDST2 and UGT1A10). All these genes have been reported to be altered in cancer either at the transcript or protein level (Tables II and III).

Increased CHST2 mRNA levels have been reported in osteosarcoma and breast and oesophageal cancer (33–35), while increased protein levels have been reported in ovarian cancer and CC (36). With regards to the glycogene MANBA, increased mRNA levels have only been reported in oesophageal cancer (37). Interestingly, of the four upregulated glycogenes, two correspond to the sialyltransferases genes ST3GAL3 and ST6GAL1. ST3GAL3 expression has been reported as altered in different cancer types, such as gastric, bile, colon, kidney, lung, breast, and ovarian cancers and glioblastoma (11,23–27). Increased ST6GAL1 mRNA and protein expression has been reported in gastric and biliary cancers (24,27), colon and colorectal cancers (25,29,31), and ovarian and pancreatic cancers (11,30). Here, we showed that the mRNA levels of the ST6GAL1 and ST3GAL3 genes can be increased by the presence of E5; interestingly, both mRNA levels are increased in premalignant and malignant tissues in the cervical epithelium (12,13). However, whether these phenotypes could be a consequence of HPV infection remains unclear. Additionally, the upregulation of these genes agrees with the increased levels of sialic acid reported for CC and with the increased levels of α2,3 and α2,6 sialic acid in premalignant lesions in the cervix (14). These results suggest that the sialyltransferase expression changes that occur in the early stages of cervical cell transformation could be related to HPV infection and due to E5, but not E6 or E7, activity (19). Nevertheless, this hypothesis requires more investigation. With respect to E5 and sialylation, a previous study found no important changes in the sialylation status of keratinocytes in the presence of HPV16 E5 (50), however, in this study the authors analysed the expression of different monosaccharaides and disaccharides, using a panel of seven lectins, but they did not perfom glycogene expression analysis. Additionally, as they use an inducible vector, they incubated the transfected cells with dexamethasone to increase the expression of E5, so the glycosylation pattern could be influenced by the effect of this molecule, as has been reported in different studies where the dexamethasone increase the sialyltransferases expression (51,52).

Regarding the downregulated genes in the presence of HPV16 E5, GALNT11 has been reported as diminished in breast cancer (33) and increased in chronic lymphocytic leukaemia, and it was proposed to be implicated in O-glycosylation changes in chronic lymphocytic leukaemia (CLL) cells (41). NDST2 has demonstrated increased mRNA levels in hepatocellular cancer (42). It was also interesting to find expression changes in two UGT genes (UGT2B15 and UGT1A10) that encode uridine 5′-diphospho-glucuronosyltransferases as these enzymes play important roles in the biotransformation of drugs, xenobiotics, and toxic compounds (44). Expression changes in UGT genes could modify the response to some cancer drugs. UGT2B15 has been reported as diminished in prostate cancer (40), and UGT1A10 has been reported as downregulated in breast cancer (45) but upregulated in gastric cancer (44). These UGT genes have not been previously reported as altered in CC; thus, it could be interesting to analyse their expression status and the response of patients to treatment when their expression is altered.

Additionally, we also identified possible glycosylation pathways altered in the presence of E5 by analysing protein-protein interactions. We identified keratan sulfate and glycosphingolipid synthesis as including the involvement of the glycogenes ST3GAL3, ST6GAL1 and CHST2. Keratan sulfate belongs to the family of glycosaminoglycans, which participates in the regulation of cellular functions in epithelial and mesenchymal tissues (53).

The glycogenes ST3GAL3 and ST6GAL1 are involved in sialylation of glycosphingolipid. These glycolipids can be located in the cellular membrane, participate in cell-cell interactions and modulate transduction pathways, cell growth, apoptosis, cell proliferation, endocytosis, cell migration, senescence and embryogenesis (54,55). The aberrant expression of glycosphingolipids and the enzymes that participate in their biosynthesis has been reported in different cancer types (56). The expression of the ganglioside GM1 has been reported as being increased in ectocervix cells expressing VPH16 E5; gangliosides are expressed at high levels on tumour cells and inhibit cytotoxic T lymphocytes (56). Our results support these findings, demonstrating that E5 could be modifying ganglioside synthesis.

The glycogenes present in the N-glycosylation pathway are ST3GAL3 and ST6GAL1. Changes in sialic acid expression have been reported for different cancer types including CC, as was mention previously (11). Increased expression of sialylated antigens such as sLe(x) and sLe(a) has been reported in premalignant lesions and CC, and the enzyme ST3Gal III participates in the synthesis of both of these antigens (17,18,57). sLe(x) antigens can be modified by the enzyme sulfotransferase CHST2 to produce 6-sulfosialil Lewis-x (6-sulfo sLex), which can be a ligand of L-, P- and E-selectin (58). Moreover, ST6Gal I catalyses the α2,6 sialylation of N-glycans, and its expression is increased in different types of cancer (59). ST6Gal I had been implicated in the hypersialylation of the cell membrane protein β1 integrin in tumour cells, which leads to increased migration capacity (60). ST6Gal I also participates in the sialylation of epidermal growth factor receptor (EGFR) (61), which showed increased expression due to HPV16 E5 (62).

For the downregulated genes, the network interactions implicated in a glycosylation pathway involved only one glycogene. Fig. 4 shows a network of four proteins implicated in glycosaminoglycan biosynthesis, but only one glycogene, NDST2, was present in this network. The upregulation of NDST2 has been related to an increase in heparan sulfate (63).

For the glycogenes downregulated in the presence of E5, there are no reports focused on CC; thus, it would be important to evaluate their expression and roles in cervical transformation.

The results of this study provide important information related to glycogenes that modify their expression in the presence of the HPV-16 E5 protein. The expression microarray generated large amounts of information on the genes that were altered, but the results must be validated. The study present some limitations, it is important to confirm that the expression of the gene is related with the expression level of its corresponding protein, additionally, the study was performed in a cell line, so the role of the HPV infection and the expression of the other viral proteins could be participating in the glycosylation changes, so the effect of E5 could be affected by other factors. Therefore, the results must be confirmed with more in vitro experiments, followed by the evaluation of glycogene expression in different stages in cervical neoplasias positive for HPV16, as some of the altered glycogenes have not been previously reported in premalignant and malignant tissues. Also, it could be of interest to evaluate if the protein E5 from different viral genotypes, plays a different role in the glycosylation changes. Studying the effects of E5 of high and low risks HPV, will certainly provide relevant additional information of the effects of this viral infection.

The expression of the HPV16 E5 protein in HaCaT cells increased ST3GAL3 and ST6GAL1 mRNA levels, suggesting that the E5 protein could participate in the glycosylation changes found during cervical transformation in the cervical epithelium infected with HPV, especially those related to increased α2,3 and α2,6 sialylation, which have been reported as enhanced in premalignant lesions and CC. Additionally, E5 could participate in UGT gene expression changes implicated in treatment response. Changes in UGT gene expression have not been previously reported; thus, it would be interesting to analyse their levels in CC samples as well as to examine the correlation of these changes with responses to treatment.

Acknowledgements

The authors would like to thank Dr Lorena Chávez González, Dr Simón Guzmán León, Dr José Luis Santillán Torres and Dr Jorge Ramírez for their technical assistance with microarray determinations. The authors would also like to thank Mr. Gerardo Coello, Mr. Gustavo Corral and Ms. Ana Patricia Gómez for their assistance with the genArise software. All the previously mentioned individuals are affiliated to the Cellular Physiology Institute of National Autonomous University of Mexico.

Funding

The current study was supported by the Consejo Nacional de Ciencia y Tecnología (grant no. SALUD-2017-01-290068). JRL has a fellowship from the Fundación IMSS (grant no. 8066205). DCR was supported by a Ph.D. fellowship from CONACYT (grant no. 242745) and IMSS (grant no. 98227564). Funding was also provided by the Programa Cátedras CONACYT 2016 (grant no. 485) and Fondo Redes Temáticas de Investigación CONACYT (grant no. 253596).

Availability of data and materials

The datasets generated and analysed during the current study are available in the repository NCBI Gene Expression Omnibus database, (accession no. GSE118776; http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE118776).

Authors' contributions

DCR performed molecular biology experiments, in silico analysis, data analysis and revised the manuscript. YML participated in data analysis and critically revised the manuscript. PMM participated in the in silico and data analyses, and critically revised the manuscript. AAL analysed the data and critically revised the manuscript. LFJS participated in the in silico analysis and critically revised the manuscript. GSL participated in the molecular biology experiments, analysed the data and revised the manuscript. JRL designed the current study, analysed the data and critically revised the manuscript. VVR conceived and designed the current study, coordinated the study and draft the manuscript. All the authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

zur Hausen H: Papillomaviruses in the causation of human cancers - a brief historical account. Virology. 384:260–265. 2009. View Article : Google Scholar : PubMed/NCBI

2 

Smith JS, Lindsay L, Hoots B, Keys J, Franceschi S, Winer R and Clifford GM: Human papillomavirus type distribution in invasive cervical cancer and high-grade cervical lesions: A meta-analysis update. Int J Cancer. 121:621–632. 2007. View Article : Google Scholar : PubMed/NCBI

3 

Aguilar-Lemarroy A, Vallejo-Ruiz V, Cortés-Gutiérrez EI, Salgado-Bernabé ME, Ramos-González NP, Ortega-Cervantes L, Arias-Flores R, Medina-Díaz IM, Hernández-Garza F, Santos-López G, et al IMSS Research Network on HPV, : Human papillomavirus infections in Mexican women with normal cytology, precancerous lesions, and cervical cancer: Type-specific prevalence and HPV coinfections. J Med Virol. 87:871–884. 2015. View Article : Google Scholar : PubMed/NCBI

4 

Münger K and Howley PM: Human papillomavirus immortalization and transformation functions. Virus Res. 89:213–228. 2002. View Article : Google Scholar : PubMed/NCBI

5 

Conrad M, Bubb VJ and Schlegel R: The human papillomavirus type 6 and 16 E5 proteins are membrane-associated proteins which associate with the 16-kilodalton pore-forming protein. J Virol. 67:6170–6178. 1993. View Article : Google Scholar : PubMed/NCBI

6 

Venuti A, Paolini F, Nasir L, Corteggio A, Roperto S, Campo MS and Borzacchiello G: Papillomavirus E5: The smallest oncoprotein with many functions. Mol Cancer. 10:1402011. View Article : Google Scholar : PubMed/NCBI

7 

Chen SL, Huang CH, Tsai TC, Lu KY and Tsao YP: The regulation mechanism of c-jun and junB by human papillomavirus type 16 E5 oncoprotein. Arch Virol. 141:791–800. 1996. View Article : Google Scholar : PubMed/NCBI

8 

Chen SL, Lin YK, Li LY, Tsao YP, Lo HY, Wang WB and Tsai TC: E5 proteins of human papillomavirus types 11 and 16 transactivate the c-fos promoter through the NF1 binding element. J Virol. 70:8558–8563. 1996. View Article : Google Scholar : PubMed/NCBI

9 

Kivi N, Greco D, Auvinen P and Auvinen E: Genes involved in cell adhesion, cell motility and mitogenic signaling are altered due to HPV 16 E5 protein expression. Oncogene. 27:2532–2541. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Varki A, Kannagi R, Toole B and Stanley P: Glycosylation Changes in Cancer. Essentials of Glycobiology [Internet]. 3rd edition. Varki A, Cummings RD, Esko JD, Stanley P, Hart GW, Aebi M, Darvill AG, Kinoshita T, Packer NH, Prestegard JH, et al: Cold Spring Harbor Laboratory Press; Cold Spring Harbor, NY: 2017

11 

Wang PH: Altered Glycosylation in Cancer: Sialic Acids and Sialyltransferases. J Cancer Mol. 1:73–81. 2005.

12 

Wang PH, Li YF, Juang CM, Lee YR, Chao HT, Ng HT, Tsai YC and Yuan CC: Expression of sialyltransferase family members in cervix squamous cell carcinoma correlates with lymph node metastasis. Gynecol Oncol. 86:45–52. 2002. View Article : Google Scholar : PubMed/NCBI

13 

López-Morales D, Velázquez-Márquez N, Valenzuela O, Santos-López G, Reyes-Leyva J and Vallejo-Ruiz V: Enhanced sialyltransferases transcription in cervical intraepithelial neoplasia. Invest Clin. 50:45–53. 2009.PubMed/NCBI

14 

López-Morales D, Reyes-Leyva J, Santos-López G, Zenteno E and Vallejo-Ruiz V: Increased expression of sialic acid in cervical biopsies with squamous intraepithelial lesions. Diagn Pathol. 5:742010. View Article : Google Scholar : PubMed/NCBI

15 

Roy A and Chakraborty S: Detection of cancer cervix by estimation of sialic acid. J Indian Med Assoc. 103:589–590. 2005.PubMed/NCBI

16 

Terasawa K, Furumoto H, Kamada M and Aono T: Expression of Tn and sialyl-Tn antigens in the neoplastic transformation of uterine cervical epithelial cells. Cancer Res. 56:2229–2232. 1996.PubMed/NCBI

17 

Engelstaedter V, Fluegel B, Kunze S, Mayr D, Friese K, Jeschke U and Bergauer F: Expression of the carbohydrate tumour marker Sialyl Lewis A, Sialyl Lewis X, Lewis Y and Thomsen-Friedenreich antigen in normal squamous epithelium of the uterine cervix, cervical dysplasia and cervical cancer. Histol Histopathol. 27:507–514. 2012.PubMed/NCBI

18 

Velázquez-Márquez N, Santos-López G, Jiménez-Aranda L, Reyes-Leyva J and Vallejo-Ruiz V: Sialyl Lewis × expression in cervical scrapes of premalignant lesions. J Biosci. 37:999–1004. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Aco-Tlachi M, Carreño-López R, Martínez-Morales PL, Maycotte P, Aguilar-Lemarroy A, Jave-Suárez LF, Santos-López G, Reyes-Leyva J and Vallejo-Ruiz V: Glycogene expression profiles based on microarray data from cervical carcinoma HeLa cells with partially silenced E6 and E7 HPV oncogenes. Infect Agent Cancer. 13:252018. View Article : Google Scholar : PubMed/NCBI

20 

Kabsch K and Alonso A: The human papillomavirus type 16 E5 protein impairs TRAIL- and FasL-mediated apoptosis in HaCaT cells by different mechanisms. J Virol. 76:12162–12172. 2002. View Article : Google Scholar : PubMed/NCBI

21 

Buettner FF, Ashikov A, Tiemann B, Lehle L and Bakker H: C. elegans DPY-19 is a C-mannosyltransferase glycosylating thrombospondin repeats. Mol Cell. 50:295–302. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Milde-Langosch K, Karn T, Schmidt M, zu Eulenburg C, Oliveira-Ferrer L, Wirtz RM, Schumacher U, Witzel I, Schütze D and Müller V: Prognostic relevance of glycosylation-associated genes in breast cancer. Breast Cancer Res Treat. 145:295–305. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Recchi MA, Hebbar M, Hornez L, Harduin-Lepers A, Peyrat JP and Delannoy P: Multiplex reverse transcription polymerase chain reaction assessment of sialyltransferase expression in human breast cancer. Cancer Res. 58:4066–4070. 1998.PubMed/NCBI

24 

Jin XL, Zheng SS, Wang BS and Chen HL: Correlation of glycosyltransferases mRNA expression in extrahepatic bile duct carcinoma with clinical pathological characteristics. Hepatobiliary Pancreat Dis Int. 3:292–295. 2004.PubMed/NCBI

25 

Petretti T, Kemmner W, Schulze B and Schlag PM: Altered mRNA expression of glycosyltransferases in human colorectal carcinomas and liver metastases. Gut. 46:359–366. 2000. View Article : Google Scholar : PubMed/NCBI

26 

Ashkani J and Naidoo KJ: Glycosyltransferase gene expression profiles classify cancer types and propose prognostic subtypes. Sci Rep. 6:264512016. View Article : Google Scholar : PubMed/NCBI

27 

Gretschel S, Haensch W, Schlag PM and Kemmner W: Clinical relevance of sialyltransferases ST6GAL-I and ST3GAL-III in gastric cancer. Oncology. 65:139–145. 2003. View Article : Google Scholar : PubMed/NCBI

28 

Zhang S, Lu J, Xu Z, Zou X, Sun X, Xu Y, Shan A, Lu J, Yan X, Cui Y, et al: Differential expression of ST6GAL1 in the tumor progression of colorectal cancer. Biochem Biophys Res Commun. 486:1090–1096. 2017. View Article : Google Scholar : PubMed/NCBI

29 

Swindall AF, Londoño-Joshi AI, Schultz MJ, Fineberg N, Buchsbaum DJ and Bellis SL: ST6Gal-I protein expression is upregulated in human epithelial tumors and correlates with stem cell markers in normal tissues and colon cancer cell lines. Cancer Res. 73:2368–2378. 2013. View Article : Google Scholar : PubMed/NCBI

30 

Schultz MJ, Holdbrooks AT, Chakraborty A, Grizzle WE, Landen CN, Buchsbaum DJ, Conner MG, Arend RC, Yoon KJ, Klug CA, et al: The tumor-associated glycosyltransferase ST6Gal-I regulates stem cell transcription factors and confers a cancer stem cell phenotype. Cancer Res. 76:3978–3988. 2016. View Article : Google Scholar : PubMed/NCBI

31 

Vázquez-Martín C, Gil-Martín E and Fernández-Briera A: Elevation of ST6Gal I activity in malignant and transitional tissue in human colorectal cancer. Oncology. 69:436–444. 2005. View Article : Google Scholar : PubMed/NCBI

32 

Chakraborty A, Dorsett KA, Trummell HQ, Yang ES, Oliver PG, Bonner JA, Buchsbaum DJ and Bellis SL: ST6Gal-I sialyltransferase promotes chemoresistance in pancreatic ductal adenocarcinoma by abrogating gemcitabine-mediated DNA damage. J Biol Chem. 293:984–994. 2018. View Article : Google Scholar : PubMed/NCBI

33 

Potapenko IO, Haakensen VD, Lüders T, Helland A, Bukholm I, Sørlie T, Kristensen VN, Lingjaerde OC and Børresen-Dale AL: Glycan gene expression signatures in normal and malignant breast tissue; possible role in diagnosis and progression. Mol Oncol. 4:98–118. 2010. View Article : Google Scholar : PubMed/NCBI

34 

Chen X, Yang TT, Qiu XC, Ji ZG, Li CX, Long H, Zhou Y, Ma BA, Ma Q, Zhang X, et al: Gene expression profiles of human osteosarcoma cell sublines with different pulmonary metastatic potentials. Cancer Biol Ther. 11:287–292. 2011. View Article : Google Scholar : PubMed/NCBI

35 

Warnecke-Eberz U, Metzger R, Hölscher AH, Drebber U and Bollschweiler E: Diagnostic marker signature for esophageal cancer from transcriptome analysis. Tumour Biol. 37:6349–6358. 2016. View Article : Google Scholar : PubMed/NCBI

36 

Seko A, Kataoka F, Aoki D, Sakamoto M, Nakamura T, Hatae M, Yonezawa S and Yamashita K: N-Acetylglucosamine 6-O-sulfotransferase-2 as a tumor marker for uterine cervical and corpus cancer. Glycoconj J. 26:1065–1073. 2009. View Article : Google Scholar : PubMed/NCBI

37 

Sud N, Sharma R, Ray R, Chattopadhyay T and Ralhan R: Differential expression of beta mannosidase in human esophageal cancer. Int J Cancer. 112:905–907. 2004. View Article : Google Scholar : PubMed/NCBI

38 

Pfeiffer MJ, Smit FP, Sedelaar JP and Schalken JA: Steroidogenic enzymes and stem cell markers are upregulated during androgen deprivation in prostate cancer. Mol Med. 17:657–664. 2011. View Article : Google Scholar : PubMed/NCBI

39 

Chen X, Li D, Wang N, Yang M, Liao A, Wang S, Hu G, Zeng B, Yao Y, Liu D, et al: Bioinformatic analysis suggests that UGT2B15 activates the Hippo YAP signaling pathway leading to the pathogenesis of gastric cancer. Oncol Rep. 40:1855–1862. 2018.PubMed/NCBI

40 

Pâquet S, Fazli L, Grosse L, Verreault M, Têtu B, Rennie PS, Bélanger A and Barbier O: Differential expression of the androgen-conjugating UGT2B15 and UGT2B17 enzymes in prostate tumor cells during cancer progression. J Clin Endocrinol Metab. 97:E428–E432. 2012. View Article : Google Scholar : PubMed/NCBI

41 

Libisch MG, Casás M, Chiribao M, Moreno P, Cayota A, Osinaga E, Oppezzo P and Robello C: GALNT11 as a new molecular marker in chronic lymphocytic leukemia. Gene. 533:270–279. 2014. View Article : Google Scholar : PubMed/NCBI

42 

Tátrai P, Egedi K, Somorácz A, van Kuppevelt TH, Ten Dam G, Lyon M, Deakin JA, Kiss A, Schaff Z and Kovalszky I: Quantitative and qualitative alterations of heparan sulfate in fibrogenic liver diseases and hepatocellular cancer. J Histochem Cytochem. 58:429–441. 2010. View Article : Google Scholar : PubMed/NCBI

43 

Ushakov VS, Tsidulko AY, de La Bourdonnaye G, Kazanskaya GM, Volkov AM, Kiselev RS, Kobozev VV, Kostromskaya DV, Gaytan AS, Krivoshapkin AL, et al: Heparan sulfate biosynthetic system is inhibited in human glioma due to EXT1/2 and HS6ST1/2 D}down-regulation. Int J Mol Sci. 18:E23012017. View Article : Google Scholar : PubMed/NCBI

44 

Cengiz B, Yumrutas O, Bozgeyik E, Borazan E, Igci YZ, Bozgeyik I and Oztuzcu S: Differential expression of the UGT1A family of genes in stomach cancer tissues. Tumour Biol. 36:5831–5837. 2015. View Article : Google Scholar : PubMed/NCBI

45 

Starlard-Davenport A, Lyn-Cook B and Radominska-Pandya A: Identification of UDP-glucuronosyltransferase 1A10 in non-malignant and malignant human breast tissues. Steroids. 73:611–620. 2008. View Article : Google Scholar : PubMed/NCBI

46 

Pinho SS and Reis CA: Glycosylation in cancer: Mechanisms and clinical implications. Nat Rev Cancer. 15:540–555. 2015. View Article : Google Scholar : PubMed/NCBI

47 

Magalhães A, Duarte HO and Reis CA: Aberrant glycosylation in cancer: A novel molecular mechanism controlling metastasis. Cancer Cell. 31:733–735. 2017. View Article : Google Scholar : PubMed/NCBI

48 

Harduin-Lepers A, Krzewinski-Recchi MA, Colomb F, Foulquier F, Groux-Degroote S and Delannoy P: Sialyltransferases functions in cancers. Front Biosci (Elite Ed). 4:499–515. 2012. View Article : Google Scholar : PubMed/NCBI

49 

Estêvão D, Costa NR, Gil da Costa RM and Medeiros R: Hallmarks of HPV carcinogenesis: The role of E6, E7 and E5 oncoproteins in cellular malignancy. Biochim Biophys Acta Gene Regul Mech. 1862:153–162. 2019. View Article : Google Scholar : PubMed/NCBI

50 

Oetke C, Auvinen E, Pawlita M and Alonso A: Human papillomavirus type 16 E5 protein localizes to the Golgi apparatus but does not grossly affect cellular glycosylation. Arch Virol. 145:2183–2191. 2000. View Article : Google Scholar : PubMed/NCBI

51 

Vandamme V, Pierce A, Verbert A and Delannoy P: Transcriptional induction of beta-galactoside alpha-2,6-sialyltransferase in rat fibroblast by dexamethasone. Eur J Biochem. 211:135–140. 1993. View Article : Google Scholar : PubMed/NCBI

52 

Coughlan CM, Burger PG, Berger EG and Breen KC: The biochemical consequences of alpha2,6(N) sialyltransferase induction by dexamethasone on sialoglycoprotein expression in the rat H411e hepatoma cell line. FEBS Lett. 413:389–393. 1997. View Article : Google Scholar : PubMed/NCBI

53 

Caterson B and Melrose J: Keratan sulfate, a complex glycosaminoglycan with unique functional capability. Glycobiology. 28:182–206. 2018. View Article : Google Scholar : PubMed/NCBI

54 

D'Angelo G, Capasso S, Sticco L and Russo D: Glycosphingolipids: Synthesis and functions. FEBS J. 280:6338–6353. 2013. View Article : Google Scholar : PubMed/NCBI

55 

Zhuo D, Li X and Guan F: Biological roles of aberrantly expressed glycosphingolipids and related enzymes in human cancer development and progression. Front Physiol. 9:4662018. View Article : Google Scholar : PubMed/NCBI

56 

Suprynowicz FA, Disbrow GL, Krawczyk E, Simic V, Lantzky K and Schlegel R: HPV-16 E5 oncoprotein upregulates lipid raft components caveolin-1 and ganglioside GM1 at the plasma membrane of cervical cells. Oncogene. 27:1071–1078. 2008. View Article : Google Scholar : PubMed/NCBI

57 

Harduin-Lepers A, Vallejo-Ruiz V, Krzewinski-Recchi MA, Samyn-Petit B, Julien S and Delannoy P: The human sialyltransferase family. Biochimie. 83:727–737. 2001. View Article : Google Scholar : PubMed/NCBI

58 

Ohmori K, Kanda K, Mitsuoka C, Kanamori A, Kurata-Miura K, Sasaki K, Nishi T, Tamatani T and Kannagi R: P- and E-selectins recognize sialyl 6-sulfo Lewis X, the recently identified L-selectin ligand. Biochem Biophys Res Commun. 278:90–96. 2000. View Article : Google Scholar : PubMed/NCBI

59 

Lu J and Gu J: Significance of β-galactoside α2,6 sialyltranferase 1 in cancers. Molecules. 20:7509–7527. 2015. View Article : Google Scholar : PubMed/NCBI

60 

Seales EC, Jurado GA, Brunson BA, Wakefield JK, Frost AR and Bellis SL: Hypersialylation of beta1 integrins, observed in colon adenocarcinoma, may contribute to cancer progression by up-regulating cell motility. Cancer Res. 65:4645–4652. 2005. View Article : Google Scholar : PubMed/NCBI

61 

Park JJ, Yi JY, Jin YB, Lee YJ, Lee JS, Lee YS, Ko YG and Lee M: Sialylation of epidermal growth factor receptor regulates receptor activity and chemosensitivity to gefitinib in colon cancer cells. Biochem Pharmacol. 83:849–857. 2012. View Article : Google Scholar : PubMed/NCBI

62 

Tomakidi P, Cheng H, Kohl A, Komposch G and Alonso A: Modulation of the epidermal growth factor receptor by the human papillomavirus type 16 E5 protein in raft cultures of human keratinocytes. Eur J Cell Biol. 79:407–412. 2000. View Article : Google Scholar : PubMed/NCBI

63 

Deligny A, Dierker T, Dagälv A, Lundequist A, Eriksson I, Nairn AV, Moremen KW, Merry CLR and Kjellén L: NDST2 (N-Deacetylase/N-Sulfotransferase-2) enzyme regulates heparan sulfate chain length. J Biol Chem. 291:18600–18607. 2016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Cisneros-Ramírez D, Martínez-Laguna Y, Martínez-Morales P, Aguilar-Lemarroy A, Jave-Suárez LF, Santos-López G, Reyes-Leyva J and Vallejo-Ruiz V: Glycogene expression profiles from a HaCaT cell line stably transfected with HPV16 E5 oncogene. Mol Med Rep 22: 5444-5453, 2020.
APA
Cisneros-Ramírez, D., Martínez-Laguna, Y., Martínez-Morales, P., Aguilar-Lemarroy, A., Jave-Suárez, L.F., Santos-López, G. ... Vallejo-Ruiz, V. (2020). Glycogene expression profiles from a HaCaT cell line stably transfected with HPV16 E5 oncogene. Molecular Medicine Reports, 22, 5444-5453. https://doi.org/10.3892/mmr.2020.11630
MLA
Cisneros-Ramírez, D., Martínez-Laguna, Y., Martínez-Morales, P., Aguilar-Lemarroy, A., Jave-Suárez, L. F., Santos-López, G., Reyes-Leyva, J., Vallejo-Ruiz, V."Glycogene expression profiles from a HaCaT cell line stably transfected with HPV16 E5 oncogene". Molecular Medicine Reports 22.6 (2020): 5444-5453.
Chicago
Cisneros-Ramírez, D., Martínez-Laguna, Y., Martínez-Morales, P., Aguilar-Lemarroy, A., Jave-Suárez, L. F., Santos-López, G., Reyes-Leyva, J., Vallejo-Ruiz, V."Glycogene expression profiles from a HaCaT cell line stably transfected with HPV16 E5 oncogene". Molecular Medicine Reports 22, no. 6 (2020): 5444-5453. https://doi.org/10.3892/mmr.2020.11630
Copy and paste a formatted citation
x
Spandidos Publications style
Cisneros-Ramírez D, Martínez-Laguna Y, Martínez-Morales P, Aguilar-Lemarroy A, Jave-Suárez LF, Santos-López G, Reyes-Leyva J and Vallejo-Ruiz V: Glycogene expression profiles from a HaCaT cell line stably transfected with HPV16 E5 oncogene. Mol Med Rep 22: 5444-5453, 2020.
APA
Cisneros-Ramírez, D., Martínez-Laguna, Y., Martínez-Morales, P., Aguilar-Lemarroy, A., Jave-Suárez, L.F., Santos-López, G. ... Vallejo-Ruiz, V. (2020). Glycogene expression profiles from a HaCaT cell line stably transfected with HPV16 E5 oncogene. Molecular Medicine Reports, 22, 5444-5453. https://doi.org/10.3892/mmr.2020.11630
MLA
Cisneros-Ramírez, D., Martínez-Laguna, Y., Martínez-Morales, P., Aguilar-Lemarroy, A., Jave-Suárez, L. F., Santos-López, G., Reyes-Leyva, J., Vallejo-Ruiz, V."Glycogene expression profiles from a HaCaT cell line stably transfected with HPV16 E5 oncogene". Molecular Medicine Reports 22.6 (2020): 5444-5453.
Chicago
Cisneros-Ramírez, D., Martínez-Laguna, Y., Martínez-Morales, P., Aguilar-Lemarroy, A., Jave-Suárez, L. F., Santos-López, G., Reyes-Leyva, J., Vallejo-Ruiz, V."Glycogene expression profiles from a HaCaT cell line stably transfected with HPV16 E5 oncogene". Molecular Medicine Reports 22, no. 6 (2020): 5444-5453. https://doi.org/10.3892/mmr.2020.11630
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team