Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
June-2025 Volume 31 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2025 Volume 31 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article Open Access

Role and mechanism of mitochondrial dysfunction‑related gene biomarkers in the progression of type 2 diabetes mellitus

  • Authors:
    • Mengxue Liu
    • Hong Qiao
  • View Affiliations / Copyright

    Affiliations: Department of Endocrinology and Metabolism, The Second Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang 150086, P.R. China, Department of Endocrinology and Metabolism, The Second Affliated Hospital of Harbin Medical University, Harbin, Heilongjiang 150086, P.R. China
    Copyright: © Liu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 158
    |
    Published online on: April 10, 2025
       https://doi.org/10.3892/mmr.2025.13523
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The present study aimed to elucidate the roles and mechanisms of gene biomarkers associated with mitochondrial dysfunction in the progression of Type 2 diabetes mellitus (T2DM). It conducted an analysis of differentially expressed genes related to mitochondrial dysfunction in T2DM and employed bioinformatics approaches to predict potential target drugs for key biomarkers. Additionally, the present study used the EPIC algorithm to examine immune cell infiltration in T2DM. Furthermore, the single‑cell RNA sequencing dataset GSE221156 was analyzed to identify specific cell types involved in T2DM. The expression of biomarkers was investigated through cellular experiments to assess the effect of marker genes on macrophage polarization. A total of five biomarker genes associated with T2DM were identified, namely ERAP2, HLA‑DQB1, HLA‑DRB5, MAP1B and OAS3. The combined detection of these genes yielded a risk‑predictive area under the curve value of 0.833 for T2DM. These five marker genes may serve as potential targets for valproic acid (VPA). During the progression of T2DM, there is an increase in macrophage numbers, with these genes being highly expressed in macrophages. In a high glucose‑induced RAW264.7 macrophage model, the expressions of MAP1B and OAS3 were upregulated. Notably, the knockdown of OAS3 markedly reduced M1 macrophage polarization, indicating OAS3 facilitates M1 macrophage polarization in a high‑glucose environment. The downregulation of OAS3 expression attenuated M1 macrophage polarization by inhibiting mTORC activation. In conclusion, five candidate biomarkers for T2DM were identified that may serve as therapeutic targets for VPA and are associated with immune infiltration in T2DM. Among these, OAS3 enhances M1 macrophage polarization in a high‑glucose environment by regulating the mTORC1 pathway.

Introduction

Diabetes mellitus (DM) is a chronic metabolic disease characterized by persistent hyperglycemia and is divided into two predominant subtypes: type 2 diabetes mellitus (T2DM) and type 1 diabetes mellitus (T1DM) (1). DM is a serious threat to human health globally and it is estimated that there are currently 537 million adults with DM worldwide (2). The number of individuals with DM diabetes will increase to 643 million by 2030, with T2DM accounting for more than 90% of these cases (2). T2DM is a polygenic genetic disease caused by genetic and environmental factors, with insulin resistance and defective insulin secretion from β-cells as the two main pathologic mechanisms (3,4). A previous study demonstrated that patients with T2DM are in a state of long-term high blood sugar, which can induce heart, brain, kidney and other target organ damage, thus leading to a variety of complications and seriously endangering the lives of patients (4). Studies have observed that weight loss through bariatric surgery, aggressive insulin therapy and behavioral interventions can lead to sustained remission of T2DM for several years; most T2DM patients require continuous treatment to maintain glycemic compliance (5,6). In addition, there are several drugs (alpha-glucosidase inhibitors, metformin, sulfonylureas and meglitinides) that have adverse effects in the current treatment of T2DM, for example, sulfonylureas can lead to decreased efficacy and hypoglycemia and metformin may trigger intestinal discomfort in patients (7). Early diagnosis and intervention in T2DM, facilitated by a thorough understanding of its onset and progression mechanisms, can substantially improve patient quality of life and effectively reduce the risk of complications. This approach constitutes an essential aspect of comprehensive diabetes management. Nevertheless, existing screening and monitoring methodologies, such as fasting blood glucose and glycosylated hemoglobin (HbA1c) testing, are insufficient and necessitate further refinement (8).

Emerging biomarkers, including glycated albumin, fructosamine and 1,5-anhydroglucitol (1,5-AG), have shown enhanced prognostic value over traditional markers, offering a more accurate assessment of blood glucose levels (8). A previous study revealed that T2DM is characterized by low adenosine triphosphate (ATP) levels, high reactive oxygen species (ROS) production and mitochondrial dysfunction (9). Mitochondria are bioenergetic and metabolic centers extensively involved in various biological processes with complex adaptive mechanisms (10). Alterations in the normal morphology and dysfunction of mitochondria are relevant factor pairs affecting the progression of multiple diseases (11). A number of researchers have identified mitochondria as the intersection of key cellular pathways such as ROS generation, energy substrate metabolism and apoptosis in T2DM and mitochondria contribute to deficits in important functions downstream of T2DM, including cardiac output, hepatocyte metabolism, skeletal muscle contraction, neuronal health and β-cell insulin production (12). Within mitochondria, the catabolism of carbohydrates and fatty acids results in the generation of ATP and ROS (13). Under physiological conditions, mitochondria regulate ROS concentrations via intrinsic antioxidant systems. However, in the context of T2DM, mitochondrial functionality is compromised and energy metabolism is disrupted, culminating in elevated ROS production (14). Mitophagy, a form of selective autophagy, regulates the progression of T2DM by specifically degrading dysfunctional or damaged mitochondria (15). Therefore, the present study conducted a screening of endoplasmic reticulum aminopeptidase 2 (ERAP2), human leukocyte antigen (HLA)-DQB1, HLA-DRB5, microtubule-associated protein 1B (MAP1B) and 2′-5′-oligoadenylate synthetases 3 (OAS3) as potential biomarkers and therapeutic targets for T2DM. This screening was based on the expression levels of genes associated with mitochondrial dysfunction in T2DM.

In addition to metabolic disturbances, an imbalance in immune homeostasis is a key feature of T2DM and can lead to increased inflammatory infiltration (16). Using bioinformatics analysis, it was identified that the aforementioned five biomarkers-ERAP2, HLA-DQB1, HLA-DRB5, MAP1B and OAS3 are all highly expressed in macrophages. Macrophages are the main cells that carry out the body's intrinsic immunity and activated macrophages participate in the inflammatory response by releasing a variety of cytokines and inflammatory mediators (17). Different phenotypes of macrophages have great differences in inflammatory reactions. They can be divided into pro-inflammatory M1 macrophages and anti-inflammatory M2 macrophages and the M1 and M2 types of macrophages can be transformed into each other under appropriate conditions (17). The microenvironment of DM patients is in a state of inflammation. The imbalance of macrophage M1/M2 polarization is associated with insulin resistance and pancreatic islet β-cell damage and the adjustment of macrophage polarization plays a therapeutic role in T2DM (17).

The present study established a 5-gene (ERAP2, HLA-DQB1, HLA-DRB5, MAP1B and OAS3) prediction model for T2DM prediction and analyzed the association of marker genes with the immune microenvironment. In addition, the association of MAP1B and OAS3 with macrophages during T2DM pathology was explored by cellular experiments. The present study aided in the early diagnosis, prevention and treatment of T2DM.

Materials and methods

Data collection and processing

In the present study, the gene expression dataset GSE184050, associated with T2DM and the single-cell transcriptomics dataset GSE221156, associated with T2DM, were downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/). The GSE184050 dataset includes sequencing results of peripheral blood samples from 50 patients with T2DM and 66 controls. The GSE221156 dataset includes sequencing results of pancreatic single-cell suspensions from 17 patients with T2DM, 17 control populations and 14 patients with pre-diabetes (prediabetic state; PD). A total of 9,189 mitochondrial dysfunction-related genes were downloaded from the GeneCard database (https://www.genecards.org/) using the keyword ‘mitochondrial dysfunction’.

The expression matrix of T2DM-related genes was extracted from the GSE184050 dataset using the R package ‘limma’ (version 3.2.0; http://www.bioconductor.org/packages/release/bioc/html/limma.html) and analyzed by differential expression and the cut-off criterion for differentially expressed genes (DEGs) was set at FC=1.3, P<0.05; volcano plots showed the final results. The R package ‘WGCNA’ (version 1.73; http://cran.r-project.org/web/packages/WGCNA/index.html) was applied to construct and visualize the network of genes in the GSE184050 dataset. First, the outliers were identified and removed by the sample clustering method and feature matching was performed.

Based on the 9,189 mitochondrial dysfunction-related genes, DEGs screened in the GSE184050 dataset and important modular genes obtained by WGCNA, the intersection analysis was further carried out by using the ‘VennDiagram’ R package (version 1.7.3; http://cran.r-project.org/web/packages/VennDiagram/index.html) and key genes related to mitochondrial dysfunction in T2DM in the present study were identified through the Venn diagram.

T2DM-related single-cell transcriptome data (GSE221156 dataset) were analyzed using the ‘Seurat’ R package (version 5.2.1; http://cran.r-project.org/web/packages/Seurat/index.html) to identify and annotate cell types and their subpopulations.

T2DM-related differential gene analysis and co-expression module construction

Weighted gene co-expression network analysis (WGCNA) is an algorithm developed based on the R language, which is mainly used to mine valuable information in high-throughput data. WGCNA identifies core genes associated with diseases in scale-free networks through clustering analysis and thus helps to reveal complex biological mechanisms (18). The network construction was performed on the genes in the GSE184050 dataset. The Pearson correlation coefficient was used to obtain the gene co-expression similarity. Then, the topological overlap matrix was used to filter the weak connections in the network construction process. When the soft threshold was set to five, the constructed network conformed to the scale-free distribution and provided appropriate average connections for the subsequent co-expression module building. Finally, the branches of the dendrogram were efficiently identified using the dynamic tree-cutting algorithm, thus defining different co-expression modules and representing them differentially with other colors. Correlation tests were performed on gene modules using Pearson correlation analysis to explore the relationships between gene modules further.

In addition, the present study screened modules closely associated with T2DM by constructing module-trait correlations. In this process, gene significance was defined by the association values between specific traits and gene expression within a module; Module eigengene and Module membership were used to differentiate significant modules associated with T2DM. Finally, modules with P<0.05 were selected for subsequent in-depth analysis.

Key gene screening and functional enrichment analysis

Next, the present study performed functional enrichment analysis on the screened key genes. Gene Ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) can be used to identify key biological pathways. The present study performed GO annotation and KEGG pathway enrichment analysis of key genes using the R packages ‘org.Hs.eg.db’ (version 3.20; http://bioconductor.org/packages/release/data/annotation/html/org.Hs.eg.db.html) and ‘clusterProfiler’ (version 3.20; http://www.bioconductor.org/packages/release/bioc/html/clusterProfiler.html) with the help of the ‘ggplot2’ package (version 3.5.1; http://cran.r-project.org/web/packages/ggplot2/index.html). The results were visualized with the ‘ggplot2’ R package and the results with P<0.05 were included in the present study.

Biomarker screening and performance evaluation

In the present study, three machine learning algorithms were used to screen out the characteristic genes of T2DM, including Least absolute shrinkage and selection operator (Lasso) logistic regression, Random forest (RF) and Support vector machine (SVM). The Lasso logistic regression analysis, RF algorithm and SVM algorithm were performed using the R packages ‘glmnet,’ (version 4.1–8; https://cran.r-project.org/web/packages/glmnet/index.html) ‘randomForest’ (version 4.7-1.2; http://cran.r-project.org/web/packages/randomForest/) and ‘e1071’ (version 1.7-16; http://cran.r-project.org/web/packages/e1071/index.html), respectively. Then, a Venn diagram obtained the intersection of the genes identified by the three algorithms and these genes are potential biomarkers.

After screening potential biomarkers, the expression differences of marker genes between normal and T2DM groups were further explored based on the GSE184050 dataset. The effect of each biomarker on the risk of T2DM was assessed by constructing line plots with the ‘rms’ package (version 7.0-0; http://cran.r-project.org/web/packages/rms/index.html) and the accuracy of the line plots was evaluated using calibration curves. At the same time, the R package ‘pROC’ (version 1.18.5; http://cran.r-project.org/web/packages/pROC/index.html) was used to plot the Receiver operating characteristic (ROC) curve and to calculate the area under the curve (AUC) to assess the predictive efficacy of the biomarkers independently as well as the overall predictive efficacy of the biomarkers. The overall predictive efficacy of the biomarkers was evaluated.

Analysis of immune cell infiltration

The present study explored the biological functions and related pathways of each biomarker by gene set enrichment analysis (GSEA; http://www.broadinstitute.org/gsea). To determine the relationship between infiltrating immune cells and candidate biomarkers in T2DM, the EPIC algorithm (http://epic.gfellerlab.org) was applied to assess the abundance of immune cells in T2DM samples from the GSE184050 dataset. The EPIC algorithm can accurately quantify the proportions of the different types of immune cells in the samples and analyze their changes between the disease state and the normal state. Based on the immune infiltration analysis results, the expression differences of immune checkpoint genes were compared between the normal and T2DM groups.

Subsequently, the relationships between biomarkers, immune infiltrating cells and immune checkpoints were explored using Pearson's correlation analysis in R and the ‘ggplot2’ R package visualized the results. P<0.05 indicates that the relationships were statistically significant.

Mendelian randomization (MR) analysis

Immune cells were used as exposure factors and significant instrumental variables for exposure factors (SNP) for exposure factors were selected from the Genome-wide association study (GWAS; http://gwas.mrcieu.ac.uk/) database as instrumental variables. To avoid the influence of strong linkage disequilibrium (LD) on the results, the thresholds of LD were set at r2 <0.3 and p1 <5e-8 (19). T2DM was used as the observed outcome and the outcome GWAS data GCST010118 was obtained from the GWAS database, including 77,418 East Asian cases and 356,122 East Asian controls. The ‘TwoSampleMR’ program package (version 2.0.1; http://cran.r-project.org/web/packages/twosamples/index.html) in R4.2.2 was used to perform the two-sample MR program method. SNP and outcome GWAS data were first preprocessed using the harmonise_data function in the TwoSampleMR program package to maintain a uniform format. MR Egger, Weighted median, Inverse variance weighted, Simple mode and Weighted mode methods were used for analysis. A heterogeneity test was also performed using the MR Egger method and inverse variance weighted (IVW) method to evaluate the heterogeneity of instrumental variables according to Cochrane's Q value. MR Egger regression equation was used to assess the horizontal polytropy of instrumental variables. In addition, to ensure that the results were not notably affected by a particular SNP, each SNP was removed in turn using the leave-one-out method. The present study compared the results of the IVW method with all variants (20). Three core assumptions ensured the accuracy of the causal estimation: i) The genetic instrumental variables are strongly associated with immune cells, ii) the genetic instrumental variables are independent of potential confounders iii) the genetic instrumental variables must influence the occurrence of T2DM only through immune cells.

Drug sensitivity analysis and molecular docking

The present study searched each of the key genes on the CTDbase database (https://ctdbase.org/) to obtain information about drug interactions and diseases associated with these genes. Subsequently, the small molecule ligands acting on the biomarker genes in T2DM were analyzed. The intersecting drugs of all the marker genes via Venn diagrams were selected for subsequent molecular docking analysis.

Regarding molecular docking, first, the 2D structure of each small molecule ligand drug was obtained from the PubChem database (PDB, http://www.rcsb.org/). These structures were imported into Chem3D software to calculate the minimum free energy and convert them into three-dimensional structures. The 3D structures of the target proteins (receptors) were then obtained from the RCSB protein database (https://www.rcsb.org/). The structures were imported into PyMOL (https://www.pymol.org/) to remove water molecules and ligands. Receptors and ligands were prepared using AutoDock 1.5.6 (The Scripps Research Institute; http://autodock.scripps.edu/download-autodock4/) to obtain their PDBQT format and 3D mesh boxes were created for the receptors for subsequent molecular docking simulations. Next, molecular docking analysis was performed using AutoDock Vina 1.1.2 (The Scripps Research Institute; http://vina.scripps.edu/downloads/) to assess the binding energy between the ligand and receptor. Finally, the best predicted binding sites were visualized using PyMOL. Binding energies less than-5 kcal/mol were defined as indicating effective ligand-receptor binding and binding energies less than −7 kcal/mol indicated strong binding activity (21).

Single-cell sequencing analysis

First, single-cell data were read using the Read10X_h5 function in the ‘Seurat’ package for data preprocessing, which helps to remove potentially low-quality cells and dead cells to ensure the reliability of the analysis results. Subsequently, the batch effect was removed using the Integration method provided by the FindIntegrationAnchors function in the ‘Seurat’ package. The effect of batch effect removal was checked by t-Distributed Stochastic Neighbor Embedding (tSNE) dimensionality reduction analysis to ensure the accuracy and consistency of the data. Next, cell clustering analysis was performed using the ‘Seurat’ package. The graph was then partitioned into highly interconnected ‘clusters’ using a graph partitioning algorithm. The FindClusters function was used to perform the graph-based clustering analysis and the resolution parameter set to 0.3 to obtain different cell clusters. The cell clusters were also screened for differential genes using the FindMarkers function, in which the logfc was entered. Threshold parameter was set to 1 and the Wilcoxon test (test. use=‘Wilcox’) used to identify the characteristic genes of each cell cluster. In this way, it was possible to pinpoint genes that were differentially expressed in different cell clusters. To further annotate cell subclusters, the ‘SingleR’ package continued to be used for cell subcluster annotation. By integrating known cell type marker genes, each cell cluster was annotated to a specific cell type or subpopulation. Next, the R package ‘Cellchat’ (version 2.1.0; http://github.com/jinworks/CellChat) was used to infer the number and strength of interactions between different cell clusters in the samples, revealing the interaction network between cell clusters, which provides important information for understanding cell function and tissue microenvironment.

Cell culture

RAW264.7 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) containing 10% fetal bovine serum and 1% double antibiotic (penicillin 100 U/ml + streptomycin 100 µg/ml) and placed in an incubator at 37°C containing 5% CO2. The cell culture medium was changed every 2–3 days and when the cell density was 80–90%, the cells were routinely passaged.

Macrophage treatment

RAW264.7 cells were divided into the control group (Control), the high glucose (HG) group and the negative control (NG) group. The cells in the control group were cultured normally (containing 4.5 mmol/l glucose) without any treatment. The cells in the HG group were cultured in a DMEM medium containing HG (25 mmol/l) for 72 h. The cells in the NG group were cultured in a DMEM medium containing low glucose (5.5 mmol/l) for 72 h.

Macrophage polarization induction

To investigate the effect of T2DM on macrophage polarization, RAW264.7 cells were treated with TNF-α to induce M1 macrophage polarization and with IL-4 to induce M2 macrophage polarization. Control group cells were not treated in any way and were cultured normally. TNF-α-treated group cells (TNF-α group) were treated with TNF-α (20 ng/ml) for 24 h. IL-4-treated group cells (IL-4 group) were treated with IL-4 (20 ng/ml) for 24 h.

Cell grouping and transfection

The sequences of the small interfering RNA specifically targeting OAS3 (siRNA#1-OAS3), siRNA#2-OAS3, siRNA#1-MAP1B, siRNA#2-MAP1B and their negative control (siNC) are shown in Table I. RAW264.7 cells were divided into siNC group, siRNA#1-OAS3 group, siRNA#2-OAS3 group, siRNA#1-MAP1B group, siRNA#2-MAP1B group, HG + siRNA-OAS3 group and TNF-α + siRNA-OAS3 group. The siNC group cells were transfected with siNC. siRNA#1-OAS3 group, siRNA#2-OAS3 group, siRNA#1-MAP1B group and siRNA#2-MAP1B group cells were transfected with the corresponding siRNA, respectively. The cells in the HG + siRNA-OAS3 group were treated with HG and transfected with siRNA#1-OAS3. The cells in the TNF-α + siRNA-OAS3 group were treated with TNF-α and transfected with siRNA#1-OAS3.

Table I.

siRNA sequences.

Table I.

siRNA sequences.

Gene name5′-3′5′-3′
Negative control UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT
mMap1b-5496 GCUAUUUGAUACAAUGCAATT UUGCAUUGUAUCAAAUAGCTT
mMap1b-2330 GGAAAGUCAAAGUCAUUAATT UUAAUGACUUUGACUUUCCTT
mOas3-1493 GGGAGAAGAGUGUAUACAATT UUGUAUACACUCUUCUCCCTT
mOas3-2418 GGACAAAUUCAUCAGUGAATT UUCACUGAUGAAUUUGUCCTT

[i] siRNA, small interfering RNA.

For cell transfection, the siRNA was first dissolved into a master mix at a concentration of 20 µM and then RNATransMate (Beyotime Institute of Biotechnology) and siRNA were mixed in a serum-free medium and incubated at 25°C for 20 min to form a siRNA/RNATransMate complex. Subsequently, 400 µl siRNA/RNATransMate complex and 1,600 µl serum-free medium were mixed, added to the culture plate, and incubated with the cells (2×105 cells/well) at 37°C in a 5% CO2 atmosphere for 24 h. A total of 48 h post-transfection, the medium was replaced with fresh complete medium to ensure cell viability.

RNA extraction and reverse transcription-quantitative (RT-q) PCR

Prior to RT-qPCR analysis, total RNA was extracted from the treated cells (1×106 cells/well) by RNeasy Plus Mini kit (cat. no. 74134; Qiagen GmbH) according to the instructions in the product manual. Then, the cDNA was synthesized with a QuantiTect Reverse Transcription kit (cat. no. 205311; Qiagen GmbH) according to the manufacturer's protocol. Finally, the RT-qPCR reactions mix solution (including Hieff UNICON Universal Blue Qpcr SYBR, Green Master Mix, PCR Forward Primer, PCR Reverse Primer, template DNA, ddH2O) was prepared using the Hieff UNICON Universal Blue qPCR SYBR Green Master Mix (cat. no. 11184ES08; Shanghai Yeasen Biotechnology Co., Ltd.) following the manufacturer's instructions. Next, qPCR was performed using the LightCycler 480 II system (Roche Diagnostics). The qPCR cycling conditions were as follows: Initial denaturation at 95°C for 30 sec, followed by 40 cycles at 95°C for 5 sec and 60°C for 30 sec. All experiments were independently replicated three times. The results were analyzed and quantified using the 2−ΔΔCq method (22), GAPDH was used as an endogenous control and sequences of all primers were listed in Table II.

Table II.

Primers for reverse transcription-quantitative PCR.

Table II.

Primers for reverse transcription-quantitative PCR.

Gene nameSequence
MAP1B-Forward GTCTCCTTTACGCAGTCCTCC
MAP1B-Reverse TGCTTTCCATTCTTCCCTTCA
OAS3-Forward TGGGTGCCATGCGAATGTTGC
OAS3-Reverse CTCCAGAGCGGGGCTGTCCTA
CD68-Forward ACCGTGACCAGTCCCTCTT
CD68-Reverse TGTCGTCTGCGGGTGATGC
CD80-Forward CTTTGTGCTGCTGATTCGT
CD80-Reverse TTTGCCAGTAGATTCGGTC
CD86-Forward ATGGGCTCGTATGATTGT
CD86-Reverse TCTTAGGTTTCGGGTGAC
CD32-Forward GCAAAGGAAGTCTAGGAAGGA
CD32-Reverse ATAATAACAATGGCTGCGACA
CD206-Forward CATCACCAACGACCTCAG
CD206-Reverse AGTAAGCCCTCTGTCTCC
CD204-Forward ACTTGATACTGACAGGAAACC
CD204-Reverse ATGTATAAAATTGTGAGCCAC
CD163-Forward CCAGTCCAAACAACAAGC
CD163-Reverse CACATTGGCATCAGTCATA
TNF-α-Forward GCGGTGCCTATGTCTCAG
TNF-α-Reverse TCCTCCACTTGGTGGTTT
GAPDH-Forward GGGTCCCAGCTTAGGTTCAT
GAPDH-Reverse CCAATACGGCCAAATCCGTT
Western blotting

First, PMSF (cat. no. HKW2017; Jiangsu Haoke Bioengineering Co., Ltd.) and phosphorylated protease inhibitor (cat. no. HKW2018; Jiangsu Haoke Bioengineering Co., Ltd.) were mixed into IP lysis buffer (cat. no. HKW2012; Jiangsu Haoke Bioengineering Co., Ltd.) to extract the total protein from the cells. Then, the BCA working solution was prepared using the BCA Protein Quantification Kit (cat. no. HKW2019; Jiangsu Haoke Bioengineering Co., Ltd.). After the concentration of protein samples was detected using the Enhanced BCA Protein Assay Kit (cat. no. P0009; Beyotime Institute of Biotechnology), 30 µg protein/lane was subjected to SDS-PAGE on 10% gels. Subsequently, the separated proteins were transferred to a PVDF membrane (cat. no. 36125ES03; Shanghai Yeasen Biotechnology Co., Ltd.), after which the PVDF membrane was blocked with 5% skimmed milk (cat. no. SW3015, Nestle) at 25°C for 1 h. Next, the PVDF membrane was incubated with diluted primary antibodies at 4°C overnight and incubated with secondary antibodies at room temperature (25°C) for 1 h. Then, the PVDF membrane was washed and treated with an ECL Plus working solution (cat. no. HKW2095; Jiangsu Haoke Bioengineering Co., Ltd.). The results were analyzed with the help of a Chemiluminescence system (Clinx Science Instruments Co., Ltd.) and were semi-quantified with ImageJ software (version 1.53m; National Institutes of Health). All information on antibodies is listed in Table III.

Table III.

All antibodies information in western blotting in the present study.

Table III.

All antibodies information in western blotting in the present study.

NameCatalog numberCompanyMolecular weightDilution
OAS321915-1-APProteintech Group, Inc.100-121 kDa1:1,000
CD86ET1606-50Huabio70 kDa1:500
CD204ER1913-21Huabio50 kDa1:1,000
Phospho-mTOR (S2448)HA600094Huabio289 kDa1:1,000
GAPDH10494-1-APProteintech Group, Inc.36 kDa1:5,000
HRP Anti-Rabbit IgG (H+L)SA00001-2Proteintech Group, Inc. 1:5,000
HRP Anti-Mouse IgG (H+L)SA00001-1Proteintech Group, Inc. 1:5,000
Statistical analysis

All bioinformatics-related statistical analyses in the present study were performed using R software 4.2.2 (https://www.r–project.org/) (23). The Pearson correlation test was used to determine the significance of correlations between variables and the Wilcoxon test was used to assess the importance of differences between the two groups. All cellular experimental data displays are the mean ± standard deviation of three biological replicates. GraphPad Prism 10.1.3 (Dotmatics) was used for statistical analysis, data processing and presentation of all experiments in the present study. One-way ANOVA and Tukey's post hoc test were used for multi-group comparisons. P<0.05 was considered to indicate a statistically significant difference.

Results

Screening of DEGs in T2DM and co-expression module construction

To screen for DEGs in T2DM, the present study first analyzed the GSE184050 database and identified 791 DEGs in T2DM, including 769 upregulated genes and 22 downregulated genes (Fig. 1). To further explore the key genes associated with T2DM, gene co-expression modules were established using WGCNA and 23 co-expression modules were identified, most of which showed positive correlations with each other, suggesting that they had some consistency in expression patterns (Fig. 2A-C). By setting a significance threshold of P<0.05, the present study screened out four gene co-expression modules that were highly correlated with T2DM, including ‘darkermagenta’, ‘floralwhite’, ‘orangered4’ and ‘dark grey’. Subsequently, in order to further screen mitochondrial dysfunction-related genes, 9,189 mitochondrial dysfunction-related genes were obtained from the GeneCard database. The mitochondrial dysfunction-related genes were intersected with the DEGs obtained from the GSE184050 database and T2DM-related genes obtained from the WGCNA and then a total of 65 genes were obtained (Fig. 2D). The specific names of the genes are shown in Table IV.

Figure 1.

Identification of DEGs between T2DM and normal samples. The blue dots represent downregulated genes and the red dots represent upregulated genes. DEGs, differentially expressed genes; T2DM, type 2 diabetes mellitus.

Figure 2.

Screening for mitochondrial dysfunction and intersection of T2DM-related genes. (A) Determination of appropriate soft thresholds based on scale independence and average connectivity. (B) Results of Pearson correlation analysis of 23 co-expression modules. (C) Results of correlation analysis between modules and traits in T2DM (blue: negative correlation, green: positive correlation). (D) Screening for mitochondrial dysfunction and intersection of T2DM-related genes. T2DM, type 2 diabetes mellitus.

Table IV.

Mitochondrial dysfunction-related genes in type 2 diabetes mellitus.

Table IV.

Mitochondrial dysfunction-related genes in type 2 diabetes mellitus.

Gene nameFull nameGene nameFull name
MAP1B Microtubule-associated protein 1BRIN3Ras and Rab interactor 3
RAB7ARab protein member 7ASPI1Spi-1 proto-oncogene
RHOGRas homolog family member GIRGMImmunity-related GTPase family M
HBA1Hemoglobin subunit alpha 1OAS3 2′-5′-Oligoadenylate synthetase 3
HBA2Hemoglobin subunit alpha 2CHERPCalcium homeostasis endoplasmic reticulum protein
SLC24A4Solute carrier family 24, member 4HBG2Hemoglobin subunit gamma 2
HBBHemoglobin subunit betaINF2Inverted formin, FH2 and WH2 domain containing
ERAP2Endoplasmic reticulum aminopeptidase 2ALOX15Arachidonate 15-lipoxygenase
RNPEPL1Arginyl aminopeptidase-like 1CXCR3C-X-C motif chemokine receptor 3
SLC26A1Solute carrier family 26, member 1ZBTB7AZinc finger and BTB domain containing 7A
MTHFS 5,10-methenyltetrahydrofolate synthetaseCXCL8C-X-C motif chemokine ligand 8
TECRTrans-2,3-enoyl-CoA reductaseHSPB1Heat shock protein family B (small) member 1
CASZ1Castor zinc finger 1HLA-DQB1Major histocompatibility complex, class II, DQ beta 1
GLUD2Glutamate dehydrogenase 2HBG1Hemoglobin subunit gamma 1
SLC25A22Solute carrier family 25, member 22UTS2Urotensin 2
ABCD1ATP binding cassette subfamily D member 1TUBB2ATubulin beta 2A class IIa
OXT Oxytocin/neurophysin I prepropeptideLTBP3Latent transforming growth factor beta binding protein 3
TAPBPTAP binding protein (tapasin)UCP2Uncoupling protein 2
SERPINA1Serpin family A member 1CBFA2T3Core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (homolog of mouse)
CSF1Colony stimulating factor 1ADORA3Adenosine A3 receptor
PMLPromyelocytic leukemiaTICAM1Toll-like receptor adaptor molecule 1
NPHP4Nephrocystin 4NRGNNeurogranin
TEX22Testis expressed 22NLRP6NLR family pyrin domain containing 6
HBDHemoglobin subunit deltaZFPM1Zinc finger protein, FOG family member 1
CD7 PANX2Pannexin 2
SLC29A1Solute carrier family 29, member 1FTH1Ferritin heavy chain 1
MIER2Mesoderm induction early response 1, family member 2DLGAP4DLG associated protein 4
OLIG1Oligodendrocyte transcription factor 1TMTC1Transmembrane and tetratricopeptide repeat containing 1
TGFB1Transforming growth factor beta 1SCAMP4Secretory carrier membrane protein 4
ARID1AAT-rich interaction domain 1AHLA-DRB5Major histocompatibility complex, class II, DR beta 5
ELANEElastase, neutrophil expressedAHDC1AT-hook DNA binding motif containing 1
JUNDJunD proto-oncogene, AP-1 transcription factor subunitCBS Cystathionine-beta-synthase
PABPN1Poly(A) binding protein nuclear 1
Functional enrichment analysis of mitochondrial dysfunction-related genes in T2DM

Then, to preliminary elucidate the underlying regulatory mechanisms of mitochondrial dysfunction in T2DM, the obtained 65 genes were subjected to functional enrichment analysis. The results of GO enrichment analysis showed that the aforementioned 65 genes were involved in biological processes (BP) such as substance transport, response to stress and chemicals, regulation of biological quality and immune system processes (Fig. 3A); and these genes were mainly enriched in the regions of the endomembrane system, cytosol, vesicles, extracellular space and organelle membrane (Fig. 3B); furthermore, these genes were mainly associated with enzyme binding, oxidoreductase activity, active transmembrane transporter activity, receptor ligand activity and antigen binding-related molecular processes (Fig. 3C). KEGG enrichment analysis showed that the aforementioned 65 genes were mainly involved in biological pathways such as necroptosis, NOD-like receptor signaling pathway, Th17 cell differentiation, ferroptosis, D-glutamine and D-glutamate metabolism (Fig. 3D). The aforementioned findings suggest that mitochondrial dysfunction-related genes in T2DM affect disease progression through multiple pathways.

Figure 3.

Functional enrichment analysis of 65 key genes. The results of GO analysis demonstrated the key genes before their critical roles in (A) MF, (B) CC and (C) BP. (D) Results of KEGG analysis demonstrated the key genes' important pathways. GO, Gene Ontology; MF, molecular function; CC, cellular component; BP, biological process; KEGG, Kyoto Encyclopedia of Genes and Genomes.

Screening of biomarkers and validation of their predictive efficacy

Next, to screen T2DM biomarkers, the present study analyzed the key genes with a strong correlation with T2DM from the 65 genes mentioned aforementioned using three commonly used machine learning algorithms, namely Random forest (RF), SVM and Lasso logistic regression, respectively (Fig. 4A-C). Then, five key genes associated with T2DM were identified by plotting Venn diagrams, which were ERAP2, HLA-DQB1, HLA-DRB5, MAP1B and OAS3 (Fig. 4D). By analyzing the GSE184050 dataset, we found that ERAP2 was notably downregulated while HLA-DQB1, HLA-DRB5, MAP1B and OAS3 were upregulated in T2DM (Fig. 5A-E; P<0.05).

Figure 4.

Screening of biomarkers. (A) RF was used to screen biomarkers and rank the genes according to importance. (B) SVM was used to screen biomarkers. (C) Lasso logistic regression algorithm was used to screen biomarkers with different colors denoting different genes. (D) Venn diagrams was used to screen common potential biomarkers obtained from all three algorithms. RF, Random forest; SVM, support vector machine; Lasso, least absolute shrinkage and selection operator.

Figure 5.

Expression and predictive efficacy analysis of biomarkers in T2DM. (A-E) Expression levels of five biomarkers in the normal and T2DM groups. (A) ERAP2, (B) HLA-DQB1, (C) HLA-DRB5, (D) MAP1B and (E) OAS3. (F) ROC curves of five biomarkers independently predicting efficacy in T2DM. *P<0.05, ***P<0.001 and ****P<0.0001. T2DM, type 2 diabetes mellitus; ERAP2, endoplasmic reticulum aminopeptidase 2; HLA, human leukocyte antigen; MAPIB, microtubule-associated protein 1B; OAS3, 2′-5′-oligoadenylate synthetases 3; ROC, receiver operating characteristic; AUC, area under the curve.

In addition, the performance of ERAP2, HLA-DQB1, HLA-DRB5, MAP1B and OAS3 in the prediction of T2DM were further analyzed. MAP1B showed the best performance (AUC=0.759), while HLA-DRB5 had the worst predictive efficacy (AUC=0.574) in the prediction of T2DM (Fig. 5F). In addition, the results of the nomogram showed that the higher the expression levels of HLA-DQB1, HLA-DRB5, MAP1B and OAS3 and the lower the expression level of ERAP2, the higher the probability of T2DM occurrence (Fig. 6A). In addition, the calibration curves were almost identical to the ideal curves, indicating that our prediction model had high accuracy (Fig. 6B). And the overall predictive efficacy AUC value of the five marker genes reached 0.833, which was notably higher than the predictive efficacy of individual genes (Fig. 6C).

Figure 6.

Analysis of the overall predictive efficacy of the five biomarkers. (A) A nomogram was constructed based on the five biomarkers. (B) The calibration curves were almost identical to the ideal curves. (C) ROC curve showing the overall prediction efficacy of the five marker genes. ROC, receiver operating characteristic; AUC, area under the curve; HLA, human leukocyte antigen; ERAP2, endoplasmic reticulum aminopeptidase 2; OAS3, 2′-5′-oligoadenylate synthetase 3.

Target compound prediction and molecular docking

The present study identified target compounds for each of the five markers: 42 for ERAP2, 106 for OAS3, 59 for HLA-DQB1, 28 for HLA-DRB5 and 170 for MAP1B. The Venn diagram revealed two common compounds, valproic acid (VPA) and aflatoxin B1 (AFB1; Fig. 7A). Since VPA is used in cancer treatment and AFB1 is a carcinogen, only VPA was chosen for molecular docking with the five markers in the next study. Molecular docking results revealed that VPA formed stable hydrogen bonds with several proteins: ERAP2 (ARG185, LYS848, GLU813, TYR812), HLA-DQB1 (SER139, ARG149, LEU147), HLA-DRB5 (GLY1, GLY14), MAP1B (GLY1, GLY14, SER288, LYS375) and OAS3 (GLY66, ASN193) (Fig. 7B-F).

Figure 7.

Biomarker targeting compounds and molecular docking results of five biomarkers VPA. (A) Biomarker targeting compounds. (B) Docking site of VPA with ERAP2. (C) Docking site of VPA with HLA-DQB1; (D) Docking site of VPA with HLA-DRB5; (E) Docking site of VPA with MAPIB; (F) Docking site of VPA with OAS3. VPA, valproic acid; ERAP2, endoplasmic reticulum aminopeptidase 2; HLA, human leukocyte antigen; MAPIB, microtubule-associated protein 1B; OAS3, 2′-5′-oligoadenylate synthetases 3; ROC, receiver operating characteristic; AUC, area under the curve.

Correlation analysis of biomarkers and immune microenvironment

T2DM is a metaflammatory disease. MR analysis explored the link between CD4+ and CD8+ T cells and T2DM. The IVW test revealed a negative correlation between T2DM risk and GCST90001482 (Resting CD4 regulatory T cell), GCST90001492 (Secreting CD4 regulatory T cell) and GCST90001499 (Activated and resting CD4 regulatory T cell), while GCST90001548 (Central Memory CD8+ T cell) showed a positive correlation. The MR analysis (Table V) revealed significant associations between mitochondrial dysfunction-related genetic variants and T2DM risk mainly using the IVW method. Specifically, exposure factors GCST90001482, GCST90001548, GCST90001492 and GCST90001499 demonstrated causal effects on T2DM susceptibility (P<0.05). Additionally, heterogeneity tests (Table VI) indicated no substantial variability across genetic instruments (IVW Q-test P-values: 0.052–0.806), supporting homogeneity of effect estimates. Horizontal pleiotropy tests (Table VII) further confirmed the absence of significant bias (MR Egger intercept P-values: 0.250–0.843), validating the robustness of causal inferences. Collectively, these findings underscore mitochondrial dysfunction-related genes as potential contributors to T2DM progression, with minimal confounding from heterogeneity or pleiotropy (P>0.05). The error line remained stable after removing each SNP (Fig. S1), confirming the reliability and robustness of the predictions.

Table V.

Mendelian analysis between exposure factors and type 2 diabetes mellitus.

Table V.

Mendelian analysis between exposure factors and type 2 diabetes mellitus.

Exposure factorMethodnSNPbSEP-valuelo_ciup_ci
GCST90001482MR Egger11−0.0700.0950.478−0.2560.116
Weighted median11−0.0260.0230.250−0.0710.019
Inverse variance weighted11−0.0510.0230.027−0.097−0.006
Simple mode11−0.0200.0520.710−0.1210.082
Weighted mode11−0.0250.0250.335−0.0730.023
GCST90001492MR Egger8−0.0100.0050.101−0.0200.000
Weighted median8−0.0080.0050.071−0.0170.001
Inverse variance weighted8−0.0070.0040.049−0.0150.000
Simple mode8−0.0070.0120.574−0.0310.016
Weighted mode8−0.0080.0040.096−0.0160.000
GCST90001499MR Egger14−0.0120.0220.587−0.0550.030
Weighted median14−0.0110.0140.429−0.0370.016
Inverse variance weighted14−0.0320.0150.031−0.060−0.003
Simple mode14−0.0430.0260.129−0.0940.009
Weighted mode14−0.0130.0130.356−0.0380.013
GCST90001548MR Egger150.0390.0200.0680.0010.078
Weighted median150.0230.0160.159−0.0090.054
Inverse variance weighted150.0250.0120.0320.0020.048
Simple mode150.0250.0230.297−0.0200.070
Weighted mode150.0250.0140.101−0.0030.053

Table VI.

Risk heterogeneity test for exposure factors and type 2 diabetes mellitus.

Table VI.

Risk heterogeneity test for exposure factors and type 2 diabetes mellitus.

Exposure factorMethodQ Q-df Q-pval
GCST90001482MR Egger24.95690.302
Inverse variance weighted25.072100.052
GCST90001492MR Egger3.23360.779
Inverse variance weighted3.76770.806
GCST90001499MR Egger25.259120.136
Inverse variance weighted28.329130.081
GCST90001548MR Egger13.850130.384
Inverse variance weighted14.707140.398

Table VII.

Risk level horizontal pleiotropy test for exposure factors and type 2 diabetes mellitus.

Table VII.

Risk level horizontal pleiotropy test for exposure factors and type 2 diabetes mellitus.

Exposure factor egger_interceptSEP-value
GCST900014820.0040.0200.843
GCST900014920.0030.0040.493
GCST90001499−0.0070.0060.250
GCST90001548−0.0050.0050.386

Subsequently, the present study analyzed the expression levels of the aforementioned five biomarkers in immune cells. The results of the GSEA analysis indicated that the five biomarkers screened may be associated with IL-2 and IL-6 pathways, suggesting that they are associated with immune infiltration in T2DM (Fig. S2). Therefore, a detailed analysis was performed of the immune infiltration of T2DM using the EPIC algorithm. It was found that the number of CD4+ T cells and CD8+ T cells in T2DM was notably lower than that in the normal group; TNFRSF4, CEACAM1, PDCD1, SIRPA, ICOSLO, BTN2A2 and BTN2A1 were notably upregulated, while CD86, HLA-DMB, HLA-DOA and HLA-DPB1 was notably downregulated in the T2DM (Fig. 8A and B; P<0.05). Pearson correlation analysis showed that. OAS3 and MAP1B were negatively correlated with CD8+ T cells, while ERAP2 was positively correlated with CD8+ T cells (Fig. 8C; P<0.05). These suggested that changes in CD8+ T cells may affect the expression of these marker genes, which in turn affects the immune microenvironment in diabetes. In addition, MAP1B was notably correlated with all immune checkpoint genes except PDCD1 (Fig. 8C; P<0.05). The aforementioned findings suggested that MAP1B may regulate the development of diabetes by modulating the immune checkpoint pathway.

Figure 8.

Correlation analysis of biomarkers with immune infiltration and immune checkpoint genes. (A) Analysis of immune infiltration; (B) Difference in expression of immune checkpoint genes in normal and T2DM groups; (C) Pearson correlation of immune cells, immune checkpoints and marker genes, with blue color indicating negative correlation and red color indicating positive correlation. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.T2DM, type 2 diabetes mellitus; ns, no significant difference.

Results of single-cell sequencing analysis

The formation of islet inflammatory microenvironment and the interaction between immune cells have gradually attracted attention. Therefore, T2DM single-cell transcriptional profiles based on the GSE221156 dataset were analyzed. As shown in Fig. 9A and B, 27 cell populations were obtained by tSNE clustering analysis and seven major cell subpopulations, including epithelial cells, neuronal cells, smooth muscle cells, tissue stem cells, endothelial cells, macrophages and T cells, were identified by cell type annotation with the ‘SingleR’ package. Analysis of the results of cell interactions showed that each cell type was associated with each other to varying degrees, with tissue stem cells being the most strongly related to other cells (Fig. S3) and macrophages and T cells being important in the immune response (Fig. 9C). Subsequently, the expressions of the five biomarkers in cells were further analyzed and it was found that MAP1B was expressed in almost all cell types, but particularly in neuronal cells and tissue stem cells; ERAP2 was more prominently expressed in endothelial cells and HLA-DQB1, HLA-DRB5 and OAS3 were more prominently expressed in macrophages (Fig. 9D). Notably, the expression of the five marker genes was more prevalent in macrophages, suggesting that the role of these marker genes in T2DM may be closely related to macrophage function. Therefore, subsequent experiments endeavored to investigate the roles of the aforementioned five biomarkers in T2DM via cellular experiments.

Figure 9.

Analysis of cell types in T2DM based on single-cell sequencing data. (A) Cell populations identified by the GSE221156 dataset; (B) annotation of cell subpopulations. (C) Interaction diagram between cell types in 7. (D) Distribution of various cell types in normal, PD and T2DM samples. PD, prediabetic state; T2DM, type 2 diabetes mellitus; OAS3, 2′-5′-oligoadenylate synthetases; MAPIB, microtubule-associated protein 1B; ERAP2, endoplasmic reticulum aminopeptidase 2; HLA, human leukocyte antigen.

Detection of MAP1B and OAS3 expression levels in macrophages

In the aforementioned single-cell sequencing analysis results, five marker genes commonly expressed in macrophages were identified. The expression of these markers in T2DM-associated macrophages was then verified by cellular experiments. Due to the absence of murine sequences for ERAP2, HLA-DQB1 and HLA-DRB5 in the NCBI database, only MAP1B and OAS3 were validated experimentally. The RT-qPCR results showed that the expressions of MAP1B and OAS3 were notably increased in the HG group (Fig. 10; P<0.001). The results indicated that HG concentration notably induced the expression levels of MAP1B and OAS3 in macrophages.

Figure 10.

The expression levels of MAP1B and OAS3 were detected in RAW264.7 cells. (A) The expression of MAP1B was detected by RT-qPCR. (B) The expression of OAS3 was detected by RT-qPCR. ***P<0.001; ns, no significant difference. MAPIB, microtubule-associated protein 1B; OAS3, 2′-5′-oligoadenylate synthetases; RT-qPCR, reverse transcription-quantitative PCR; Ctrl, blank control group; NG, negative control group; HG, high glucose group.

Analysis of M1/M2 macrophage polarization in T2DM

To further explore the effect of T2DM on macrophage polarization, the expression of M1 macrophage markers (CD68, CD80, CD86 and CD32) and M2 macrophage markers (CD206, CD204 and CD163) were examined (Fig. 11). The results showed that the expression of M1 macrophage markers (except for CD32) was notably increased and the expression of M2 macrophage markers were decreased considerably under HG conditions (Fig. 11; P<0.01). The aforementioned findings suggested that in an HG environment, M1 macrophages and pro-inflammatory responses increase, while M2 macrophages and anti-inflammatory responses decrease. Future studies on M1/M2 polarization will focus on CD86 and CD204, as they showed the most significant expression differences.

Figure 11.

Detection of M1 macrophage and M2 macrophage polarization in T2DM. (A) Detection of the expression of M1 macrophage markers CD68, CD80, CD86 and CD32. (B) Detection of the expression of M2 macrophage markers CD206, CD204 and CD163. **P<0.01; ***P<0.001; ns, no significant difference; T2DM, type 2 diabetes mellitus; Ctrl, blank control group; NG, negative control group; HG, high glucose group.

Effects of MAP1B and OAS3 on macrophage M1/M2 polarization

To further investigate the effects of MAP1B and OAS3 in macrophage polarization, the present study initially assessed their expression levels in M1 and M2 macrophages. RAW264.7 cells were stimulated with TNF-α to induce M1 polarization and with IL-4 to induce M2 polarization. RT-qPCR analysis revealed a significant downregulation of MAP1B expression in the TNF-α group and a marked upregulation in the IL-4 group (Fig. 12A; P<0.001). Conversely, OAS3 expression was increased in the TNF-α group and decreased in the IL-4 group (Fig. 12B; P<0.01). These findings suggested that MAP1B is potentially associated with M2 macrophage polarization, whereas OAS3 appears to be linked to M1 macrophage polarization.

Figure 12.

The effects of MAP1B and OAS3 on macrophage polarization. Detection of (A) MAP1B and (B) OAS3 n levels in TNF-α and IL-4 groups. RT-qPCR to detect the levels of (C) MAP1B, (D) CD86 and (E) CD204 following transfection of siRNA#1-MAP1B or siRNA#2-MAP1B. RT-qPCR to detect the expressions of (F) OAS3, (G) CD86 and (H) CD204 following transfection of siRNA#1-OAS3 or siRNA#2-OAS3; **P<0.01; ***P<0.001. MAPIB, microtubule-associated protein 1B; OAS3, 2′-5′-oligoadenylate synthetases; RT-qPCR, reverse transcription-quantitative PCR; siRNA, small interfering RNA; NC, negative control.

To assess the effects of MAP1B and OAS3 on macrophage polarization, siRNA was used to inhibit their expression. RT-qPCR showed siRNA#1-MAP1B was more effective than siRNA#2-MAP1B (Fig. 12C; P<0.001), while siRNA#2-OAS3 outperformed siRNA#1-OAS3 (Fig. 12F; P<0.001). Inhibiting MAP1B increased M1 macrophage marker CD86 level and decreased M2 macrophage marker CD204 (Fig. 12D and E; P<0.001), whereas reducing OAS3 lowered CD86 and raised CD204 levels. (Fig. 12G and H; P<0.001). These results indicated that MAP1B promotes M2 macrophage polarization, whereas OAS3 promotes M1 macrophage polarization. Since significant M1 macrophage polarization in HG-induced RAW264.7 cells was observed in the aforementioned experiments, which is consistent with the role of OAS3, we aim to investigate the mechanism of OAS3 in macrophage polarization in depth in a follow-up study.

Downregulation of OAS3 expression attenuates M1 macrophage polarization by upregulating phosphorylated (p-)mTORC level

To explore the role of OAS3 expression on macrophage polarization in T2DM, the expression of OAS3 in HG-induced macrophages was knocked down by transfection with siRNA#2-OAS3. HG treatment notably increased the expression level of the M1 macrophage marker CD86 and notably decreased the expression level of the M2 macrophage marker CD204. By contrast, inhibition of OAS3 expression notably reversed the effect of HG treatment (Fig. 13A and B; P<0.001). The aforementioned data suggested that downregulation of OAS3 expression inhibited macrophage M1 polarization and promoted macrophage M2 polarization in a high-glucose environment, which attenuated the inflammatory response.

Figure 13.

OAS3 modulates macrophage polarization markers (CD86/CD204) and mTOR signaling in type 2 diabetes mellitus models. (A) RT-qPCR to detect the levels of CD86 and CD204. (B) Western blotting to detect the protein expression levels of CD86 and CD204. (C) RT-qPCR to detect the expressions of CD86. (D) Western blotting to detect the protein expressions of CD86. (E) Protein expression levels of mTORC and p-mTORC were detected by western blotting; **P<0.01; ***P<0.001; ns: no significant difference. RT-qPCR, reverse transcription-quantitative PCR; siRNA, small interfering RNA; NC, negative control; MAPIB, microtubule-associated protein 1B; OAS3, 2′-5′-oligoadenylate synthetases; p-, phosphorylated.

To further validate the role of OAS3 in M1 macrophage polarization, the OAS3 expression was downregulated in TNF-α-induced macrophages. The results of RT-qPCR and western blotting experiments showed that TNF-α treatment upregulated the expression of CD86 in macrophages and downregulation of OAS3 expression inhibited CD86 expression; moreover, downregulation of OAS3 reversed the TNF-α action (Fig. 13C and D; P<0.01). The results further indicated that OAS3 played a promoting role in M1 macrophage polarization and that downregulation of OAS3 notably inhibited M1-type polarization and attenuated inflammatory responses.

To explore the potential mechanism of OAS3-induced M1 macrophage polarization, GSEA was used and it was found that OAS3 showed activation in the mTORC1 signaling pathway (Fig. S2). Therefore, the effect of downregulation of OAS3 on proteins related to the mTORC1 signaling pathway in macrophages was examined. Western blotting results showed that there was no significant change in the levels of mTORC protein in each group (Fig. 13E). TNF-α induced a significant decrease in p-mTORC/mTORC protein levels in macrophages, whereas downregulation of OAS3 expression increased the value of p-mTORC/mTORC (Fig. 13E; P<0.001). In addition, downregulation of OAS3 expression reversed the effect of TNF-α, suggesting that downregulation of OAS3 expression attenuated macrophage M1 polarization by upregulating p-mTORC levels.

Discussion

Research has shown that there are a number of factors contributing to the global epidemic of diabetes, including an aging population, a sedentary lifestyle, obesity and an unhealthy daily diet (24). Prolonged hyperglycemia can cause damage to organs and tissues such as eyes, nerves, kidneys and cardiovascular organs, leading to a series of complications that pose a serious threat to human health and a huge burden on healthcare costs (12,25). The current classical drugs for the treatment of T2DM, such as metformin, sulfonylureas and thiazolidinediones, cause adverse reactions in patients to varying degrees (6). Therefore, through an in-depth study of the pathogenesis of T2DM and corresponding early analysis, the prediction, diagnosis and development of therapeutic drugs are of great significance to the clinical treatment of patients.

Currently, HbA1c is extensively utilized in the diagnosis of T2DM (8). Despite its high stability and convenience, it may result in misdiagnosis in certain cases, such as those involving anemia or ethnic differences (26). Fasting blood glucose (FPG) and the oral glucose tolerance test (OGTT) continue to be regarded as the gold standards for T2DM diagnosis, with OGTT being particularly sensitive in detecting early diabetes and prediabetes (27). Nevertheless, the complexity and cost associated with OGTT constrain its use in some regions. Consequently, novel biomarkers and assays for T2DM are being developed, which have the potential to transform future screening and diagnostic strategies for diabetes. Fructosamine and glycated albumin have been identified as valuable indicators for evaluating short-term glycemic control, particularly in patients necessitating frequent monitoring (28). A previous study proposed that fructosamine and glycated albumin may offer greater predictive value than HbA1c in certain populations (28). Furthermore, 1,5-AG serves as an additional marker for assessing short-term blood glucose fluctuations (29). 1,5-AG is particularly effective in monitoring postprandial hyperglycemia and its integration with HbA1c and FPG enhances the early detection rate of T2DM (29). These advances not only facilitate the early detection of diabetes but also enhance patient management and prognosis, thereby mitigating the risk of complications.

The pathogenesis of T2DM is characterized by a gradual loss of insulin secretion from β-cells due to inflammatory factors and the development of insulin resistance (6). Recently, researchers have demonstrated the relationship between mitochondrial dysfunction and insulin resistance, suggesting that mitochondrial dysfunction is significant in the pathogenesis and progression of T2DM (12). Previous studies have suggested that therapeutic modalities targeting mitochondria may effectively treat T2DM and its secondary defects (30,31). The present study aimed to investigate the role and mechanisms of genes associated with mitochondrial dysfunction in the risk prediction and progression of T2DM. Therefore, it combined bioinformatics analysis and experimental validation to investigate the role and mechanism of mitochondrial dysfunction-related genes in the prediction and development of T2DM risk.

First, the present study obtained five key genes associated with mitochondrial dysfunction in T2DM by bioinformatics analysis, including ERAP2, HLA-DQB1, HLA-DRB5, MAP1B and OAS3. It was demonstrated that ERAP2 played an important role in antigenic peptide processing, which is involved in the maturation of proteins in the endoplasmic reticulum and influences cytotoxic immune responses (32). ERAP2 was upregulated as a mitochondrial dysfunction-related gene in obstructive sleep apnea (33). HLA-DQB1 and HLA-DRB5 play an important role in the immune system by presenting peptides to T-cells and are differentially expressed in type 1 diabetes (34,35). The HLA-DQB1 allele is associated with T2DM and diabetic nephropathy in the Chinese Han population (36). MAP1B expression is associated with neurodevelopment and calcineurin-10 affects the progression of T2DM by regulating the cleavage of MAP1B (37,38). OAS3 expression is upregulated as a co-immunization biomarker in T2DM patients (39,40). The present study identified a significant downregulation of ERAP2 in T2DM, whereas the expressions of HLA-DQB1, HLA-DRB5, MAP1B and OAS3 were upregulated. In addition, MAP1B had an improved predictive performance for T2DM (AUC value of 0.759), whereas the AUC value was increased to 0.833 for the combined detection of the aforementioned five markers.

Addressing mitochondrial dysfunction could represent a novel therapeutic strategy for the management of T2DM (12). Pharmacological agents that enhance mitochondrial function, including specific antioxidants and mitochondrial protective compounds, may contribute to the restoration of normal metabolic processes, thereby improving insulin sensitivity and glycemic regulation (12,41). The present study explored the potential role of these five markers (ERAP2, HLA-DQB1, HLA-DRB5, MAP1B and OAS3) in the treatment of T2DM and the results showed that these genes collectively target VPA. Turnbull et al (42) demonstrated a modest decrease in blood glucose levels in Wistar rats treated with VPA following administration of VPA, a result that was confirmed in subsequent preclinical studies (43–45). Several clinical studies also found lower blood glucose levels in VPA-treated patients (46,47). In the present study, molecular docking results showed that VPA was able to bind to the five markers (ERAP2, HLA-DQB1, HLA-DRB5, MAP1B and OAS3) through the formation of a stable hydrogen bond toward binding. The findings indicate that investigating mitochondrial dysfunction offers a potential target for the development of innovative therapeutic strategies. Furthermore, early identification and intervention in mitochondrial dysfunction may mitigate the risk of diabetic complications, thereby enhancing quality of life and prognosis in patients.

Metabolic disorders associated with T2DM are intricately linked to immune system function (48). The metabolic condition of mitochondria influences not only energy production but also modulates the activity and functionality of immune cells (48). Studies have shown that immune system disorders are closely related to the progression of T2DM (49). Accumulation of immune cells and inflammatory mediators in pancreatic islets, as well as immune cell infiltration, is one of the key features of islet dysfunction (50). Previous studies have demonstrated the effect of T cells on T2DM (51–53). CD4+ T cells, as the main cells that make up the body's immune system, play a crucial role in the development of the disease. The helper T cells differentiated from CD4+ T cells contain three subpopulations, Th1, Th2 and Th17 and serum TNF-α secreted by Th1 cells and IL-4, IL-10 secreted by Th2 cells, as well as IL-17 secreted by Th17 cells, have been shown to play an important role in the development of diabetes (54–56). CD8+ T cells contribute to the development of chronic low-grade inflammation by secreting pro-inflammatory cytokines and expressing cytotoxic molecules (57,58). In addition, a number of studies have shown that macrophage infiltration is increased in pancreatic islets of T2DM patients (59–61). The present study found a significant decrease in the abundance of CD4+ T cells and CD8+ T cells and a substantial enrichment of macrophages in T2DM based on bioinformatics analysis. In addition, it found that CD4+ T cells were notably associated with ERAP2, whereas CD8+ T cells were notably associated with OAS3, MAP1B and ERAP2. Mitochondrial dysfunction is a critical factor in the pathogenesis of T2DM, notably influencing the immune microenvironment and thereby exacerbating insulin resistance and metabolic disorders. A comprehensive understanding of this intricate interaction is essential not only for elucidating the pathological mechanisms underlying T2DM but also for identifying potential targets for novel therapeutic strategies. Future research should further investigate the relationship between mitochondrial function and immune response to facilitate the development of more effective interventions for the management of T2DM.

Patients with T2DM develop an imbalance in macrophage M1/M2 polarization, which is manifested by an increase in pro-inflammatory M1 macrophages and a decrease in anti-inflammatory M2 macrophages (62). Chronic inflammation mediated by an imbalance in macrophage M1/M2 polarization may be a key factor in insulin resistance and pancreatic β-cell dysfunction (62). The present study revealed a significant increase in the expression of the M1 macrophage markers CD86, CD80 and CD68 and a decrease in the expression of the M2 macrophage markers CD204, CD206 and CD163 in a high-glucose environment. ERAP2, HLA-DQB1, HLA-DRB5, MAP1B and OAS3 are closely associated with immune responses and previous studies have reported their expression in macrophages (63–67). Since the murine sequences of ERAP2, HLA-DQB1 and HLA-DRB5 were not retrieved from the NCBI database, MAP1B and OAS3 were chosen for cellular experimental validation. One study notes that MAP1B could be used as a prognostic marker for bladder cancer patients and was notably positively correlated with the M2 macrophage-associated gene CD163 (66). Another study indicates that OAS3 was positively correlated with M1 macrophages in systemic lupus erythematosus (68). The present study showed that the expression of MAP1B and OAS3 was notably upregulated in HG-induced RAW264.7 cells and that the expression of MAP1B was higher in M2 macrophages. By contrast, the expression of OAS3 was higher in M1 macrophages. In addition, it was found that OAS3 showed activation in the mTORC1 signaling pathway by GSEA. A previous study confirmed that mTORC1 reduces insulin sensitivity by inhibiting insulin signaling (69). The present study found that downregulation of OAS3 expression attenuated M1 macrophage polarization by upregulating p-mTORC levels.

There are still some limitations to the present study. First, it obtained five biomarkers based on bioinformatics analysis, but since there were no mouse sequences for ERAP2, HLA-DQB1 and HLA-DRB5, Only MAP1B and OAS3 were experimentally validated. In addition, it was not experimentally demonstrated that VPA could target the expression of five biomarkers to alleviate the progression of T2DM. Future studies will conduct a more comprehensive analysis of the clinical application value and mechanism of action of the five biomarkers.

In conclusion, the present study screened five mitochondrial dysfunction biomarkers (ERAP2, HLA-DQB1, HLA-DRB5, MAP1B and OAS3) associated with T2DM and the combined detection of the aforementioned five markers has good efficacy in T2DM prediction. In addition, the aforementioned five marker genes may be target-regulated genes of VPA. Moreover, downregulation of OAS3 expression could attenuate the degree of M1 macrophage polarization by regulating the level of p-mTORC and thus regulate the progression of T2DM.

Supplementary Material

Supporting Data

Acknowledgements

Not applicable.

Funding

Funding: No funding was received.

Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

Authors' contributions

ML contributed to the conception and design. ML and HQ contributed to the collection and assembly of data. ML and HQ analyzed and interpreted the data. ML and HQ confirm the authenticity of all the raw data. Both authors read and approved the final version of the manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Diane A, Allouch A, Mu UMRBA and Al-Siddiqi HH: Endoplasmic reticulum stress in pancreatic β-cell dysfunctionality and diabetes mellitus: A promising target for generation of functional hPSC-derived β-cells in vitro. Front Endocrinol (Lausanne). 15:13864712024. View Article : Google Scholar : PubMed/NCBI

2 

Ding Y, Shi Y, Guan R, Yan S, Liu H, Wang Z, Li J, Wang T, Cai W and Ma G: Evaluation and comparison of efficacy and safety of tirzepatide and semaglutide in patients with type 2 diabetes mellitus: A Bayesian network meta-analysis. Pharmacol Res. 199:1070312024. View Article : Google Scholar : PubMed/NCBI

3 

Ye H, Wang R, Wei J, Wang Y, Zhang X and Wang L: Bioinformatics analysis identifies potential ferroptosis key gene in type 2 diabetic islet dysfunction. Front Endocrinol (Lausanne). 13:9043122022. View Article : Google Scholar : PubMed/NCBI

4 

Zheng Y, Ley SH and Hu FB: Global aetiology and epidemiology of type 2 diabetes mellitus and its complications. Nat Rev Endocrinol. 14:88–98. 2018. View Article : Google Scholar : PubMed/NCBI

5 

Sandoval DA and Patti ME: Glucose metabolism after bariatric surgery: Implications for T2DM remission and hypoglycaemia. Nat Rev Endocrinol. 19:164–176. 2023. View Article : Google Scholar : PubMed/NCBI

6 

Ruze R, Liu T, Zou X, Song J, Chen Y, Xu R, Yin X and Xu Q: Obesity and type 2 diabetes mellitus: Connections in epidemiology, pathogenesis and treatments. Front Endocrinol (Lausanne). 14:11615212023. View Article : Google Scholar : PubMed/NCBI

7 

Marin-Penalver JJ, Martin-Timon I, Sevillano-Collantes C and Del Canizo-Gomez FJ: Update on the treatment of type 2 diabetes mellitus. World J Diabetes. 7:354–395. 2016. View Article : Google Scholar : PubMed/NCBI

8 

Ortiz-Martinez M, Gonzalez-Gonzalez M, Martagon AJ, Hlavinka V, Willson RC and Rito-Palomares M: Recent developments in biomarkers for diagnosis and screening of type 2 diabetes Mellitus. Curr Diab Rep. 22:95–115. 2022. View Article : Google Scholar : PubMed/NCBI

9 

Rovira-Llopis S, Banuls C, Diaz-Morales N, Hernandez-Mijares A, Rocha M and Victor VM: Mitochondrial dynamics in type 2 diabetes: Pathophysiological implications. Redox Biol. 11:637–645. 2017. View Article : Google Scholar : PubMed/NCBI

10 

Baker ZN, Forny P and Pagliarini DJ: Mitochondrial proteome research: The road ahead. Nat Rev Mol Cell Biol. 25:65–82. 2024. View Article : Google Scholar : PubMed/NCBI

11 

Miwa S, Kashyap S, Chini E and von Zglinicki T: Mitochondrial dysfunction in cell senescence and aging. J Clin Invest. 132:2022. View Article : Google Scholar : PubMed/NCBI

12 

Pinti MV, Fink GK, Hathaway QA, Durr AJ, Kunovac A and Hollander JM: Mitochondrial dysfunction in type 2 diabetes mellitus: An Organ-based analysis. Am J Physiol Endocrinol Metab. 316:E268–E285. 2019. View Article : Google Scholar : PubMed/NCBI

13 

Palma FR, Gantner BN, Sakiyama MJ, Kayzuka C, Shukla S, Lacchini R, Cunniff B and Bonini MG: ROS production by mitochondria: Function or dysfunction? Oncogene. 43:295–303. 2024. View Article : Google Scholar : PubMed/NCBI

14 

Apostolova N, Vezza T, Muntane J, Rocha M and Victor VM: Mitochondrial dysfunction and mitophagy in type 2 diabetes: Pathophysiology and therapeutic targets. Antioxid Redox Signal. 39:278–320. 2023. View Article : Google Scholar : PubMed/NCBI

15 

Shan Z, Fa WH, Tian CR, Yuan CS and Jie N: Mitophagy and mitochondrial dynamics in type 2 diabetes mellitus treatment. Aging (Albany NY). 14:2902–2919. 2022. View Article : Google Scholar : PubMed/NCBI

16 

Shen S, Liao Q, Wong YK, Chen X, Yang C, Xu C, Sun J and Wang J: The role of melatonin in the treatment of type 2 diabetes mellitus and Alzheimer's disease. Int J Biol Sci. 18:983–994. 2022. View Article : Google Scholar : PubMed/NCBI

17 

Luo M, Zhao F, Cheng H, Su M and Wang Y: Macrophage polarization: An important role in inflammatory diseases. Front Immunol. 15:13529462024. View Article : Google Scholar : PubMed/NCBI

18 

Langfelder P and Horvath S: WGCNA: An R package for weighted correlation network analysis. BMC Bioinformatics. 9:5592008. View Article : Google Scholar : PubMed/NCBI

19 

Xie W, Li J, Du H and Xia J: Causal relationship between PCSK9 inhibitor and autoimmune diseases: A drug target Mendelian randomization study. Arthritis Res Ther. 25:1482023. View Article : Google Scholar : PubMed/NCBI

20 

Hemani G, Zheng J, Elsworth B, Wade KH, Haberland V, Baird D, Laurin C, Burgess S, Bowden J, Langdon R, et al: The MR-Base platform supports systematic causal inference across the human phenome. Elife. 7:e344082018. View Article : Google Scholar : PubMed/NCBI

21 

Yang S, Guo J, Kong Z, Deng M, Da J, Lin X, Peng S, Fu J, Luo T, Ma J, et al: Causal effects of gut microbiota on sepsis and sepsis-related death: Insights from genome-wide Mendelian randomization, single-cell RNA, bulk RNA sequencing and network pharmacology. J Transl Med. 22:102024. View Article : Google Scholar : PubMed/NCBI

22 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

23 

Shen B, Liu J, Wu D and Guo J: Evaluation of the safety and efficacy of high-dose rate brachytherapy for radiorecurrent prostate cancer: Asystematic review and meta-analysis. Strahlenther Onkol. 200:655–670. 2024. View Article : Google Scholar : PubMed/NCBI

24 

Namazi N, Moghaddam SS, Esmaeili S, Peimani M, Tehrani YS, Bandarian F, Shobeiri P, Nasli-Esfahani E, Malekpour MR, Rezaei N, et al: Burden of type 2 diabetes mellitus and its risk factors in North Africa and the Middle East, 1990–2019: findings from the Global Burden of Disease study 2019. BMC Public Health. 24:982024. View Article : Google Scholar : PubMed/NCBI

25 

Huang X, He Y, Xu H, Shen Y, Pan X, Wu J and Chen K: Association between sociodemographic status and the T2DM-related risks in China: Implication for reducing T2DM disease burden. Front Public Health. 11:12972032023. View Article : Google Scholar : PubMed/NCBI

26 

Herman WH: Are There Clinical implications of racial differences in HbA1c? Yes, to not consider can do great harm! Diabetes Care. 39:1458–1461. 2016.PubMed/NCBI

27 

Alidrisi HA, Al-Ibadi AA, Al-Saidi JS, Alsawad MA, Jameel AA and Al-Shati AW: Comparative analysis of glycemic and lipid profiles in newly diagnosed males and females with type 2 diabetes mellitus. Cureus. 15:e501012023.PubMed/NCBI

28 

Parrinello CM and Selvin E: Beyond HbA1c and glucose: The role of nontraditional glycemic markers in diabetes diagnosis, prognosis and management. Curr Diab Rep. 14:5482014. View Article : Google Scholar : PubMed/NCBI

29 

Xu H, Chen R, Hou X, Li N, Han Y and Ji S: The clinical potential of 1,5-anhydroglucitol as biomarker in diabetes mellitus. Front Endocrinol (Lausanne). 15:14715772024. View Article : Google Scholar : PubMed/NCBI

30 

Blagov A, Nedosugova L, Kirichenko T, Sukhorukov V, Melnichenko A and Orekhov A: Mitochondrial dysfunction as a factor of energy metabolism disorders in type 2 diabetes mellitus. Front Biosci (Schol Ed). 16:52024. View Article : Google Scholar : PubMed/NCBI

31 

Gao X, Yu X, Zhang C, Wang Y, Sun Y, Sun H, Zhang H, Shi Y and He X: Telomeres and mitochondrial metabolism: Implications for cellular senescence and Age-related diseases. Stem Cell Rev Rep. 18:2315–2327. 2022. View Article : Google Scholar : PubMed/NCBI

32 

Mattorre B, Caristi S, Donato S, Volpe E, Faiella M, Paiardini A, Sorrentino R and Paladini F: A Short ERAP2 that binds IRAP is expressed in macrophages independently of gene variation. Int J Mol Sci. 23:49612022. View Article : Google Scholar : PubMed/NCBI

33 

Liu Q, Hao T, Li L, Huang D, Lin Z, Fang Y, Wang D and Zhang X: Construction of a mitochondrial dysfunction related signature of diagnosed model to obstructive sleep apnea. Front Genet. 13:10566912022. View Article : Google Scholar : PubMed/NCBI

34 

Anderson K, Carey B, Martin A, Roark C, Chalk C, Nowell-Bostic M, Freed B, Aubrey M, Trapnell B and Fontenot A: Pulmonary alveolar proteinosis: An autoimmune disease lacking an HLA association. PLoS One. 14:e02131792019. View Article : Google Scholar : PubMed/NCBI

35 

Qiu YH, Deng FY, Tang ZX, Jiang ZH and Lei SF: Functional relevance for type 1 diabetes Mellitus-associated genetic variants by using integrative analyses. Hum Immunol. 76:753–758. 2015. View Article : Google Scholar : PubMed/NCBI

36 

Ma ZJ, Sun P, Guo G, Zhang R and Chen LM: Association of the HLA-DQA1 and HLA-DQB1 alleles in type 2 diabetes mellitus and diabetic nephropathy in the han ethnicity of China. J Diabetes Res. 2013:4525372013. View Article : Google Scholar : PubMed/NCBI

37 

Inoue H, Kanda T, Hayashi G, Munenaga R, Yoshida M, Hasegawa K, Miyagawa T, Kurumada Y, Hasegawa J, Wada T, et al: A MAP1B-cortactin-Tks5 axis regulates TNBC invasion and tumorigenesis. J Cell Biol. 223:e2023031022024. View Article : Google Scholar : PubMed/NCBI

38 

Hatta T, Iemura SI, Ohishi T, Nakayama H, Seimiya H, Yasuda T, Iizuka K, Fukuda M, Takeda J, Natsume T and Horikawa Y: Calpain-10 regulates actin dynamics by proteolysis of microtubule-associated protein 1B. Sci Rep. 8:167562018. View Article : Google Scholar : PubMed/NCBI

39 

Li XY, Hou L, Zhang LY, Zhang L, Wang D, Wang Z, Wen MZ and Yang XT: OAS3 is a Co-immune biomarker associated with tumour microenvironment, disease staging, prognosis and treatment response in multiple cancer types. Front Cell Dev Biol. 10:8154802022. View Article : Google Scholar : PubMed/NCBI

40 

Wu C, Chen X, Shu J and Lee CT: Whole-genome expression analyses of type 2 diabetes in human skin reveal altered immune function and burden of infection. Oncotarget. 8:34601–34609. 2017. View Article : Google Scholar : PubMed/NCBI

41 

Potenza MA, Sgarra L, Desantis V, Nacci C and Montagnani M: Diabetes and Alzheimer's Disease: Might mitochondrial dysfunction help deciphering the common path? Antioxidants (Basel). 10:12572021. View Article : Google Scholar : PubMed/NCBI

42 

Turnbull DM, Bone AJ, Tames FJ, Wilson L, Baird JD and Sherratt HS: The effect of valproate on blood metabolite concentrations in spontaneously diabetic, ketoacidotic, BB/E Wistar rats. Diabetes Res. 2:45–48. 1985.PubMed/NCBI

43 

Kuretu A, Arineitwe C, Mothibe M, Ngubane P, Khathi A and Sibiya N: Drug-induced mitochondrial toxicity: Risks of developing glucose handling impairments. Front Endocrinol (Lausanne). 14:11239282023. View Article : Google Scholar : PubMed/NCBI

44 

Stakisaitis D, Kapocius L, Kilimaite E, Gečys D, Šlekienė L, Balnytė I, Palubinskienė J and Lesauskaitė V: Preclinical study in mouse thymus and thymocytes: Effects of treatment with a combination of sodium dichloroacetate and sodium valproate on infectious inflammation pathways. Pharmaceutics. 15:27152023. View Article : Google Scholar : PubMed/NCBI

45 

Khan S and Jena G: Valproic acid improves glucose homeostasis by increasing beta-cell proliferation, function and reducing its apoptosis through HDAC inhibition in juvenile diabetic rat. J Biochem Mol Toxicol. 30:438–446. 2016. View Article : Google Scholar : PubMed/NCBI

46 

Cicek NP, Kamasak T, Serin M, Okten A, Alver A and Cansu A: The effects of valproate and topiramate use on serum insulin, leptin, neuropeptide Y and ghrelin levels in epileptic children. Seizure. 58:90–95. 2018. View Article : Google Scholar : PubMed/NCBI

47 

Tien N, Wu TY, Lin CL, Chu FY, Wang CCN, Hsu CY, Tsai FJ, Fang YJ and Lim YP: Association of epilepsy, anti-epileptic drugs (AEDs) and type 2 diabetes mellitus (T2DM): A population-based cohort retrospective study, impact of AEDs on T2DM-related molecular pathway and via peroxisome proliferator-activated receptor gamma transactivation. Front Endocrinol (Lausanne). 14:11569522023. View Article : Google Scholar : PubMed/NCBI

48 

Daryabor G, Atashzar MR, Kabelitz D, Meri S and Kalantar K: The effects of type 2 diabetes mellitus on organ metabolism and the immune system. Front Immunol. 11:15822020. View Article : Google Scholar : PubMed/NCBI

49 

Painter JD and Akbari O: Type 2 innate lymphoid cells: Protectors in type 2 Diabetes. Front Immunol. 12:7270082021. View Article : Google Scholar : PubMed/NCBI

50 

Song Y, He C, Jiang Y, Yang M, Xu Z, Yuan L, Zhang W and Xu Y: Bulk and single-cell transcriptome analyses of islet tissue unravel gene signatures associated with pyroptosis and immune infiltration in type 2 diabetes. Front Endocrinol (Lausanne). 14:11321942023. View Article : Google Scholar : PubMed/NCBI

51 

Zhang S, Gang X, Yang S, Cui M, Sun L, Li Z and Wang G: The alterations in and the role of the Th17/Treg balance in metabolic diseases. Front Immunol. 12:6783552021. View Article : Google Scholar : PubMed/NCBI

52 

Xia C, Rao X and Zhong J: Role of T lymphocytes in type 2 diabetes and diabetes-associated inflammation. J Diabetes Res. 2017:64947952017. View Article : Google Scholar : PubMed/NCBI

53 

Sun Q, Yang P, Gu QW, Gu WS, Wang W, Wang J and Mao XM: Increased glycemic variability results in abnormal differentiation of T cell subpopulation in type 2 diabetes patients. J Diabetes Complications. 38:1087382024. View Article : Google Scholar : PubMed/NCBI

54 

Abdel-Moneim A, Bakery HH and Allam G: The potential pathogenic role of IL-17/Th17 cells in both type 1 and type 2 diabetes mellitus. Biomed Pharmacother. 101:287–292. 2018. View Article : Google Scholar : PubMed/NCBI

55 

Wang C and Zhou B: Associations of blood glucose, helper T cells and cytokine levels with degree of periodontal lesion in type 2 diabetes mellitus patients accompanied by chronic periodontitis. Afr Health Sci. 23:239–245. 2023. View Article : Google Scholar : PubMed/NCBI

56 

Ju SH, Lim JY, Song M, Kim JM, Kang YE, Yi HS, Joung KH, Lee JH, Kim HJ and Ku BJ: Distinct effects of rosuvastatin and rosuvastatin/ezetimibe on senescence markers of CD8+ T cells in patients with type 2 diabetes mellitus: A randomized controlled trial. Front Endocrinol (Lausanne). 15:13363572024. View Article : Google Scholar : PubMed/NCBI

57 

Ju SH and Ku BJ: Effects of rosuvastatin/ezetimibe on senescence of CD8+ T-cell in type 2 diabetic patients with hypercholesterolemia: A study protocol. Medicine (Baltimore). 101:e316912022. View Article : Google Scholar : PubMed/NCBI

58 

Osawa Y, Studenski SA and Ferrucci L: Knee extension rate of velocity development affects walking performance differently in men and women. Exp Gerontol. 112:63–67. 2018. View Article : Google Scholar : PubMed/NCBI

59 

Gao D, Jiao J, Wang Z, Huang X, Ni X, Fang S, Zhou Q, Zhu X, Sun L, Yang Z and Yuan H: The roles of cell-cell and organ-organ crosstalk in the type 2 diabetes mellitus associated inflammatory microenvironment. Cytokine Growth Factor Rev. 66:15–25. 2022. View Article : Google Scholar : PubMed/NCBI

60 

Lee MK, Ryu H, Van JY, Kim MJ, Jeong HH, Jung WK, Jun JY and Lee B: The role of macrophage populations in skeletal muscle insulin sensitivity: Current understanding and implications. Int J Mol Sci. 24:114672023. View Article : Google Scholar : PubMed/NCBI

61 

Pivari F, Mingione A, Brasacchio C and Soldati L: Curcumin and Type 2 Diabetes Mellitus: Prevention and Treatment. Nutrients. 11:18372019. View Article : Google Scholar : PubMed/NCBI

62 

Banu S and Sur D: Role of macrophage in type 2 diabetes mellitus: macrophage polarization a new paradigm for treatment of type 2 diabetes mellitus. Endocr Metab Immune Disord Drug Targets. 23:2–11. 2023. View Article : Google Scholar : PubMed/NCBI

63 

Schachinger E, Chanda G, Lobo RP, Naito M and Pronin AV: Eliashberg analysis of the optical conductivity in superconducting Pr2CuOx with × ≃ 4. J Phys Condens Matter. 27:0457022015. View Article : Google Scholar : PubMed/NCBI

64 

Zhang JA, Zhou XY, Huang D, Luan C, Gu H, Ju M and Chen K: Development of an Immune-related gene signature for prognosis in melanoma. Front Oncol. 10:6025552020. View Article : Google Scholar : PubMed/NCBI

65 

O'Brien CL, Summers KM, Martin NM, Carter-Cusack D, Yang Y, Barua R, Dixit OVA, Hume DA and Pavli P: The relationship between extreme inter-individual variation in macrophage gene expression and genetic susceptibility to inflammatory bowel disease. Hum Genet. 143:233–261. 2024. View Article : Google Scholar : PubMed/NCBI

66 

Lyu X, Qiang Y, Zhang B, Xu W, Cui Y and Ma L: Identification of immuno-infiltrating MAP1A as a prognosis-related biomarker for bladder cancer and its ceRNA network construction. Front Oncol. 12:10165422022. View Article : Google Scholar : PubMed/NCBI

67 

Monti A, Lopez-Serrano J, Prieto A and Nicasio MC: Broad-scope amination of aryl sulfamates catalyzed by a palladium phosphine complex. ACS Catal. 13:10945–10952. 2023. View Article : Google Scholar : PubMed/NCBI

68 

Han Y, Liu S, Shi S, Shu Y, Lu C and Gu X: Screening of genes associated with immune infiltration of discoid lupus erythematosus based on weighted gene Co-expression network analysis. Biochem Genet. 63:465–482. 2025. View Article : Google Scholar : PubMed/NCBI

69 

Khalid M, Alkaabi J, Khan MAB and Adem A: Insulin signal transduction perturbations in insulin resistance. Int J Mol Sci. 22:85902021. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu M and Qiao H: Role and mechanism of mitochondrial dysfunction‑related gene biomarkers in the progression of type 2 diabetes mellitus. Mol Med Rep 31: 158, 2025.
APA
Liu, M., & Qiao, H. (2025). Role and mechanism of mitochondrial dysfunction‑related gene biomarkers in the progression of type 2 diabetes mellitus. Molecular Medicine Reports, 31, 158. https://doi.org/10.3892/mmr.2025.13523
MLA
Liu, M., Qiao, H."Role and mechanism of mitochondrial dysfunction‑related gene biomarkers in the progression of type 2 diabetes mellitus". Molecular Medicine Reports 31.6 (2025): 158.
Chicago
Liu, M., Qiao, H."Role and mechanism of mitochondrial dysfunction‑related gene biomarkers in the progression of type 2 diabetes mellitus". Molecular Medicine Reports 31, no. 6 (2025): 158. https://doi.org/10.3892/mmr.2025.13523
Copy and paste a formatted citation
x
Spandidos Publications style
Liu M and Qiao H: Role and mechanism of mitochondrial dysfunction‑related gene biomarkers in the progression of type 2 diabetes mellitus. Mol Med Rep 31: 158, 2025.
APA
Liu, M., & Qiao, H. (2025). Role and mechanism of mitochondrial dysfunction‑related gene biomarkers in the progression of type 2 diabetes mellitus. Molecular Medicine Reports, 31, 158. https://doi.org/10.3892/mmr.2025.13523
MLA
Liu, M., Qiao, H."Role and mechanism of mitochondrial dysfunction‑related gene biomarkers in the progression of type 2 diabetes mellitus". Molecular Medicine Reports 31.6 (2025): 158.
Chicago
Liu, M., Qiao, H."Role and mechanism of mitochondrial dysfunction‑related gene biomarkers in the progression of type 2 diabetes mellitus". Molecular Medicine Reports 31, no. 6 (2025): 158. https://doi.org/10.3892/mmr.2025.13523
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team