Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
February 2013 Volume 5 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February 2013 Volume 5 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Factors affecting the sensitivity of human-derived esophageal carcinoma cell lines to 5-fluorouracil and cisplatin

  • Authors:
    • Tetsuya Minegaki
    • Kohji Takara
    • Ryohei Hamaguchi
    • Masayuki Tsujimoto
    • Kohshi Nishiguchi
  • View Affiliations / Copyright

    Affiliations: Department of Clinical Pharmacy, Faculty of Pharmaceutical Sciences, Kyoto Pharmaceutical University, Kyoto 607-8414, Japan, Department of Clinical Pharmaceutics, Faculty of Pharmaceutical Sciences, Himeji Dokkyo University, Himeji 670-8524, Japan
  • Pages: 427-434
    |
    Published online on: November 5, 2012
       https://doi.org/10.3892/ol.2012.1014
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Effective chemotherapy against esophageal carcinoma is considered achievable with a combination of 5-fluorouracil (5-FU) and cisplatin (CDDP). However, chemotherapy remains ineffective in certain patients. The aim of this study was to clarify the factors which affect sensitivity to 5-FU and CDDP. The effects of factors known to influence sensitivity to 5-FU and CDDP, namely transporters, DNA repair enzymes and metabolic enzymes, were examined. mRNA levels of four transporters, SLC22A2, SLC23A2, ABCB1 and ABCC2, two DNA repair-related enzymes, Rad51 and MSH2, and one metabolic enzyme, dihydropyrimidine dehydrogenase (DPYD), showed a strong correlation (|r|>0.7) with IC50 values for 5-FU. In addition, the mRNA levels of ABCC2, MSH2 and DPYD showed a strong correlation (|r|>0.7) with the IC50 values for CDDP. Gimeracil, a DPYD inhibitor, enhanced the sensitivity of some cells to 5-FU but decreased the sensitivity of all the cells to CDDP. The inhibitory effects of ABCC2 with MK571 did not correspond to those observed in the correlation analysis. In conclusion, mRNA levels of SLC22A2, SLC23A2, ABCB1, ABCC2, Rad51, MSH2 and DPYD were confirmed to be strongly correlated with IC50 values for 5-FU, and mRNA levels of ABCC2, MSH2 and DPYD were confirmed to be strongly correlated with IC50 values for CDDP. In addition, the inhibition of DPYD appeared to affect the cytotoxicity of CDDP.

Introduction

In Japan, one-third of all mortalities are cancer-related (1). The incidence of lung, colorectal and breast cancer is increasing in Japan as well as worldwide (1). Esophageal carcinoma has a lower incidence than other types of cancer, but 5-fluorouracil (5-FU) and cisplatin (CDDP)-based chemoradiotherapy results in moderately high response and survival rates relative to other types of cancer. In fact, the complete response and 5-year survival rates following 5-FU and CDDP-based chemoradiotherapy have been reported to be 58 and 29%, respectively, among Japanese esophageal carcinoma patients (2). However, chemotherapy remains ineffective in certain patients. Therefore, identifying the factors that affect sensitivity to 5-FU and CDDP is necessary for enhancing the clinical outcome of chemotherapy for esophageal carcinoma.

Certain factors affecting sensitivity to 5-FU or CDDP have previously been revealed, including the molecular mechanisms involved in the cellular kinetics and dynamics of 5-FU and CDDP. For example, overexpression of the ABC transporter superfamily C5 (ABCC5/MRP5) decreases cellular accumulation of 5-FU, resulting in resistance to 5-FU (3). In addition, dihydropyrimidine dehydrogenase (DPYD), a 5-FU metabolizing enzyme, has been correlated with clinical response to 5-FU-based chemotherapy among colon cancer patients (4,5). The cytotoxic effects of CDDP are also attenuated by ERCC1, a DNA repair-related enzyme associated with restoration of DNA damage induced by chemotherapeutic agents or UV rays (6–8). However, there is little information concerning whether the levels of these molecules are predictive of sensitivity to 5-FU or CDDP in esophageal carcinoma.

In the present study, sensitivity to 5-FU and CDDP and mRNA levels of 35 genes, including drug transporters, DNA repair enzymes and metabolic enzymes, were evaluated in 5 human esophageal carcinoma cell lines. Based on these findings, factors affecting the sensitivity of esophageal carcinoma cells to 5-FU and CDDP were examined.

Materials and methods

Chemicals

5-FU was obtained from Sigma-Aldrich Chemical Co. (St. Louis, MO, USA). CDDP was purchased from Wako Pure Chemical Industries, Ltd. (Osaka, Japan). Gimeracil and MK571 were purchased from Toronto Research Chemicals, Inc. (Toronto, ON, Canada) and Cayman Chemical Company (Ann Arbor, MI, USA), respectively. 2-(4-Iodophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium, monosodium salt (WST-1) and 1-methoxy-5-methylphenazinium methylsulfate were purchased from Dojindo Laboratories (Kumamoto, Japan).

Cell culture

The human esophageal adenocarcinoma cell line OE33 was purchased from DS Pharma Biomedical Co., Ltd. (Osaka, Japan) and the squamous carcinoma cell lines KYSE30, KYSE70, KYSE140 and KYSE150 (9) were obtained from Health Science Research Resources Bank (Osaka, Japan). OE33 and the other cell lines were maintained in RPMI-1640 medium (Invitrogen Corp., Carlsbad, CA, USA) and Dulbecco’s modified Eagle’s medium (Invitrogen), respectively, supplemented with 10% heat-inactivated fetal bovine serum (lot no. 1335770 and 348777, Invitrogen). Cells were cultured in an atmosphere of 95% air and 5% CO2 at 37°C and subcultured every 3 or 4 days at a density of 1×106 cells/25 cm2 culture flask. The number of passages for OE33, KYSE30, KYSE70, KYSE140 and KYSE150 cells was 15–25, 15–28, 15–26, 21–31 and 19–31, respectively.

Growth rate of esophageal carcinoma cell lines

The growth rate of esophageal carcinoma cells was evaluated with a WST-1 assay utilizing succinate dehydrogenase activity. Cells were seeded onto a 96-well plate (Corning Inc., Corning, NY, USA) at a density of 5×103 cells/well/100 μl and cultured in an atmosphere of 95% air and 5% CO2 at 37°C. After 0, 6, 12, 18, 24, 36, 48, 72 and 96 h, the culture medium was exchanged for 110 μl of medium containing WST-1 reagent solution (10 μl WST-1 solution and 100 μl culture medium), and 3 h later the absorbance was determined using a micro-plate reader at 450 nm with a reference wavelength of 620 nm (SpectraFluor™, Tecan Group Ltd., Männedorf, Switzerland). The doubling time for cell growth was calculated from the logarithmic phase of a growth curve (10) as follows: Doubling time = (t1 - t0) × log102/(log10N1 - log10N0). N0 and N1 are the number of cells (% of day 0) at t1 and t0, respectively.

Growth inhibitory activity assay

Cells were seeded onto 96-well plates (Corning Inc.) at a density of 5×103 cells/well/100 μl on day 0. After incubation for 24 h, the culture medium was exchanged for one containing 5-FU or CDDP at various concentrations (day 1). On day 4, a WST-1 assay was performed as described above.

The effects of gimeracil and MK571 on the growth inhibitory effects of 5-FU and CDDP were also evaluated by WST-1 assay. Cells were incubated for 24 h as described above and the culture medium was exchanged for one containing 5-FU or CDDP at various concentrations with or without gimeracil (100 μM) or MK571 (50 μM). Following incubation for 72 h at 37°C, the culture medium was replaced with a medium containing WST-1 and the absorbance was measured.

The 50% growth inhibitory concentrations (IC50) were calculated according to the sigmoid inhibitory effect model: E = Emax × [1 - Cγ/(Cγ + IC50γ)], using the nonlinear least-squares fitting method (Solver, Microsoft® Excel). E and Emax represent the surviving fraction (% of control) and its maximum, respectively. C and γ are the drug concentration in the medium and the sigmoidicity factor, respectively. Relative sensitivity was calculated as follows: Relative sensitivity = IC50 (without gimeracil or MK571)/IC50 (with gimeracil or MK571).

Real-time reverse transcription (RT)-PCR

The mRNA expression levels were measured by real-time RT-PCR. Cells were seeded at a density of 2×106 cells/60 mm culture dish and 48 h later, total RNA was extracted from the cells with a GenEluteTM Mammalian Total RNA Miniprep kit (Sigma-Aldrich). Total RNA (1 μg) was used for RT with a PrimeScriptTM RT reagent kit (Takara Bio, Inc., Shiga, Japan) and a thermal cycler (i-Cycler, Bio-Rad Laboratories, Inc., Hercules, CA, USA). The RT reaction was conducted in 40 μl reaction buffer at 37°C for 15 min and terminated by heating at 85°C for 5 sec followed by cooling at 4°C.

Real-time PCR was performed with a 7500 Real-time PCR system (Applied Biosystems, Carlsbad, CA, USA) and SYBR Premix Ex Taq™ (Takara Bio, Inc.). The primer sequences are shown in Table I. PCR was performed at 95°C for 10 sec, followed by 40 cycles of 95°C for 5 sec and 60°C for 34 sec. Dissociation was initiated at 95°C for 15 sec followed by 60°C for 1 min and 95°C for 15 sec. To compare the relative expression of target mRNA levels between the cell lines, the comparative Ct method was used, as previously described (10); β-actin (ACTB) was used as an internal standard. Samples were prepared in duplicate and three independent sample sets were analyzed.

Table I.

Sequences of oligonucleotide primers designed for real-time PCR.

Table I.

Sequences of oligonucleotide primers designed for real-time PCR.

Function and geneForward (5′–3′)Reverse (5′–3′)Reference
ACTB TCATGAAGTGTGACGTGGACATC TGCATCCTGTCGGCAATG10
Transport
  SLC22A1 TCTTCCATCGTCACTGAGTTCAAC AGAAGCCCGCATTCAAACAG10
  SLC22A2 TCTACTCTGCCCTGGTTGAATTC ATGCAGCCCAAGGGTAACG10
  SLC22A3 TAGCCCCATTTCTGCTCTTTC AGATGGATGCCAGGATACCAA10
  SLC23A2 TCTTTGTGCTTGGATTTTCGAT ACGTTCAACACTTGATCGATTC23
  SLC31A1 ACAAGTCAGCATTCGCTACAATTC TTGCAGGAGGTGAGGAAAGC9
  ABCB1 TTCCTTCACCCAGGCAATG ATGAGTTTATGTGCCACCAAGTAGa
  ABCC1 CAGTGACCTCTGGTCCTTAAACAA TTGGCGCATTCCTTCTTCC24
  ABCC2 ACTTGTGACATCGGTAGCATGGA AAGAGGCAGTTTGTGAGGGATGAa
  ABCC3 GTCCGCAGAATGGACTTGAT TCACCACTTGGGGATCATTT25
  ABCC4 GCTCAGGTTGCCTATGTGCT CGGTTACATTTCCTCCTCCA25
  ABCC5 CGAAGGGTTGTGTGGATCTT GTTTCACCATGAAGGCTGGTa
  ABCC6 TGTCGCTCTTTGGAAAATCC AGGAACACTGCGAAGCTCAT25
  ABCG2 TGACGGTGAGAGAAAACTTAC TGCCACTTTATCCAGACCT26
  ATP7A AGATACTGGGACACTGGAGAAA AGGTCATCCCTTCCACTTTCA10
  ATP7B TGATTTATAACCTGGTTGGGATACC ATGAGAGCACCACAGACACAGA10
DNA repair
  ERCC1 TACAAGGCCTATGAGCAGAAACCA TCTCTTGATGCGGCGATGAGa
  ERCC2 CTGGAGGTGACCAAACTCATCTA CCTGCTTCTCATAGAAGTTGAGC27
  ERCC3 TATCCCAGGACACACAGGAAAT TCACCTTGAAGCTATAACCTTGAa
  XPA TGCGGCGAGCAGTAAGAAG TCATGGCCACACATAGTACAAGTCa
  Rad51 TGGGAACTGCAACTCATCTGG GCGCTCCTCTCTCCAGCAG28
  BRCA1 ACAGCTGTGTGGTGCTTCTGTG CATTGTCCTCTGTCCAGGCATC29
  BRCA2 TGAAGAGCAGTTAAGAGCCTTGAA ACGGTTGTGACATCCCTTGATAAAa
  HMGB1 CAAGCGAACAGCAGGGTTAG CAGATTGAGTCATTTGCTCCTCTTAa
  HMGB2 TGAACATCGCCCAAAGATCA TCAGACCACATTTCACCCAATTa
  MLH1 GATTACCCCTTCTGATTGACA ACTGAGGCTTTCAAAACA30
  MSH2 CAGTATATTGGAGAATCGCA AGGGCATTTGTTTCACC30
  PMS2 AGTCAGCGTGCAGCAGTTATT GACCATTTTGGCATACTCCTTCTa
  RPP25 AGAATGGTGGACAGTGGGATT TACTTCAGGTGCTCTTCGTGAATGa
Metabolism
  GSTP1 CTGCGCATGCTGCTGGCAGATC TTGGACTGGTACAGGGTGAGGTC31
  GCLC GGCAAGATACCTTTATGACCAGTT TGCAGCACTCAAAGCCATAA32
  GCLM TGACTGCATTTGCTAAACAATTTGA CGTGCGCTTGAATGTCAGG33
  TYSM GCCTCGGTGTGCCTTTCA CCCGTGATGTGCGCAAT34
  DPYD AATGATTCGAAGAGCTTTTGAAGC GTTCCCCGGATGATTCTGG35
  UMPS TAGTGTTTTGGAAACTGTTGAGGTT CTTGCCTCCCTGCTCTCTGT36
  MTHFR CGGGTTAATTACCACCTTGTCAA GCATTCGGCTGCAGTTCA36

a Primer sequences were designed using Primer Express® software. ACTB, β-actin.

Statistical analyses

Data are shown as the mean ± standard deviation (SD). Comparisons between 2 and among 3 or more groups were performed with Student’s unpaired t-test and repeated one-way analysis of variance (ANOVA) followed by Scheffe’s F test, respectively. P<0.05 (two-tailed) was considered to indicate a statistically significant result. The correlation analysis was performed using Pearson’s correlation coefficient (r).

Results

Growth rates of esophageal carcinoma cell lines

Table II shows the cell growth doubling times for the 5 esophageal carcinoma cell lines. Doubling times for the cells varied from 20 to 25 h, revealing a significant difference between lines. KYSE30 cells (20.1±1.41 h) had the shortest doubling time and OE33 cells (25.0±0.90 h) the longest.

Table II.

Doubling times of esophageal carcinoma cell lines.

Table II.

Doubling times of esophageal carcinoma cell lines.

Cell lineDoubling time, mean ± SD (h)
OE3325.0±0.90
KYSE3020.1±1.41
KYSE7021.8±0.51
KYSE14023.3±1.07
KYSE15020.6±0.53

[i] n=6.

Sensitivity of esophageal carcinoma cell lines to 5-FU and CDDP

The IC50 values for 5-FU were markedly different among the cell lines (0.524–30.2 μM); the OE33 cells showed the highest sensitivity to 5-FU and the KYSE30 cells the lowest sensitivity (Table III). In the case of CDDP, the IC50 values were also substantially different among the cell lines (2.17–19.5 μM). The rank order of sensitivity to CDDP was comparable to that for 5-FU.

Table III.

IC50 values for 5-FU and CDDP in esophageal carcinoma cell lines.

Table III.

IC50 values for 5-FU and CDDP in esophageal carcinoma cell lines.

IC50 value, mean ± SD (μM)
Cell line5-FUCDDP
OE330.524±0.082.17±0.33
KYSE3030.2±8.2919.5±3.67
KYSE7013.1±13.35.27±0.36
KYSE1401.88±0.383.09±0.67
KYSE1504.75±1.4614.0±1.02

[i] n=4. 5-FU, 5-fluorouracil; CDDP, cisplatin.

Correlation analysis of factors affecting drug sensitivity

The level of mRNA expression differed among the esophageal carcinoma cell lines (Table IV). The correlations between the IC50 values and the mRNA levels of the 35 different genes were analyzed (Table V). SLC22A3 mRNA was not detected in any cells, with the exception of the OE33 cell line. ABCC6 mRNA expression was not observed in KYSE30 and KYSE70 cells.

Table IV.

Expression levels of mRNA in esophageal carcinoma cell lines.

Table IV.

Expression levels of mRNA in esophageal carcinoma cell lines.

Expression ratio, mean ± SD (2−ΔCt×10−4)
Function and geneOE33KYSE30KYSE70KYSE140KYSE150
Transport
  SLC22A10.11±0.030.07±0.020.01±0.0030.03±0.020.12±0.07
  SLC22A20.49 ±0.150.16±0.030.23±0.030.87±0.450.47±0.36
  SLC22A336.3±9.24NDNDNDND
  SLC23A276.1±13.836.6±6.3959.8±4.6661.1±43.892.9±64.0
  SLC31A1125±26.6131±10.2179±23.4252±135244±147
  ABCB10.53±0.140.16±0.030.25±0.060.54±0.200.79±0.59
  ABCC174.7±11.337.0±3.83246±32.9123±75.667.8±36.6
  ABCC20.05±0.012.57±0.891.36±0.070.38±0.160.38±0.23
  ABCC380.5±15.110.2±2.6460.7±8.6240.6±23.3123±86.7
  ABCC426.1±2.1728.9±1.9552.1±5.53189±10592.5±51.3
  ABCC59.06±1.3062.14±17.065.38±8.6022.92±10.626.76±19.2
  ABCC61.79±0.12NDND0.05±0.050.04±0.04
  ABCG26.25±1.294.64±0.211.66±0.342.47±0.6933.1±18.3
  ATP7A8.66±1.277.99±0.704.68±1.206.09±3.6115.4±7.98
  ATP7B1.91±0.251.89±0.732.21±0.475.72±4.773.37±2.69
DNA repair
  ERCC1219±66.1143±35.896.3±13.2241±131296±175
  ERCC243.9±4.5735.1±8.0121.0±2.5247.9±22.452.2±22.6
  ERCC382.3±11.579.3±19.457.4±6.31134±97.9185±104
  XPA91.4±16.0107±16.7193±14.8461±290283±164
  Rad513.84±1.032.64±0.373.67±1.096.09±3.074.72±1.75
  BRCA190.5±15.661.1±2.4665.3±4.56188±116151±78.8
  BRCA2110±20.4111±3.9943.5±3.74261±165204±108
  HMGB135.2±7.2935.9±1.8451.4±3.9879.9±47.837.6±19.1
  HMGB2509±87.31340±1501343±1291980±9471367±679
  MLH127.5±4.5521.3±1.6123.9±1.8328.2±18.470.9±36.8
  MSH2185±39.8540±38.6331±23.5338±154272±114
  PMS225.3±3.2234.2±4.2477.1±12.8123±81.667.0±42.8
  RPP2527.5±4.356.32±0.990.13±0.0374.9±59.90.74±0.47
Metabolism
  GSTP12444 ±4252926±6443421±3805784±35497249±3978
  GCLC5.21±0.513.87±1.1545.0±4.3010.8±4.419.05±5.39
  GCLM8.38±2.6131.34±4.3075.1±10.833.0±15.432.1±22.2
  TYMS54.0±11.6163±3.102511±13681.8±32.9215.6±102
  DPYD5.81±2.0362.4±6.500.82±0.291.23±0.8712.4±9.82
  UMPS85.6±17.469.0±3.85162±20.6183±108165±73.2
  MTHFR5.78±1.8510.0±2.3918.6±2.7225.6±23.223.7±15.3

[i] ΔCt = Ct (target gene) - Ct (β-actin). ND, not detected; n=3.

Table V.

Pearson’s correlation coefficient between IC50 values for 5-FU or CDDP and mRNA expression level.

Table V.

Pearson’s correlation coefficient between IC50 values for 5-FU or CDDP and mRNA expression level.

Pearson’s correlation coefficient (r)
Function and gene5-FUCDDP
Transport
  SLC22A1−0.1890.333
  SLC22A2−0.764−0.574
  SLC22A3NDND
  SLC23A2−0.790−0.302
  SLC31A1−0.477−0.132
  ABCB1−0.788−0.215
  ABCC1−0.150−0.530
  ABCC20.992b0.706
  ABCC3−0.659−0.179
  ABCC4−0.470−0.315
  ABCC50.5730.234
  ABCC6NDND
  ABCG2−0.2440.398
  ATP7A−0.1990.451
  ATP7B−0.485−0.314
DNA repair
  ERCC1−0.638−0.041
  ERCC2−0.5330.019
  ERCC3−0.4390.187
  XPA−0.463−0.284
  Rad51−0.756−0.523
  BRCA1−0.653−0.274
  BRCA2−0.455−0.049
  HMGB1−0.341−0.507
  HMGB20.0100.125
  MLH1−0.3690.269
  MSH20.913a0.719
  PMS2−0.363−0.365
  RPP25−0.486−0.561
Metabolism
  GSTP1−0.4010.121
  GCLC0.032−0.321
  GCLM0.287−0.011
  TYMS0.163−0.211
  DPYD0.8810.863
  UMPS−0.522−0.379
  MTHFR−0.319−0.074

{ label (or @symbol) needed for fn[@id='tfn5-ol-05-02-0427'] } ND, not detected.

a P<0.05 and

b P<0.01 significant correlations between IC50 values and mRNA expression levels. 5-FU, 5-fluorouracil; CDDP, cisplatin.

The mRNA levels of SLC22A2, SLC23A2, ABCB1 and Rad51 showed a strong negative correlation (r<−0.7) with the IC50 values for 5-FU. ABCC2, MSH2 and DPYD were positively correlated with the IC50 values for 5-FU (r>0.7; Table V and Fig. 1). In the case of CDDP, a high positive correlation coefficient (r>0.7) was found between the IC50 values and ABCC2, MSH2 and DPYD mRNA expression (Table V and Fig. 2).

Figure 1.

Correlation between IC50 values for 5-FU and mRNA expression levels in the esophageal carcinoma cell lines. The IC50 values for 5-FU were obtained from growth inhibition studies (Table III). The mRNA expression levels (2−ΔCt) in the cells were evaluated by real-time RT-PCR assay using SYBR®-Green. The threshold cycle (Ct) values were used to quantify the PCR product, and the relative expression level of the target gene was expressed as 2−ΔCt. The ΔCt was calculated by subtracting Ct (β-actin; as an internal standard) from Ct (target gene). 5-FU, 5-fluorouracil; RT, reverse transcription.

Figure 2.

Correlation between the IC50 values for CDDP and mRNA expression levels in the esophageal carcinoma cell lines. The IC50 values for CDDP were obtained from growth inhibition studies (Table III). The mRNA expression levels (2−ΔCt) in the cells were evaluated by real-time RT-PCR assay using SYBR®-Green. The threshold cycle (Ct) values were used to quantify the PCR product, and the relative expression level of the target gene was expressed as 2−ΔCt. ΔCt was calculated by subtracting Ct (β-actin; as an internal standard) from Ct (target gene). CDDP, cisplatin; RT, reverse transcription.

Effects of gimeracil and MK571 on sensitivity of esophageal carcinoma cell lines to 5-FU and CDDP

The sensitivity of KYSE30 cells to 5-FU was enhanced by gimeracil, but in the other cell lines gimeracil had no observable effect (Table VI). In addition, gimeracil showed a tendency to decrease the sensitivity of all the cell lines to CDDP.

Table VI.

Relative sensitivity of the esophageal carcinoma cell lines to 5-FU or CDDP with or without gimeracil.

Table VI.

Relative sensitivity of the esophageal carcinoma cell lines to 5-FU or CDDP with or without gimeracil.

Relative sensitivity, mean ± SD (fold)
Cell line5-FUCDDP
OE331.10±0.370.579±0.06
KYSE302.30±0.130.710±0.03
KYSE701.16±0.190.687±0.05
KYSE1400.989±0.150.691±0.10
KYSE1501.19±0.160.788±0.25

[i] Relative sensitivity, the ratio of IC50 value for 5-FU or CDDP without gimeracil to those with gimeracil (n=4). Gimeracil, 100 μM. 5-FU, 5-fluorouracil; CDDP, cisplatin.

MK571 had no observable effect on the KYSE30, KYSE140 and KYSE150 cells (Table VII). However, the sensitivity of KYSE70 cells to 5-FU was substantially accelerated by the presence of MK571, and the sensitivity of OE33 cells to 5-FU was markedly decreased. However, MK571 showed a tendency to decrease sensitivity to CDDP, with the exception of the KYSE30 and KYSE150 cell lines.

Table VII.

Relative sensitivity of the esophageal carcinoma cell lines to 5-FU or CDDP with or without MK571.

Table VII.

Relative sensitivity of the esophageal carcinoma cell lines to 5-FU or CDDP with or without MK571.

Relative sensitivity, mean ± SD (fold)
Cell line5-FUCDDP
OE330.0680±0.010.852±0.28
KYSE300.961±0.060.974±0.09
KYSE702.36±1.360.617±0.06
KYSE1400.813±0.160.803±0.04
KYSE1500.731±0.111.08±0.26

[i] Relative sensitivity, the ratio of IC50 values for 5-FU or CDDP without MK571 to those with MK571 (n=4). MK571, 50 μM. 5-FU, 5-fluorouracil; CDDP, cisplatin.

Discussion

Combination chemotherapy with 5-FU and CDDP is known to be effective against esophageal carcinoma. However, it remains ineffective in certain patients, and the causes for this have not been clarified. The aim of the present study was to examine the factors affecting the sensitivity of esophageal carcinoma cells to 5-FU and CDDP.

The sensitivity of the 5 different esophageal carcinoma cell lines to 5-FU and CDDP differed (Table III). OE33, an adenocarcinoma cell line, showed a high sensitivity to 5-FU and CDDP, whereas the squamous cell carcinoma KYSE30 cells showed low sensitivity to 5-FU and CDDP. In addition, OE33 cells had the longest doubling time (an index of cell growth) of all the cell lines and KYSE30 cells the shortest (Table II), resulting in a trend for lower sensitivity to chemo-therapeutic agents among cells with higher growth activity. These findings suggest that sensitivity to 5-FU and CDDP was influenced by the growth activity of cells, although cytotoxic agents such as 5-FU and CDDP are known to be more toxic in cells with higher growth activity. In order to resolve this discrepancy, further studies concerning the correlation between cell growth and sensitivity to 5-FU or CDDP should be performed.

The correlations between sensitivity to 5-FU and CDDP and the mRNA levels of the 35 genes were then examined. The levels of target mRNA expression differed among the cell lines (Table IV). The mRNA levels of ABCC2, MSH2 and DPYD were positively correlated with the IC50 values of 5-FU (r>0.7; Fig. 1 and Table V). By contrast, a negative correlation between the IC50 values of 5-FU and the mRNA levels of SLC22A2, SLC23A2, ABCB1 and Rad51 was observed. In the light of the biological roles of these genes, the negative correlation between SLC22A2 and SLC23A2 mRNA expression and sensitivity was considered to be noteworthy. SLC22A2 encodes an organic cation transporter which is responsible for cell uptake of various drugs, including CDDP (11,12). A colon carcinoma cell line exhibiting resistance to 5-FU has been reported to show lower expression of SLC23A2 mRNA than its parent cells (13). ABCC2, MSH2 and DPYD are known to act in detoxifying mechanisms; they are an efflux transporter, DNA repair-related protein and metabolic enzyme, respectively. Although ABCB1 is a known efflux transporter that contributes to drug resistance, the cytotoxicity of 5-FU was not influenced by the expression of ABCB1 (14). In addition, the overexpression of DNA-repair related proteins, including Rad51, has been reported to contribute to resistance to DNA damaging agents (15). Although the present findings showing a negative correlation between IC50 values and ABCB1 and Rad51 mRNA expression levels conflict with previous findings, they may indicate that ABCB1 and Rad51 have no significant impact on sensitivity.

In the case of CDDP, a positive correlation (r>0.7) between the IC50 values and the mRNA levels of ABCC2, MSH2 and DPYD was identified. The findings for ABCC2 and MSH2 are supported by their functions; the export of CDDP from cells (16) and repair of DNA damaged by CDDP (17), respectively (Table V and Fig. 2). In addition, proliferating cell nuclear antigen-normalized mRNA expression of DPYD has previously been reported to be associated with sensitivity to CDDP in lung cancer tissues (18). Although the correlation between CDDP and DPYD has not been investigated in detail, these previous results may support the present findings. The mRNA levels of ABCC2, MSH2 and DPYD correlated well with sensitivity to both 5-FU and CDDP, suggesting that these are potent predictive factors for 5-FU and CDDP-based chemotherapy in esophageal carcinoma patients.

Finally, the roles of ABCC2 and DPYD in sensitivity to 5-FU and CDDP were examined, since the knock-down of MSH2 in SW460 and HeLa cells has been reported to have no influence on sensitivity to 5-FU (19). In the present study, 100 μM gimeracil, which showed sufficient inhibition of DPYD (20), enhanced 5-FU sensitivity in the KYSE30 cell line (Table VI), which had the highest level of DPYD mRNA expression of all the cell lines tested (Table IV). The present findings support those of Ando et al(21); that is, DPYD was a predictor of sensitivity to 5-FU. Apart from the correlation analysis, gimeracil decreased sensitivity to CDDP in all cell lines (Table VI), implying that DPYD activity may be required for the cytotoxic effect of CDDP. Further investigations are required to resolve this contradiction. The concomitant administration of 50 μM MK571, a representative ABCC2 inhibitor (22), was found to decrease the sensitivity of OE33 and KYSE150 cells to 5-FU. In addition, the growth inhibitory activity of CDDP was decreased in KYSE30 and KYSE150 cell lines (Table VII). These findings conflict with the function of ABCC2 function as an efflux transporter, and further investigations are required to clarify this situation.

In conclusion, the mRNA levels of SLC22A2, SLC23A2, ABCB1, ABCC2, Rad51, MSH2 and DPYD were confirmed to be strongly correlated with the IC50 values for 5-FU, and those of ABCC2, MSH2 and DPYD were also confirmed to be strongly correlated with the IC50 values for CDDP. These genes have the potential to affect the sensitivity to 5-FU and CDDP. In addition, the inhibition of DPYD was suggested to affect the cytotoxicity of CDDP. These findings provide useful information for improving the clinical outcome of chemotherapy against esophageal carcinoma.

Acknowledgements

This study was supported in part by a grant of Strategic Research Foundation Grant-aided Project for Private Universities from the Ministry of Education, Culture, Sport, Science and Technology, Japan.

References

1. 

National Cancer Center: Cancer statistics in Japan: 2011, http://ganjoho.jp/public/statistics/backnumber/2011_jp.html. Accessed June 29, 2012.

2. 

Tahara M, Ohtsu A, Hironaka S, Boku N, Ishikura S, Miyata Y, Ogino T and Yoshida S: Clinical impact of criteria for complete response (CR) of primary site to treatment of esophageal cancer. Jpn J Clin Oncol. 35:316–323. 2005. View Article : Google Scholar : PubMed/NCBI

3. 

Pratt S, Shepard RL, Kandasamy RA, Johnston PA, Perry W III and Dantzig AH: The multidrug resistance protein 5 (ABCC5) confers resistance to 5-fluorouracil and transports its monophosphorylated metabolites. Mol Cancer Ther. 4:855–863. 2005. View Article : Google Scholar : PubMed/NCBI

4. 

Kornmann M, Schwabe W, Sander S, Kron M, Sträter J, Polat S, Kettner E, Weiser HF, Baumann W, Schramm H, Häusler P, Ott K, Behnke D, Staib L, Beger HG and Link KH: Thymidylate synthase and dihydropyrimidine dehydrogenase mRNA expression levels: predictors for survival in colorectal cancer patients receiving adjuvant 5-fluorouracil. Clin Cancer Res. 9:4116–4124. 2003.

5. 

Ciaparrone M, Quirino M, Schinzari G, Zannoni G, Corsi DC, Vecchio FM, Cassano A, La Torre G and Barone C: Predictive role of thymidylate synthase, dihydropyrimidine dehydrogenase and thymidine phosphorylase expression in colorectal cancer patients receiving adjuvant 5-fluorouracil. Oncology. 70:366–377. 2006. View Article : Google Scholar

6. 

Larminat F and Bohr VA: Role of the human ERCC-1 gene in gene-specific repair of cisplatin-induced DNA damage. Nucleic Acids Res. 22:3005–3010. 1994. View Article : Google Scholar : PubMed/NCBI

7. 

Andersson BS, Sadeghi T, Siciliano MJ, Legerski R and Murray D: Nucleotide excision repair genes as determinants of cellular sensitivity to cyclophosphamide analogs. Cancer Chemother Pharmacol. 38:406–416. 1996. View Article : Google Scholar : PubMed/NCBI

8. 

Hsu DS, Lan HY, Huang CH, Tai SK, Chang SY, Tsai TL, Chang CC, Tzeng CH, Wu KJ, Kao JY and Yang MH: Regulation of excision repair cross-complementation group 1 by Snail contributes to cisplatin resistance in head and neck cancer. Clin Cancer Res. 16:4561–4571. 2010. View Article : Google Scholar : PubMed/NCBI

9. 

Shimada Y, Imamura M, Wagata T, Yamaguchi N and Tobe T: Characterization of 21 newly established esophageal cancer cell lines. Cancer. 69:277–284. 1992. View Article : Google Scholar : PubMed/NCBI

10. 

Kitada N, Takara K, Minegaki T, Itoh C, Tsujimoto M, Sakaeda T and Yokoyama T: Factors affecting sensitivity to antitumor platinum derivatives of human colorectal tumor cell lines. Cancer Chemother Pharmacol. 62:577–584. 2008. View Article : Google Scholar : PubMed/NCBI

11. 

Kimura N, Masuda S, Tanihara Y, Ueo H, Okuda M, Katsura T and Inui K: Metformin is a superior substrate for renal organic cation transporter OCT2 rather than hepatic OCT1. Drug Metab Pharmacokinet. 20:379–386. 2005. View Article : Google Scholar : PubMed/NCBI

12. 

Filipski KK, Loos WJ, Verweij J and Sparreboom A: Interaction of Cisplatin with the human organic cation transporter 2. Clin Cancer Res. 14:3875–3880. 2008. View Article : Google Scholar : PubMed/NCBI

13. 

Karasawa H, Miura K, Fujibuchi W, Ishida K, Kaneko N, Kinouchi M, Okabe M, Ando T, Murata Y, Sasaki H, Takami K, Yamamura A, Shibata C and Sasaki I: Down-regulation of cIAP2 enhances 5-FU sensitivity through the apoptotic pathway in human colon cancer cells. Cancer Sci. 100:903–913. 2009. View Article : Google Scholar : PubMed/NCBI

14. 

Takara K, Obata Y, Yoshikawa E, Kitada N, Sakaeda T, Ohnishi N and Yokoyama T: Molecular changes to HeLa cells on continuous exposure to cisplatin or paclitaxel. Cancer Chemother Pharmacol. 58:785–793. 2006. View Article : Google Scholar : PubMed/NCBI

15. 

Takenaka T, Yoshino I, Kouso H, Ohba T, Yohena T, Osoegawa A, Shoji F and Maehara Y: Combined evaluation of Rad51 and ERCC1 expressions for sensitivity to platinum agents in non-small cell lung cancer. Int J Cancer. 121:895–900. 2007. View Article : Google Scholar : PubMed/NCBI

16. 

Noma B, Sasaki T, Fujimoto Y, Serikawa M, Kobayashi K, Inoue M, Itsuki H, Kamigaki M, Minami T and Chayama K: Expression of multidrug resistance-associated protein 2 is involved in chemotherapy resistance in human pancreatic cancer. Int J Oncol. 33:1187–1194. 2008.PubMed/NCBI

17. 

Lan L, Hayashi T, Rabeya RM, Nakajima S, Kanno S, Takao M, Matsunaga T, Yoshino M, Ichikawa M, Riele H, Tsuchiya S, Tanaka K and Yasui A: Functional and physical interactions between ERCC1 and MSH2 complexes for resistance to cisdiamminedichloroplatinum(II) in mammalian cells. DNA Repair (Amst). 3:135–143. 2004. View Article : Google Scholar : PubMed/NCBI

18. 

Takizawa M, Kawakami K, Obata T, Matsumoto I, Ohta Y, Oda M, Sasaki T and Watanabe G: In vitro sensitivity to platinum-derived drugs is associated with expression of thymidylate synthase and dihydropyrimidine dehydrogenase in human lung cancer. Oncol Rep. 15:1533–1539. 2006.

19. 

Pettersen HS, Visnes T, Vågbø CB, Svaasand EK, Doseth B, Slupphaug G, Kavli B and Krokan HE: UNG-initiated base excision repair is the major repair route for 5-fluorouracil in DNA, but 5-fluorouracil cytotoxicity depends mainly on RNA incorporation. Nucleic Acids Res. 39:8430–8444. 2011. View Article : Google Scholar : PubMed/NCBI

20. 

Li Y, Mizutani Y, Shiraishi T, Nakamura T, Mikami K, Takaha N, Okihara K, Kawauchi A, Sakai T and Miki T: The significance of the expression of dihydropyrimidine dehydrogenase in prostate cancer. BJU Int. 99:663–668. 2007. View Article : Google Scholar : PubMed/NCBI

21. 

Ando T, Ishiguro H, Kuwabara Y, Kimura M, Mitsui A, Sugito N, Mori R, Ogawa R, Katada T and Fujii Y: Relationship between expression of 5-fluorouracil metabolic enzymes and 5-fluorouracil sensitivity in esophageal carcinoma cell lines. Dis Esophagus. 21:15–20. 2008.PubMed/NCBI

22. 

Pedersen JM, Matsson P, Bergström CA, Norinder U, Hoogstraate J and Artursson P: Prediction and identification of drug interactions with the human ATP-binding cassette transporter multidrug-resistance associated protein 2 (MRP2; ABCC2). J Med Chem. 51:3275–3287. 2008. View Article : Google Scholar : PubMed/NCBI

23. 

Reidling JC, Subramanian VS, Dahhan T, Sadat M and Said HM: Mechanisms and regulation of vitamin C uptake: studies of the hSVCT systems in human liver epithelial cells. Am J Physiol Gastrointest Liver Physiol. 295:1217–1227. 2008. View Article : Google Scholar : PubMed/NCBI

24. 

Nishimura M, Koeda A, Morikawa H, Satoh T, Narimatsu S and Naito S: Comparison of inducibility of multidrug resistance (MDR)1, multidrug resistance-associated protein (MRP)1, and MRP2 mRNAs by prototypical microsomal enzyme inducers in primary cultures of human and cynomolgus monkey hepatocytes. Biol Pharm Bull. 31:2068–2072. 2008. View Article : Google Scholar

25. 

Maubon N, Le Vee M, Fossati L, Audry M, Le Ferrec E, Bolze S and Fardel O: Analysis of drug transporter expression in human intestinal Caco-2 cells by real-time PCR. Fundam Clin Pharmacol. 21:659–663. 2007. View Article : Google Scholar : PubMed/NCBI

26. 

Dauchy S, Miller F, Couraud PO, Weaver RJ, Weksler B, Romero IA, Scherrmann JM, De Waziers I and Declèves X: Expression and transcriptional regulation of ABC transporters and cytochromes P450 in hCMEC/D3 human cerebral micro-vascular endothelial cells. Biochem Pharmacol. 77:897–909. 2009. View Article : Google Scholar

27. 

Shimizu J, Horio Y, Osada H, Hida T, Hasegawa Y, Shimokata K, Takahashi T, Sekido Y and Yatabe Y: mRNA expression of RRM1, ERCC1 and ERCC2 is not associated with chemosensitivity to cisplatin, carboplatin and gemcitabine in human lung cancer cell lines. Respirology. 13:510–517. 2008. View Article : Google Scholar : PubMed/NCBI

28. 

Sliwinski T, Krupa R, Majsterek I, Rykala J, Kolacinska A, Morawiec Z, Drzewoski J, Zadrozny M and Blasiak J: Polymorphisms of the BRCA2 and RAD51 genes in breast cancer. Breast Cancer Res Treat. 94:105–109. 2005. View Article : Google Scholar : PubMed/NCBI

29. 

Amirrad M, Al-Mulla F, Varadharaj G, John B, Saji T and Anim JT: BRCA1 gene expression in breast cancer in Kuwait: correlation with prognostic parameters. Med Princ Pract. 14:67–72. 2005. View Article : Google Scholar : PubMed/NCBI

30. 

Müller A, Zielinski D, Friedrichs N, Oberschmid B, Merkelbach-Bruse S, Schackert HK, Linnebacher M, von Knebel Doeberitz M, Büttner R and Rüschoff J: Reduced mRNA expression in paraffin-embedded tissue identifies MLH1-and MSH2-deficient colorectal tumours and potential mutation carriers. Virchows Arch. 453:9–16. 2008.PubMed/NCBI

31. 

Veeriah S, Kautenburger T, Habermann N, Sauer J, Dietrich H, Will F and Pool-Zobel BL: Apple flavonoids inhibit growth of HT29 human colon cancer cells and modulate expression of genes involved in the biotransformation of xenobiotics. Mol Carcinog. 45:164–174. 2006. View Article : Google Scholar : PubMed/NCBI

32. 

Uthus EO, Reeves PG and Saari JT: Copper deficiency decreases plasma homocysteine in rats. J Nutr. 137:1370–1374. 2007.PubMed/NCBI

33. 

Hoang YD, Avakian AP and Luderer U: Minimal ovarian upregulation of glutamate cysteine ligase expression in response to suppression of glutathione by buthionine sulfoximine. Reprod Toxicol. 21:186–196. 2006. View Article : Google Scholar : PubMed/NCBI

34. 

Gustavsson B, Kaiser C, Carlsson G, Wettergren Y, Odin E, Lindskog EB, Niyikiza C and Ma D: Molecular determinants of efficacy for 5-FU-based treatments in advanced colorectal cancer: mRNA expression for 18 chemotherapy-related genes. Int J Cancer. 124:1220–1226. 2009. View Article : Google Scholar : PubMed/NCBI

35. 

Yoshinare K, Kubota T, Watanabe M, Wada N, Nishibori H, Hasegawa H, Kitajima M, Takechi T and Fukushima M: Gene expression in colorectal cancer and in vitro chemosensitivity to 5-fluorouracil: a study of 88 surgical specimens. Cancer Sci. 94:633–638. 2003. View Article : Google Scholar : PubMed/NCBI

36. 

Matsubara J, Nishina T, Yamada Y, Moriwaki T, Shimoda T, Kajiwara T, Nakajima TE, Kato K, Hamaguchi T, Shimada Y, Okayama Y, Oka T and Shirao K: Impacts of excision repair cross-complementing gene 1 (ERCC1), dihydropyrimidine dehydrogenase, and epidermal growth factor receptor on the outcomes of patients with advanced gastric cancer. Br J Cancer. 98:832–839. 2008. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Minegaki T, Takara K, Hamaguchi R, Tsujimoto M and Nishiguchi K: Factors affecting the sensitivity of human-derived esophageal carcinoma cell lines to 5-fluorouracil and cisplatin. Oncol Lett 5: 427-434, 2013.
APA
Minegaki, T., Takara, K., Hamaguchi, R., Tsujimoto, M., & Nishiguchi, K. (2013). Factors affecting the sensitivity of human-derived esophageal carcinoma cell lines to 5-fluorouracil and cisplatin. Oncology Letters, 5, 427-434. https://doi.org/10.3892/ol.2012.1014
MLA
Minegaki, T., Takara, K., Hamaguchi, R., Tsujimoto, M., Nishiguchi, K."Factors affecting the sensitivity of human-derived esophageal carcinoma cell lines to 5-fluorouracil and cisplatin". Oncology Letters 5.2 (2013): 427-434.
Chicago
Minegaki, T., Takara, K., Hamaguchi, R., Tsujimoto, M., Nishiguchi, K."Factors affecting the sensitivity of human-derived esophageal carcinoma cell lines to 5-fluorouracil and cisplatin". Oncology Letters 5, no. 2 (2013): 427-434. https://doi.org/10.3892/ol.2012.1014
Copy and paste a formatted citation
x
Spandidos Publications style
Minegaki T, Takara K, Hamaguchi R, Tsujimoto M and Nishiguchi K: Factors affecting the sensitivity of human-derived esophageal carcinoma cell lines to 5-fluorouracil and cisplatin. Oncol Lett 5: 427-434, 2013.
APA
Minegaki, T., Takara, K., Hamaguchi, R., Tsujimoto, M., & Nishiguchi, K. (2013). Factors affecting the sensitivity of human-derived esophageal carcinoma cell lines to 5-fluorouracil and cisplatin. Oncology Letters, 5, 427-434. https://doi.org/10.3892/ol.2012.1014
MLA
Minegaki, T., Takara, K., Hamaguchi, R., Tsujimoto, M., Nishiguchi, K."Factors affecting the sensitivity of human-derived esophageal carcinoma cell lines to 5-fluorouracil and cisplatin". Oncology Letters 5.2 (2013): 427-434.
Chicago
Minegaki, T., Takara, K., Hamaguchi, R., Tsujimoto, M., Nishiguchi, K."Factors affecting the sensitivity of human-derived esophageal carcinoma cell lines to 5-fluorouracil and cisplatin". Oncology Letters 5, no. 2 (2013): 427-434. https://doi.org/10.3892/ol.2012.1014
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team