Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
May-2015 Volume 9 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2015 Volume 9 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Overexpression of DNA methyltransferase 1 as a negative independent prognostic factor in primary gastrointestinal diffuse large B-cell lymphoma treated with CHOP-like regimen and rituximab

  • Authors:
    • Haifeng Zhao
    • Le Zhang
    • Shanqi Guo
    • Tian Yuan
    • Bing Xia
    • Lianyu Zhang
    • Yizhuo Zhang
  • View Affiliations / Copyright

    Affiliations: Department of Hematology, Tianjin Medical University Cancer Institute and Hospital, National Clinical Research Center for Cancer, Key Laboratory of Cancer Prevention and Therapy, Tianjin 300060, P.R. China, Department of Pathology, Tianjin Medical University Cancer Institute and Hospital, National Clinical Research Center for Cancer, Key Laboratory of Cancer Prevention and Therapy, Tianjin 300060, P.R. China
  • Pages: 2307-2312
    |
    Published online on: March 13, 2015
       https://doi.org/10.3892/ol.2015.3038
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The aims of the present study were to elucidate the transcript levels of DNA methyltransferase (DNMT)1, DNMT3a and DNMT3b by quantitative polymerase chain reaction in patients with primary gastrointestinal diffuse large B‑cell lymphoma (PGI‑DLBCL), and determine the association of their expression with the clinical parameters and prognostic values of the disease. The results revealed that the expression of DNMT1 in patients with PGI‑DLBCL was significantly higher than that in healthy controls (P=0.04), while the expression of DNMT3a and DNMT3b were significantly lower (P<0.001 and P=0.001, respectively). The increased expression of DNMT1 was significantly correlated with shorter overall survival and progression‑free survival rates (P=0.018 and P=0.008, respectively). The multivariate analysis demonstrated that the level of DNMT1 was an independent prognostic factor. In conclusion, DNMT1 was identified to be an independent prognostic factor for predicting the survival of patients with PGI‑DLBCL; this suggests that it could be used as a marker to indicate the prognosis of PGI‑DLBCL.

Introduction

Primary gastrointestinal (PGI) lymphoma is an extremely rare disease that accounts for 1–4% of all gastrointestinal malignancies (1). In general, gastrointestinal lymphoma is secondary to widespread nodal diseases. Lymphomas may originate from any section of the gastrointestinal tract, however, the most frequently affected region is the stomach, followed by the small intestine (2). The most commonly diagnosed histopathological subtype of PGI lymphoma is diffuse large B-cell lymphoma (DLBCL), which accounts for ∼50% of all cases (3). Due to its rarity, only a limited number of studies concerning PGI-DLBCL have been published (4–6).

Aberrant DNA methylation, which is characterized by widespread genome hypomethylation, chromosome instability and localized DNA hypermethylation, is considered to be an important event, occurring in early tumor development (7,8). Methylation patterns are predominantly regulated by independent DNA methyltransferases (DNMTs), including DNMT1, DNMT3a and DNMT3b (9,10). DNMT1 mediates maintenance DNA methylation and DNMT3a and DNMT3b are responsible for de novo methylation (9). Previous studies have revealed that DNMT1 and DNMT3b overexpression is associated with unfavorable prognoses in a number of human cancers, including breast and hepatocellular carcinomas, lung cancers, acute myeloid leukemia and epithelial ovarian cancer (11–17).

Increasing evidence suggests that aberrant DNA methylation is significant in the pathogenesis of lymphomas (18–22). However, at present, the prognostic significance of DNMT expression in PGI-DLBCL is yet to be elucidated. The aims of the current study were to determine the transcript levels of DNMT1, DNMT3a and DNMT3b in PGI-DLBCL patients by quantitative polymerase chain reaction (qPCR), and establish their clinical significance.

Materials and methods

Patients and controls

In total, 62 patients with a histopathological diagnosis of PGI-DLBCL, and 30 age- and gender-matched healthy controls were recruited. The study was approved by Tianjin Medical University Cancer Institute and Hospital Ethics Committee, and all the patients provided written informed consent prior to study participation. Fresh samples of cancerous tissues and normal tissues were collected via surgical resection. The samples were frozen in liquid nitrogen for 30 min in cryovials, and subsequently stored at −80°C until further analysis. The diagnosis of PGI-DLBCL was based upon the World Health Organization classification system for hematological malignancies (23). The patients were staged according to the Lugano staging system for gastrointestinal non-Hodgkin's lymphoma (NHL) (24). The diagnostic work-up consisted of the patient's history, their performance status according to the Eastern Cooperative Oncology Group scale, a physical examination, a baseline endoscopy or barium meal examination, gastric mucosal biopsies or a gastrectomy, a complete blood cell count, a biochemical profile, measurement of serum lactate dehydrogenase (LDH), computed tomography scans of the thorax, abdomen and pelvic cavity, and a bone marrow aspiration and biopsy. A low hemoglobin level was defined as <120 g/l, and a high LDH level as >245 U/l. The patients were subsequently grouped according to age, gender, tumor origin, performance status, Lugano staging system outcome, clinical stage, B symptoms, LDH level, International Prognostic Index (IPI) score and chemotherapy response. A retrospective review of the clinical, pathological and treatment results of all patients was conducted and the results were entered into an anonymized database. The clinical characteristics and histological features of the patients with PGI-DLBCL are shown in Table I.

Table I.

Clinical characteristics of primary gastrointestinal diffuse large B cell lymphoma patients.

Table I.

Clinical characteristics of primary gastrointestinal diffuse large B cell lymphoma patients.

CharacteristicPatients, n (%)
Age, years
  ≤6035 (56.5)
  >6027 (43.5)
Gender
  Male33 (53.2)
  Female29 (46.8)
Origin
  Stomach41 (66.1)
  Intestinal21 (33.9)
Performance status
  ECOG 0–145 (72.6)
  ECOG 2–417 (27.4)
Lugano staging system
  I-II  20 (32.3)
  IIE-IV42 (67.7)
Pathological type
  Non-GCB45 (72.6)
  GCB17 (27.4)
LDH
  Normal22 (35.5)
  Elevated40 (64.5)
Hemoglobin
  Normal30 (48.4)
  Low32 (51.6)
B symptoms
  Positive13 (21.0)
  Negative49 (79.0)
IPI
  0–239 (62.9)
  3–523 (37.1)
Therapeutic evaluation
  CR32 (51.6)
  PR/SD/PD30 (48.4)

[i] ECOG, Eastern Cooperative Oncology Group; GCB, germinal center B-cell-like; LDH, lactose dehydrogenase; IPI, International Prognostic Index; CR, complete remission; PR, partial remission; SD, stable disease; PD, progressive disease.

RNA, cDNA preparation and qPCR

For the RNA extraction step, ∼25 mg of tumor tissue was pulverized under liquid nitrogen using a pestle and mortar. The RNA was subsequently extracted using RNeasy (Qiagen Inc., Valencia, CA, USA), according to the manufacturer's instructions. Following this, reverse transcription reactions were performed using a PrimeScript 1st Strand cDNA Synthesis Kit (Takara Bio, Inc., Otsu, Japan), according to the manufacturer's instructions and qPCR was performed using a CM9600 Sequence Detection System (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The amplification step was performed in a total volume of 20 µl, with 10 µl kit-supplied QuantiTect™ SYBR® Green RT-PCR Master mix (Applied Biosystems Life Technologies, Foster City, CA, USA), 0.4 µl of each primer (10 µM), 2 µl of cDNA (50 ng RNA) and 7.2 µl ddH2O. The PCR cycling parameters were set as follows: 95°C for 30 sec, followed by 40 cycles of PCR reacting at 95°C for 5 sec, and finally 60°C for 34 sec. β actin was used as an internal standard. The ΔΔCT values were calculated using the differences between the target genes and β actin. The primer sequences are shown in Table II. Each experiment was conducted in triplicate.

Table II.

Primer sequences.

Table II.

Primer sequences.

GeneForward sequence (5′→3′)Reverse sequence (5′→3′)
DNMT1 GTGGGGGACTGTGTCTCTGT TGAAAGCTGCATGTCCTCAC
DNMT3a CAGCTTCCACGTTGCCTTCT CATCTGCAAGCTGTCTCCCTTT
DNMT3b CCCATTCGAGTCCTGTCATT GGTTCCAACAGCAATGGACT
β actin CCTGGCACCCAGCACAAT GGGCCGGACTCGTCATAC

[i] DNMT, DNA methyltransferase.

Immunohistochemical staining and scoring

The biopsied tissues were initially fixed in 10% buffered formalin, embedded in paraffin and cut into 4-µm sections. Following this, deparaffinization and heat-induced antigen retrieval steps were performed. The endogenous peroxidase activity was blocked using 0.5% hydrogen peroxide. Subsequent to washing with phosphate-buffered saline (PBS), the sections were incubated with anti-cluster of differentiation (CD)10 (cat. no. ZM0283), -B-cell lymphoma 6 (BCL-6; cat. no. ZM-0011) and -melanoma associated antigen 1 (MUM1; cat. no. ZA-0583) antibodies (ZSGB-BIO, Beijing, China) at 4°C overnight. After washing with PBS again, the secondary antibodies were added to the sections. The nuclei were subsequently stained with hematoxylin, and the color was developed using diaminobenzidine. A positive result was recorded when ≥30% of the cells were stained. The tissues were also analyzed for CD10, BCL-6 and MUM1 immunoreactivity according to the immunophenotypic profile criteria of DLBCL described previously by Hans et al (25). The intensity of the staining and the percentage of positive cells were recorded. The staining intensity was scored between 0 and 3+ as follows: i) 0, Absence of staining; ii) 1+, >25 % of the tumor cells exhibited weak staining; iii) 2+, tumor cells exhibited moderate staining; and iv) 3+, tumor cells demonstrated strong staining. Tumors with a score of 1+, 2+ or 3+ were considered to be positive, while tumors with a score of 0 were considered to be negative. The immunohistochemical analysis was performed independently by at least two histopathologists.

Treatment and response assessment

The patients were treated with four therapeutic modalities; surgery, chemotherapy, Helicobacter pylori (Hp) eradication and radiotherapy. The aim of surgery was to remove the tumor tissue. All patients were treated with 6–8, 21-day cycles of the CHOP [cyclophosphamide (750 mg/m2, day 1), doxorubicin (50 mg/m2, day 1), vincristine (1.4 mg/m2, day 1) and prednisone (100 mg, days 1–5)] or R-CHOP [rituximab (350 mg/m2, day 1), cyclophosphamide (750 mg/m2, day 1), doxorubicin (50 mg/m2, day 1), vincristine (1.4 mg/m2, day 1) and prednisone (100 mg, days 1–5)] regimens. The Hp eradication regimen, which consisted of proton pump inhibitors [omeprazole (20 mg, twice daily), lansoprazole (30 mg, twice daily) or rabeprazole (10 mg, twice daily)] and a combination of antibiotics [amoxicillin (1,000 mg, twice daily), clarithromycin (500 mg, twice daily) and/or metronidazole (200 mg, twice daily)], was administered to eight patients, seven days a month, for three months. In total, six patients received radiotherapy. The responses were assessed by the International Workshop for NHL Standardized Criteria (26).

Statistical analysis

The statistical analysis was performed using SSPS version 19.0 software (SPSS Inc., Chicago, IL, USA). The results are presented as the mean ± standard deviation. The data were analyzed using the non-parametric Mann-Whitney U-test. The significant differences between the survival curves were calculated using the log-rank test. A GraphPad Prism software package was used for the Kaplan-Meier estimate graphs. The Cox proportional hazards regression model was used for the multivariate analysis. P<0.05 was considered to indicate a statistically significant difference.

Results

Clinical characteristics and histological features

In total, 62 patients with PGI-DLBCL, which included 33 males and 29 females (median age, 54 years; range, 32–76 years), and 30 age- and gender-matched healthy controls were enrolled in the present study. Overall, 20 patients (32.3%) were diagnosed with an advanced Ann Arbor clinical stage (stages IIE-IV), and 45 patients (72.6%) exhibited a good performance status (<2). An elevated serum LDH level was observed in 40 patients (64.5%); low or low-intermediate IPI scores were identified in 39 patients (62.9%). Based upon the results of the immunophenotypical profiles, 17 patients (27.4%) were classified as having a germinal center B-cell-like (GCB) subtype, and 45 patients (72.6%) with a non-GCB subtype. In total, 32 patients (51.6%) achieved complete remission after 6–8 cycles of the CHOP or R-CHOP regimens, 11 (17.8%) were in partial remission and 19 patients (30.6%) exhibited stable or progressive disease.

mRNA expression of DNMT1, DNMT3a and DNMT3b in patients with PGI-DLBCL

The mRNA expression of DNMT1, DNMT3a and DNMT3b was determined using qPCR. The expression of DNMT1 mRNA in PGI-DLBCL patients was significantly higher than that of the healthy controls (P=0.04), while the expression of DNMT3a and DNMT3b mRNA was significantly lower (P<0.0001 and P=0.001, respectively) (Fig. 1).

Figure 1.

Relative mRNA expression of DNMT1, DNMT3a and DNMT3b in PGI-DLBCL patients and healthy controls. The mRNA expression was detected using quantitative polymerase chain reaction. The bars indicate the relative mRNA levels (mean ± standard deviation). (A) The levels of DNMT1 mRNA from PGI-DLBCL patients were significantly higher than those of healthy controls (P=0.04), while the expression of (B) DNMT3a and (C) DNMT3b mRNA was lower (P<0.0001 and P=0.001, respectively). DNMT, DNA methyltransferase; PGI-DLBCL, primary gastrointestinal diffuse large B cell lymphoma.

Association of DNMT1 expression with the clinicopathological characteristics of PGI-DLBCL

The patients with PGI-DLBCL were divided into subgroups according to specific clinical parameters, such as the Lugano stage (stages I-II and stages IIE-IV subgroups), the IPI score (low IPI, 0–2; and high IPI, 3–5 subgroups), and the DLBCL type (non-GCB and GCB subgroups). It was revealed that DNMT1 expression was significantly higher in the high IPI subgroup than in the low IPI subgroup (P=0.03; Fig. 2). By contrast, there were no significant differences in the expression of DNMT3a and DNMT3b between any of the subgroups (data not shown).

Figure 2.

DNMT1 expression in the IPI subgroups. Patients with primary gastrointestinal diffuse large B cell lymphoma were divided into low IPI (0–2) and high IPI (3–5) subgroups. DNMT1 expression was significantly higher in the high IPI subgroup (p=0.03) compared with the low IPI subgroup. DNMT1, DNA methyltransferase 1; IPI, International Prognostic Index.

DNMT1 is a negative independent prognostic factor for patients with PGI-DLBCL

The patients were divided into high-expression (above the median) and low-expression (below the median) groups depending on mRNA expression levels. The results demonstrated that the overall survival (OS) and progression-free survival (PFS) rates of the high-DNMT1 group were significantly shorter compared with those of the low-DNMT1 group (P=0.038 and P=0.012, respectively; Fig. 3). The univariate analysis revealed that DNMT1 expression, Lugano staging, pathological type and IPI scores were factors associated with the prognosis of patients with PGI-DLBCL (Table III). The multivariate analysis showed that in addition to the IPI score, DNTM1 expression was also an independent predictive factor for mortality and disease progression (Table IV).

Figure 3.

Effect of DNMT1 expression on OS and PFS in patients with primary gastrointestinal diffuse large B cell lymphoma. The (A) OS and (B) PFS rates of the high-DNMT1 group were significantly shorter than those of the low-DNMT1 group (P=0.038 and P=0.012, respectively). DNMT1, DNA methyltransferase 1; OS, overall survival; PFS, progression-free survival.

Table III.

Univariate analysis revealing the significance of different prognostic variables for primary gastrointestinal diffuse large B cell lymphoma.

Table III.

Univariate analysis revealing the significance of different prognostic variables for primary gastrointestinal diffuse large B cell lymphoma.

Overall survivalProgression-free survival


VariableHR (95% CI)P-valueHR (95% CI)P-value
DNMT1 expression (low vs. high)5.87 (2.31–12.68)0.0153.78 (1.24–8.62)0.012
ECOG (0–1 vs. −4)3.24 (1.67–8.90)0.0722.56 (1.24–9.78)0.145
Lugano stage (I-II vs. IIE-IV)2.13 (0.45–7.89)0.0323.02 (0.24–8.34)0.024
Pathological type (non-GCB vs. GCB)3.56 (0.83–10.76)0.0271.56 (0.45–6.76)0.032
LDH (normal vs. elevated)0.67 (0.06–1.18)0.1240.92 (0.06–3.54)0.294
IPI (0–2 vs. 3–5)3.45 (0.23–11.92)0.0162.30 (0.23–10.34)0.031
Treatment (surgery+R-CHOP vs. surgery+CHOP)2.01 (0.54–5.72)0.5691.03 (0.78–8.45)0.756
Therapeutic evaluation (SD vs. PR/SD/PD)2.69 (0.35–6.97)0.1871.45 (0.56–12.46)0.357

[i] HR, hazard ratio; DNMT1, DNA methyltransferase 1; ECOG, Eastern Cooperative Oncology Group; GCB, germinal center B-cell-like; LDH, lactose dehydrogenase; IPI, International Prognostic Index; R-CHOP, rituximab administered with cyclophosphamide, doxorubicin, vincristine and prednisone; CHOP, cyclophosphamide, doxorubicin, vincristine and prednisone; SD, stable disease; PR, partial remission; PD, progressive disease.

Table IV.

Multivariate analysis revealing the significance of independent prognostic variables for primary gastrointestinal diffuse large B cell lymphoma.

Table IV.

Multivariate analysis revealing the significance of independent prognostic variables for primary gastrointestinal diffuse large B cell lymphoma.

Overall survivalProgression-free survival


VariableHR (95% CI)P-valueHR (95% CI)P-value
DNMT1 expression (low vs. high)4.32 (1.25–8.23)0.0184.02 (1.42–12.63)0.008
Lugano stage (I-II vs. IIE-IV)1.34 (0.69–6.90)0.0821.56 (0.54–7.78)0.160
Pathological type (non-GCB vs. GCB)1.13 (0.45–4.56)0.1431.02 (0.24–3.34)0.237
IPI (0–2 vs. 3–5)2.96 (0.58–5.76)0.0172.56 (0.83–5.76)0.020

[i] HR, hazard ratio; DNMT1, DNA methyltransferase 1; GCB, germinal center B-cell-like; IPI, International Prognostic Index.

Discussion

The processes that underlie the pathogenesis of PGI-DLBCL are yet to be elucidated. Previous studies have hypothesized that abnormal DNA methylation is an important event that occurs early in tumor development (27,28). DNA methylation is regulated by DNMTs, predominantly DNMT1, DNMT3a and DNMT3b (9,10). Therefore, we hypothesize that the dysregulated expression and function of DNMT1, DNMT3a and DNMT3b is significant in the pathogenesis of PGI-DLBCL.

Increasing evidence indicates that high DNMT1 and/or DNMT3b expression has a modulating effect upon the clinical outcome of cancer patients. A previous study revealed that high DNMT1 expression was associated with a subgroup of gastric cancer patients with poorer outcomes following platinum/fluorouracil-based neoadjuvant chemotherapy (29). Another study identified that the level of DNMT1 mRNA was significantly higher in gastric cancer patients with methylated Runx3, compared with those with unmethylated Runx3 (30). Furthermore, increased expression of DNMT1 and DNMT3b have been detected in the tumor tissues of patients with lung cancer, and were also associated with poorer prognoses (31–34). In a study concerning pancreatic cancer patients, those with a higher DNMT1 expression exhibited a lower overall survival rate (35). In addition, DNMT1 and DNMT3b were markedly upregulated in malignant glioma tumor tissues (36), and DNMT3b overexpression was identified to be an independent prognostic factor for predicting the reduced survival of DLBCL patients (37).

The present study revealed that DNMT1 mRNA expression in PGI-DLBCL patients was higher than that of the healthy controls, and that it was increased in the high IPI subgroup compared with the low IPI subgroup. The Kaplan-Meier analysis showed that the high-DNMT1 subgroup exhibited shorter OS and PFS rates compared with the low-DNMT1 subgroup. This suggests that DNMT1 is a negative predictive factor for PGI-DLBCL. The Cox regression analysis revealed that DNMT1 was an independent prognostic factor, which suggests that DNMT1 expression may be a suitable prognostic marker for patients with PGI-DLBCL. These findings are consistent with those of other previous studies (28–36). Although previous studies have reported that the levels of DNMT3a and DNMT3b were significantly higher in cancer patients (31,33,35,36), the present study indicated that the expression of DNMT3a and DNMT3b in PGI-DLBCL patients was markedly lower than that of the healthy controls. This may be due to the small number of samples used in the present study. Future studies with larger patient cohorts are therefore required in order to address this inconsistency.

In conclusion, the results of the present study suggest that DNMT1, DNMT3a and DNMT3b may be involved in the etiology of PGI-DLBCL. In addition, the results indicate that DNMT1 is a negative and independent prognostic parameter for patients with PGI-DLBCL, and, therefore, may be used as a biomarker in order to guide prognosis.

References

1 

Wang T, Gui W and Shen Q: Primary gastrointestinal non-Hodgkin's lymphoma: clinicopathological and prognostic analysis. Med Oncol. 27:661–666. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Herrmann R, Panahon AM, Barcos MP, Walsh D and Stutzman L: Gastrointestinal involvement in non-Hodgkin's lymphoma. Cancer. 46:215–222. 1980. View Article : Google Scholar : PubMed/NCBI

3 

van Krieken JH, Otter R, Hermans J, et al: Malignant lymphoma of the gastrointestinal tract and mesentery. A clinico-pathologic study of the significance of histologic classification. NHL Study Group of the Comprehensive Cancer Center West. Am J Pathol. 135:281–289. 1989.PubMed/NCBI

4 

Chen F, Yang G and Xia B: Increased expression of the spindle checkpoint protein BubR1 is associated with high cell proliferation in primary gastrointestinal diffuse large B cell lymphoma. Cell Biochem Biophys. 66:747–752. 2013. View Article : Google Scholar : PubMed/NCBI

5 

Ding D, Pei W, Chen W, Zuo Y and Ren S: Analysis of clinical characteristics, diagnosis, treatment and prognosis of 46 patients with primary gastrointestinal non-Hodgkin lymphoma. Mol Clin Oncol. 2:259–264. 2014.PubMed/NCBI

6 

Li X, Shen W, Cao J, et al: Treatment of gastrointestinal diffuse large B cell lymphoma in China: a 10-year retrospective study of 114 cases. Ann Hematol. 91:1721–1729. 2012. View Article : Google Scholar : PubMed/NCBI

7 

Robertson KD: DNA methylation, methyltransferases, and cancer. Oncogene. 20:3139–3155. 2001. View Article : Google Scholar : PubMed/NCBI

8 

Jones PA and Baylin SB: The fundamental role of epigenetic events in cancer. Nat Rev Genet. 3:415–428. 2002.PubMed/NCBI

9 

Fitzpatrick DR and Wilson CB: Methylation and demethylation in the regulation of genes, cells, and responses in the immune system. Clin Immunol. 109:37–45. 2003. View Article : Google Scholar : PubMed/NCBI

10 

Fatemi M, Hermann A, Gowher H and Jeltsch A: Dnmt3a and Dnmt1 functionally cooperate during de novo methylation of DNA. Eur J Biochem. 269:4981–4984. 2002. View Article : Google Scholar : PubMed/NCBI

11 

Lin RK, Hsu HS, Chang JW, Chen CY, Chen JT and Wang YC: Alteration of DNA methyltransferases contributes to 5′CpG methylation and poor prognosis in lung cancer. Lung Cancer. 55:205–213. 2007. View Article : Google Scholar : PubMed/NCBI

12 

Saito Y, Kanai Y, Nakagawa T, et al: Increased protein expression of DNA methyltransferase (DNMT) 1 is significantly correlated with the malignant potential and poor prognosis of human hepatocellular carcinomas. Int J Cancer. 105:527–532. 2003. View Article : Google Scholar : PubMed/NCBI

13 

Oue N, Kuraoka K, Kuniyasu H, et al: DNA methylation status of hMLH1, p16(INK4a), and CDH1 is not associated with mRNA expression levels of DNA methyltransferase and DNA demethylase in gastric carcinomas. Oncol Rep. 8:1085–1089. 2001.PubMed/NCBI

14 

Girault I, Tozlu S, Lidereau R and Bieche I: Expression analysis of DNA methyltransferases 1, 3A, and 3B in sporadic breast carcinomas. Clin Cancer Res. 9:4415–4122. 2003.PubMed/NCBI

15 

Xing J, Stewart DJ, Gu J, Lu C, Spitz MR and Wu X: Expression of methylation-related genes is associated with overall survival in patients with non-small cell lung cancer. Br J Cancer. 98:1716–1722. 2008. View Article : Google Scholar : PubMed/NCBI

16 

Hayette S, Thomas X, Jallades L, et al: High DNA methyltransferase DNMT3B levels: poor prognostic marker in acute myeloid leukemia. PLoS One. 7:e515272012. View Article : Google Scholar : PubMed/NCBI

17 

Bai X, Song Z, Fu Y, et al: Clinicopathological significance and prognostic value of DNA methyltransferase 1, 3a, and 3b expressions in sporadic epithelial ovarian cancer. PLoS One. 7:e400242012. View Article : Google Scholar : PubMed/NCBI

18 

Shaknovich R and Melnick A: Epigenetics and B-cell lymphoma. Curr Opin Hematol. 18:293–299. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Taylor KH, Briley A, Wang Z, Cheng J, Shi H and Caldwell CW: Aberrant epigenetic gene regulation in lymphoid malignancies. Semin Hematol. 50:38–47. 2013. View Article : Google Scholar : PubMed/NCBI

20 

De S, Shaknovich R, Riester M, et al: Aberration in DNA methylation in B-cell lymphomas has a complex origin and increases with disease severity. PLoS Genet. 9:e10031372013. View Article : Google Scholar : PubMed/NCBI

21 

Pike BL, Greiner TC, Wang X, et al: DNA methylation profiles in diffuse large B-cell lymphoma and their relationship to gene expression status. Leukemia. 22:1035–1043. 2008. View Article : Google Scholar : PubMed/NCBI

22 

Asmar F, Punj V, Christensen J, et al: Genome-wide profiling identifies a DNA methylation signature that associates with TET2 mutations in diffuse large B-cell lymphoma. Haematologica. 98:1912–1920. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Tomonaga M.: Outline and direction of revised WHO classification of tumors of haematopoietic and lymphoid tissues. Rinsho Ketsueki. 50:1401–1406. 2009.(In Japanese). PubMed/NCBI

24 

No authors listed: 5th International Conference on Malignant Lymphoma, Part 2. Proceedings. Lugano, Switzerland, June 9–12, 1993. Ann Oncol. 5 (Suppl 2):S1–S163. 1994.PubMed/NCBI

25 

Hans CP, Weisenburger DD, Greiner TC, et al: Confirmation of the molecular classification of diffuse large B-cell lymphoma by immunohistochemistry using a tissue microarray. Blood. 103:275–282. 2004. View Article : Google Scholar : PubMed/NCBI

26 

Cheson BD, Horning SJ, Coiffier B, et al: Report of an international workshop to standardize response criteria for non-Hodgkin's lymphomas. NCI Sponsored International Working Group. J Clin Oncol. 17:12441999.PubMed/NCBI

27 

Fukushige S and Horii A: DNA methylation in cancer: a gene silencing mechanism and the clinical potential of its biomarkers. Tohoku J Exp Med. 229:173–185. 2013. View Article : Google Scholar : PubMed/NCBI

28 

Sincic N and Herceg Z: DNA methylation and cancer: ghosts and angels above the genes. Curr Opin Oncol. 23:69–76. 2011. View Article : Google Scholar : PubMed/NCBI

29 

Mutze K, Langer R, Schumacher F, et al: DNA methyltransferase 1 as a predictive biomarker and potential therapeutic target for chemotherapy in gastric cancer. Eur J Cancer. 47:1817–1825. 2011. View Article : Google Scholar : PubMed/NCBI

30 

Chen W, Gao N, Shen Y and Cen JN: Hypermethylation downregulates Runx3 gene expression and its restoration suppresses gastric epithelial cell growth by inducing p27 and caspase3 in human gastric cancer. J Gastroenterol Hepatol. 25:823–831. 2010. View Article : Google Scholar : PubMed/NCBI

31 

Gao P, Yang X, Xue YW, Zhang XF, Wang Y, Liu WJ and Wu XJ: Promoter methylation of glutathione S-transferase pi1 and multidrug resistance gene 1 in bronchioloalveolar carcinoma and its correlation with DNA methyltransferase 1 expression. Cancer. 115:3222–3232. 2009. View Article : Google Scholar : PubMed/NCBI

32 

Xing J, Stewart DJ, Gu J, Lu C, Spitz MR and Wu X: Expression of methylation-related genes is associated with overall survival in patients with non-small cell lung cancer. Br J Cancer. 98:1716–1722. 2008. View Article : Google Scholar : PubMed/NCBI

33 

Kim H, Kwon YM, Kim JS, Han J, Shim YM, Park J and Kim DH: Elevated mRNA levels of DNA methyltransferase-1 as an independent prognostic factor in primary non-small cell lung cancer. Cancer. 107:1042–1049. 2006. View Article : Google Scholar : PubMed/NCBI

34 

Vallbohmer D, Brabender J, Yang D, et al: DNA methyltransferases messenger RNA expression and aberrant methylation of CpG islands in non-small-cell lung cancer: association and prognostic value. Clin Lung Cancer. 8:39–44. 2006. View Article : Google Scholar : PubMed/NCBI

35 

Wang W, Gao J, Man XH, Li ZS and Gong YF: Significance of DNA methyltransferase-1 and histone deacetylase-1 in pancreatic cancer. Oncol Rep. 21:1439–1447. 2009.PubMed/NCBI

36 

Kreth S, Thon N, Eigenbrod S, et al: O-methylguanine-DNA methyltransferase (MGMT) mRNA expression predicts outcome in malignant glioma independent of MGMT promoter methylation. PLoS One. 6:e171562011. View Article : Google Scholar : PubMed/NCBI

37 

Amara K, Ziadi S, Hachana M, Soltani N, Korbi S and Trimeche M: DNA methyltransferase DNMT3b protein overexpression as a prognostic factor in patients with diffuse large B-cell lymphomas. Cancer Sci. 101:1722–1730. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhao H, Zhang L, Guo S, Yuan T, Xia B, Zhang L and Zhang Y: Overexpression of DNA methyltransferase 1 as a negative independent prognostic factor in primary gastrointestinal diffuse large B-cell lymphoma treated with CHOP-like regimen and rituximab. Oncol Lett 9: 2307-2312, 2015.
APA
Zhao, H., Zhang, L., Guo, S., Yuan, T., Xia, B., Zhang, L., & Zhang, Y. (2015). Overexpression of DNA methyltransferase 1 as a negative independent prognostic factor in primary gastrointestinal diffuse large B-cell lymphoma treated with CHOP-like regimen and rituximab. Oncology Letters, 9, 2307-2312. https://doi.org/10.3892/ol.2015.3038
MLA
Zhao, H., Zhang, L., Guo, S., Yuan, T., Xia, B., Zhang, L., Zhang, Y."Overexpression of DNA methyltransferase 1 as a negative independent prognostic factor in primary gastrointestinal diffuse large B-cell lymphoma treated with CHOP-like regimen and rituximab". Oncology Letters 9.5 (2015): 2307-2312.
Chicago
Zhao, H., Zhang, L., Guo, S., Yuan, T., Xia, B., Zhang, L., Zhang, Y."Overexpression of DNA methyltransferase 1 as a negative independent prognostic factor in primary gastrointestinal diffuse large B-cell lymphoma treated with CHOP-like regimen and rituximab". Oncology Letters 9, no. 5 (2015): 2307-2312. https://doi.org/10.3892/ol.2015.3038
Copy and paste a formatted citation
x
Spandidos Publications style
Zhao H, Zhang L, Guo S, Yuan T, Xia B, Zhang L and Zhang Y: Overexpression of DNA methyltransferase 1 as a negative independent prognostic factor in primary gastrointestinal diffuse large B-cell lymphoma treated with CHOP-like regimen and rituximab. Oncol Lett 9: 2307-2312, 2015.
APA
Zhao, H., Zhang, L., Guo, S., Yuan, T., Xia, B., Zhang, L., & Zhang, Y. (2015). Overexpression of DNA methyltransferase 1 as a negative independent prognostic factor in primary gastrointestinal diffuse large B-cell lymphoma treated with CHOP-like regimen and rituximab. Oncology Letters, 9, 2307-2312. https://doi.org/10.3892/ol.2015.3038
MLA
Zhao, H., Zhang, L., Guo, S., Yuan, T., Xia, B., Zhang, L., Zhang, Y."Overexpression of DNA methyltransferase 1 as a negative independent prognostic factor in primary gastrointestinal diffuse large B-cell lymphoma treated with CHOP-like regimen and rituximab". Oncology Letters 9.5 (2015): 2307-2312.
Chicago
Zhao, H., Zhang, L., Guo, S., Yuan, T., Xia, B., Zhang, L., Zhang, Y."Overexpression of DNA methyltransferase 1 as a negative independent prognostic factor in primary gastrointestinal diffuse large B-cell lymphoma treated with CHOP-like regimen and rituximab". Oncology Letters 9, no. 5 (2015): 2307-2312. https://doi.org/10.3892/ol.2015.3038
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team