Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
April-2016 Volume 11 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2016 Volume 11 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

miR-517a is an independent prognostic marker and contributes to cell migration and invasion in human colorectal cancer

  • Authors:
    • Wenqi Ma
    • Qiang Yu
    • Jue Jiang
    • Xiaopeng Du
    • Lili Huang
    • Linlin Zhao
    • Qi Zhou
  • View Affiliations / Copyright

    Affiliations: Department of Ultrasound, The Second Affiliated Hospital of Xi'an Jiaotong University, Xi'an, Shaanxi 710004, P.R. China, Department of Pediatric Surgery, The Second Affiliated Hospital of Xi'an Jiaotong University, Xi'an, Shaanxi 710004, P.R. China
  • Pages: 2583-2589
    |
    Published online on: February 24, 2016
       https://doi.org/10.3892/ol.2016.4269
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Colorectal cancer (CRC) is a highly invasive tumor that is frequently associated with distant metastasis, which is the primary cause of poor prognosis. However, the mechanisms of metastasis remain poorly understood. MicroRNAs (miRNAs/miRs) have been considered to be implicated in CRC progression. In particular, miR-517a is proposed as a novel tumor-associated miRNA and has a potential role in tumor metastasis. The expression of miR-517a in CRC specimens was detected by reverse transcription‑quantitative polymerase chain reaction. Transwell assays were performed to determine the migration and invasion of CRC cells. The putative target genes of miR‑517a were disclosed using publicly available databases and western blot analysis. The present study identified that the expression of miR‑517a was significantly higher in CRC tissues as compared with adjacent non‑tumor tissues. Clinical analysis indicated that increased expression of miR-517a was correlated with poor prognostic features and poor long‑term survival of CRC patients. In vitro evidences demonstrated that downregulation of miR‑517a inhibited cell migration and invasion in HCT-116 cells. By contrast, upregulation of miR‑517a increased the number of migrated and invaded SW480 cells. Notably, miR-517a expression was inversely regulated by forkhead box J3 (FOXJ3) abundance in CRC cells. Furthermore, an inverse correlation between miR‑517a and FOXJ3 expression was observed in CRC tissues. In conclusion, miR-517a appears to be an independent prognostic marker for predicting survival of CRC patients, and may promote cell migration and invasion by inhibiting FOXJ3.

Introduction

Colorectal cancer (CRC) is one of the most common type of cancer in the world, and its incidence is continuously increasing in China (1). Global cancer statistics indicate that CRC remains to be the fourth leading cause of cancer-associated mortalities worldwide, responsible for >600,000 mortalities annually (2). The major therapeutic approaches for CRC are surgery, neoadjuvant radiotherapy and adjuvant chemotherapy. Carcinoembryonic antigen and cancer antigen 19–9 are widely used biomarkers for CRC diagnosis. Endoscopy and blood screening have been proved to effectively reduce the incidence and mortality of CRC (3). However, the prognosis of CRC patients remains poor, with a 50–59% 5-year survival rate (2).

MicroRNAs (miRNAs/miRs) are small non-coding RNA molecules that are 20–24 nucleotides in length, and regulate 60% of coding genes by preventing mRNA molecule translation and/or promoting degradation. Increasing evidence has revealed that miRNAs are critical in various diseases, including cancer. Novel functions and mechanisms by which miRNAs regulate genes are constantly being investigated (4–6).

miRNAs that promote carcinogenesis are termed oncomiRs (7). Numerous oncomiRs are overexpressed in CRC compared with noncancerous tissues, including miR-494, miR-21, miR-23a and miR-130b (8–11). These oncomiRs effect CRC cell proliferation, apoptosis, migration and invasion (12). However, another type of miRNA, termed tumor suppressive miRs (tsmiRs), are significantly downregulated in human colorectal adenocarcinoma tissue samples compared with the adjacent normal colorectal tissues, including miR-339-5p, miR-27a and miR-139-5p (13–15). miR-517a is considered to be a novel oncomiR and was observed to be elevated in human hepatocellular carcinoma (HCC) (16); expression of miR-517a increased proliferation, migration, and invasion of HCC cells in vitro (16). Furthermore, hsa-miR-517a exhibited significant inverse correlation with cyclin-dependent kinase 2a (CDKN2A) in glioblastoma; low expression of CDKN2A was associated with worse prognosis (17). A recent study reported that manipulation of miR-517a-3p expression changed lung cancer cell proliferation, migration and invasion capacity (18). Furthermore, miR-517a-3p accelerated lung cancer cell proliferation migration and invasion through inhibiting forkhead box J3 (FOXJ3) expression (18). However, the clinical significance of miR-517a in CRC, as well as its associated molecular pathways involved in the development and progression of CRC, have yet to be elucidated.

The present study aimed to explore the clinical significance of miR-517a, and its role in CRC cell migration and invasion. The present study demonstrated that overexpression of miR-517a is observed in CRC tissues compared with noncancerous tissues, and its overexpression correlates with poor prognostic features. Furthermore, miR-517a appears to be an independent prognostic marker for predicting the survival of patients with CRC. In vitro experiments indicated that miR-517a promotes CRC cell migration and invasion. Mechanistically, the current results demonstrate that miR-517a may potentiate the invasive behavior of CRC cells by inhibiting FOXJ3.

Materials and methods

Clinical samples and cell lines

A total of 90 pairs of CRC and matched adjacent non-tumor tissue samples were obtained during colorectomies from the Department of Pathology, the Second Affiliated Hospital of Xi'an Jiaotong University (Xi'an, China) between January 2007 and January 2009. The clinical specimens were frozen and stored at −80°C for reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analysis. Samples were paraformaldehyde-fixed (Nanjing SenBeiJia Biological Technoogy Co., Ltd., Nanjing, China) and paraffin-embedded (Meryer Chemical Technology Co., Ltd., Shanghai, China). for immunohistochemical staining. The demographic features and clinicopathological parameters are indicated in Table I. All specimens had confirmed pathological diagnosis of CRC and were classified according to the International Union Against Cancer and American Joint Committee on Cancer criteria (7th edition) (19). Patients did not receive preoperative chemotherapy or embolization. All samples were used after obtaining informed consent. The Xi'an Jiaotong University Ethics Committee approved all protocols according to the Declaration of Helsinki (as revised in Tokyo 2004) (20).

Table I.

Clinical association analysis of miR-517a expression in patients with colorectal cancer.

Table I.

Clinical association analysis of miR-517a expression in patients with colorectal cancer.

Patients, n

FeatureTotal patients, n (n=90)Low miR-517aHigh miR-517aP-value
Age, years 0.490
  ≤60271512
  >60633033
Gender 0.389
  Male542925
  Female361620
Tumor grade 0.468
  G1/G2673532
  G3/G4231013
Size, cm 0.660
  <5321715
  ≥5582830
Tumor invasion 0.011a
  T1/T22015  5
  T3/T4703040
Lymph node metastases 0.038a
  Absent633627
  Present27  918
Distant metastasis 0.020a
  Absent714031
  Present19  514
TNM stage 0.001a
  I/II543519
  III/IV361026

a Statistically significant.

In the present study, two CRC cell lines (HCT-116 and SW480) were used. In a pre-experiment, a noncancerous colon epithelial cell line (HCEC) was used as a control to evaluate the expression of miR-517a in HCT-116 and SW480 cells (data not shown). These cell lines were purchased from the Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, where they were established. Cells were cultured in complete Dulbecco's modified Eagle medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) with 100 U/ml penicillin and 100 µg/ml streptomycin (Sigma-Aldrich, St. Louis, MO, USA) at 37°C in a humidified incubator containing 5% CO2.

RT-qPCR

The mir-Vana miRNA Isolation kit (Ambion; Thermo Fisher Scientific, Inc.) was used to isolate total RNA from frozen patient samples and cell lines, according to the manufacturer's protocol (21). The RNA was treated with DNase (Invitrogen; Thermo Fisher Scientific, Inc.). cDNA was synthesized using the Universal cDNA Synthesis kit II (Exiqon, Vedbaek, Denmark). The RT-qPCR analyses were performed in the ABI PRISM 7300 Sequence Detection System (Applied Biosystems; Thermo Fisher Scientific, Inc.) using ExiLENT SYBR Green Master Mix (Exiqon) for miR-517a. The reactions were incubated at 95°C for 60 sec, followed by 40 cycles of 95°C for 5 sec and 60°C for 34 sec. RNU6B (U6) was measured as an internal control for miRNA. All samples were normalized to internal controls and fold changes were calculated based on relative quantification (2−ΔΔCq). The primers for miR-517a and U6 were purchased from Exiqon. The following primer sequences were used: miR-517a stem-loop RT primer, CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACACTCTA; miR-517a forward, CGGCGGATCGTGCATCCCTTTA; miR-517a reverse, GTGCAGGGTCCGAGGT; U6 forward, CTCGCTTCGGCAGCACA; U6 reverse, AACGCTTCACGAATTTGCGT.

Target prediction

To determine the molecular mechanisms by which miR-517a inhibits CRC cell migration and invasion, predicted target genes of miR-517a were retrieved and analyzed using the publicly available databases, TargetScan 6.2 (www.targetscan.org) and miRanda (www.microrna.org).

Immunohistochemical staining

The paraffin-embedded tissue samples from postoperative patients were cut in 5-cm sections. Then the samples were deparaffinized in xylene (ZSGB-BIO, Beijing, China) and rehydrated using a series of graded alcohol. Slides were blocked with 10% goat serum (ZSGB-BIO) prior to incubation with rabbit anti-human polyclonal FOXJ3 (dilution, 1:100; cat no. SAB4500907; Sigma-Aldrich) antibody. The samples were incubated overnight with the primary antibody at 4°C, and then incubated with goat anti-rabbit secondary antibody (dilution, 1:1,000; cat no. ZDR-5403; ZSGB-BIO) at room temperature for 2h followed by 3,3′-diaminobenzidine-labeled secondary antibody. Subsequently, sections were counterstained with hematoxylin (ZSGB-BIO). Protein staining was evaluated under a light microscope (BX-51; Olympus, Tokyo, Japan) at x400 magnification.

Cell transfection

miRNA vectors, including miR-517a expression vector (HmiR0330-MR04), scrambled control vector for miR-517a (CmiR0001-MR04), miR-517a inhibitor (HmiR-AN0575-AM04) and negative control for the miR-517a inhibitor (CmiR-AN0001-AM04), were purchased from Genecopoeia (Guangzhou, China). Cells were transfected with the aforementioned vectors using Lipofectamine 2000, according to the manufacturer's instructions (Invitrogen; Thermo Fisher Scientific, Inc.).

Transwell assays

Transwell migration assays were performed in 12-well plates with 8-µm BioCoat control inserts (BD Biosciences, Bedford, MA, USA). Cells (1–2×105) that were suspended in 500 µl serum-free DMEM were seeded in the upper well. DMEM medium with 10% FBS was added to the lower well. After 12 h incubation, the membranes were removed, cells on the side facing the upper well were wiped with a cotton swab, and the membranes were stained with crystal violet (MCE China, Shanghai, China). At least 6 representative images of each well were captured (BX-51; Olympus, Tokyo, Japan) and cell numbers were counted using ImageJ software (version 1.46r; National Institutes of Health, Bethesda, MD, USA). A BioCoat Matrigel invasion chamber (BD Biosciences) was used for Transwell invasion assays; otherwise, the same protocols were used for Transwell migration assays. The experiments were performed in triplicate.

Western blot analysis

Total proteins were extracted from cells with radioimmunoprecipitation lysis buffer (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) and centrifuged at 14,000 × g for 10 min, separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Sigma-Aldrich) at 165 V for 1.5 h and then transferred onto a PVDF membrane (Roche, Indianapolis, IN, USA). The membrane was blocked with 5% skimmed milk (Shanghai Haoran Bio Technologies Co., Ltd., Shanghai, China and incubated with the appropriate antibody overnight at 4°C. The following primary antibodies were used: Rabbit anti-human polyclonal FOXJ3 (dilution, 1:1,000; cat no. SAB4500907; Sigma-Aldrich) and mouse anti-human monoclonal GAPDH (dilution, 1:5,000; cat no. G8140; United States Biological, Swampscott, MA, USA). Horseradish peroxidase-conjugated donkey anti-rabbit and goat anti-mouse secondary antibodies (cat nos. sc-2313 and sc-2005, respectively; Santa Cruz Biotechnology, Inc.) were used at room temperature for 2 h with a dilution of 1:1,000–1:5,000 and expression as detected using enhanced chemiluminescence reagents (Thermo Fisher Scientific, Inc.).

Statistical analysis

Results are expressed as the mean ± standard error of the mean. The quantitative data were compared between two groups using the two-tailed Student's t-test. Categorical data were analyzed using the Pearson's χ2 test. The Kaplan-Meier method and log-rank test were used to compare the cumulative recurrence and survival rates. The independent factors influencing the survival and recurrence of CRC patients were determined using the Cox proportional hazards model. Correlation analysis was tested by the Spearman's rank correlation coefficient. P<0.05 was considered to indicate statistically significant differences.

Results

Clinical significance of miR-517a in CRC specimens

The expression of miR-517a was determined by RT-qPCR and normalized against an endogenous control (U6 RNA) in 90 pairs of CRC and adjacent non-tumor tissues. The data indicated that the expression of miR-517a in CRC tissues was significantly higher than in adjacent non-tumor tissues (P<0.001; Fig. 1A). The expression of miR-517a was considered to be low (n=45) or high (n=45) according to the cutoff value, which was defined as the median of the cohort. As indicated in Table I, clinical association analysis revealed that high expression of miR-517a was prominently associated with poor prognostic features, including high tumor invasion, lymph node metastases, distant metastasis and advanced TNM stage (P<0.05). Furthermore, CRC patients with high expression of miR-517a were associated with poor overall and disease-free survival (P=0.011 and 0.046, respectively; Fig. 1B and C). Notably, miR-517a expression, in addition to TNM stage, is an independent factor for predicting the survival of patients with CRC (P<0.05; Table II). These data indicate that miR-517a acts as a potent biomarker for predicting the prognosis of patients with CRC.

Figure 1.

Expression and prognostic significance of miR-517a in colorectal cancer (CRC). (A) Comparing differences in the expression levels of miR-517a between CRC tissues (tumor) and matched adjacent non-tumor tissues. *P<0.05 vs. tumor. According to the level of miR-517a expression, Kaplan-Meier 5-year (B) overall and (C) disease-free survival curves of CRC patients showed that high expression of miR-517a was correlated with poor prognosis. The median miR-517a expression value obtained for the 90 CRC samples, as detected by reverse transcription-quantitative polymerase chain reaction, was used as the cutoff value. miR, micro RNA.

Table II.

Multivariate Cox regression analysis of 5-year overall and disease-free survival of 90 patients with colorectal cancer.

Table II.

Multivariate Cox regression analysis of 5-year overall and disease-free survival of 90 patients with colorectal cancer.

Overall survivalDisease-free survival


VariableHR95% CIP-valueHR95% CIP-value
Tumor invasion (T1/T2 vs. T3/T4)1.5110.998–2.4100.0511.5230.969–2.3950.068
Lymph node metastases (absent vs. present)1.4370.939–2.2000.0951.3950.894–2.1780.143
Distant metastasis (absent vs. present)1.9281.161–3.2040.011a1.3850.911–2.1060.127
TNM stage (I/II vs. III/IV)1.9931.290–3.0800.002a1.6231.034–2.5480.035a
miR-517a expression (low vs. high)2.3941.466–3.909 <0.001a1.7541.033–2.9780.038a

a Statistically significant. HR, hazard ratio; CI, confidence interval.

miR-517a promotes cell migration and invasion in CRC

A noncancerous colon epithelial cell line (HCEC) was used as a control to evaluate the expression of miR-517a in HCT-116 and SW480 cells in a pre-experiment. The levels of miR-517a expression in the HCT-116 and SW480 cells were approximately 4.6– and-1.5 fold higher compared with the HCEC cells (data not shown). To investigate the potential role of miR-517a in CRC, the expression of miR-517a was altered by transfecting CRC cells with miR-517a mimics and inhibitors. As assessed by RT-qPCR, the expression of miR-517a was significantly downregulated by miR-517a inhibitors in HCT-116 cells (P=0.011; Fig. 2A). Transwell migration assays were performed to analyze the effect of altering miR-517a levels on cell migration. It was determined that downregulation of miR-517a led to a significant reduction of cell migration in HCT-116 cells (P=0.018; Fig. 2B). Furthermore, as determined by Transwell invasion assays, the number of invaded HCT-116 cells was significantly reduced following downregulation of miR-517a (P=0.032; Fig. 2B). Next, SW480 cells, which showed a significant 5.43–fold reduction in miR-517a expression compared with HCT-116 cells under normal conditions, were used for gain-of-function experiments. miR-517a-overexpressing SW480 cells were established and confirmed by RT-qPCR (P=0.005; Fig. 3A). As expected, upregulation of miR-517a significantly increased the number of migrated and invaded SW480 cells (P=0.008 and 0.019, respectively; Fig. 3B). Thus, miR-517a appears to promote cell migration and invasion in CRC.

Figure 2.

Downregulation of miR-517a inhibits HCT-116 cell migration and invasion. (A) HCT-116 cells that were transfected with NC and miR-517a inhibitor (anti-miR-517a) were subjected to reverse transcription-quantitative polymerase chain reaction to determine miR-517a expression. n=3 independent experiments. *P<0.05 vs. NC. (B) Cell migration and invasion, as measured by Transwell assays, were inhibited by downregulation of miR-517a in HCT-116 cells as compared with control cells. n=3 repeats with similar results. *P<0.05. Scale bar, 100 µm. Crystal violet staining. miR, micro RNA; NC, negative control.

Figure 3.

Upregulation of miR-517a inhibits SW480 cell migration and invasion. (A) SW480 cells that were transfected with miR-control (control) and miR-517a were subjected to reverse transcription-quantitative polymerase chain reaction to determine miR-517a expression. n=3 independent experiments. *P<0.05 vs. control. (B) miR-517a-overexpressing SW480 cells conferred greater cell migration and invasion as compared with control cells. n=3 repeats with similar results. *P<0.05. Scale bar, 100 µm. Crystal violet staining. miR, micro RNA.

miR-517a inversely regulates FOXJ3 abundance in CRC

A previous study reported that miR-517a-3p accelerates cell proliferation, migration and invasion through inhibiting FOXJ3 expression in human lung cancer (18). In addition, TargetScan and miRanda databases were used to identify FOXJ3 as one of the targets of miR-517a. Therefore, HCT-116 cells transfected with negative control or miR-517a inhibitors were subjected to western blotting for FOXJ3. As assessed by immunoblotting, downregulation of miR-517a significantly increased the expression of FOXJ3 protein in HCT-116 cells (P=0.014; Fig. 4A). By contrast, upregulation of miR-517a significantly decreased the expression of FOXJ3 protein in SW480 cells (P=0.004; Fig. 4B). Next, the correlation between FOXJ3 and miR-517a expression were evaluated in CRC tissues. The expression of FOXJ3 in miR-517a high-expressing tumors was significantly lower than those in miR-517a low-expressing tumors (P<0.001; Fig. 5). Furthermore, Spearman's rank correlation analysis indicated that miR-517a was inversely correlated with FOXJ3 expression in CRC tissues (r=−0.458; P=0.012). Taken together, these data indicate that miR-517a suppresses FOXJ3 expression in CRC.

Figure 4.

miR-517a inversely regulates FOXJ3 expression in colorectal cancer cells. (A) Downregulation of miR-517a increased FOXJ3 protein in HCT-116 cells. n=3 independent experiments, *P<0.05. (B) Upregulation of miR-517a led to a significant reduction of FOXJ3 expression in SW480 cells. n=3 independent experiments, *P<0.05. NC, negative control; FOXJ3, forkhead box J3; miR, micro RNA.

Figure 5.

An inverse correlation between miR-517a and FOXJ3 is observed in colorectal cancer tissues. In cases of low miR-517a expression, there was strong FOXJ3 protein expression in the same tissue section. By contrast, in the case of high miR-517a expression, there was weak FOXJ3 protein expression. Quantitative data showed that the expression of FOXJ3 in miR-517a high-expressing tumors was significantly lower than those in miR-517a low-expressing tumors. Scale bar, 50 µm. 3,3′-diaminobenzidine staining. *P<0.05. FOXJ3, forkhead box J3; IHC, immunohistochemistry; miR, micro RNA.

Discussion

Increasing evidence has indicated that the deregulation and dysfunction of miRNAs is key in the development and progression of CRC (22,23). Increased expression of oncomiRs and decreased expression of tsmiRs have been observed in CRC tissues as compared with adjacent non-tumor tissues (24). However, miRNAs that are correlated with the recurrence and metastasis of CRC remain poorly understood. Considering the findings of previous studies, the present study aimed to explore the clinical significance of miR-517a and its role in CRC cell migration and invasion. The current data demonstrated that the expression of miR-517a in CRC tissues was significantly higher than in adjacent noncancerous tissues. Clinical analysis determined that high expression of miR-517a was significantly correlated with high tumor invasion, lymph node metastases, distant metastasis and advanced TNM stage in CRC. Furthermore, Kaplan-Meier and multivariate Cox regression analysis demonstrated that miR-517a was an independent prognostic marker for the predicting survival of patients with CRC. Together, these results suggest that miR-517a is critical for the prognostic determination in CRC.

miR-517a has been proposed to be involved in tumor metastasis of HCC and lung cancer (16,18). Therefore, the role of miR-517a in CRC was further investigated. The present study identified that downregulation of miR-517a inhibited cell migration and invasion in HCT-116 cells. Furthermore, upregulation of miR-517a increased the number of migrated and invaded SW480 cells. These data suggest that miR-517a promotes cell migration and invasion in CRC. To determine the molecular mechanisms by which miR-517a inhibits CRC cell migration and invasion, predicted target genes of miR-517a were retrieved and analyzed using publicly available databases (TargetScan and miRanda). FOXJ3, which is known to be a key transcription factor of mitochondrial biogenesis and was identified to upregulate myocyte enhancer factor 2C (25,26), was predicted as one of the targets of miR-517a. A recent study reported that miR-517a-3p accelerates cell proliferation, migration and invasion through inhibiting FOXJ3 expression in human lung cancer (18). Thus, the regulatory effect of miR-517a on FOXJ3 in CRC cells was investigated. The data indicated that downregulation of miR-517a increased the expression level of FOXJ3 protein in HCT-116 cells. By contrast, upregulation of miR-517a reduced FOXJ3 expression in SW480 cells. Furthermore, a significant inverse correlation between miR-517a and FOXJ3 expression was observed in CRC tissues. Accordingly, we propose that miR-517a may promote cell migration and invasion by targeting FOXJ3 in CRC.

In conclusion, the present study determined that miR-517a is overexpressed in CRC and its high expression is associated with poor prognostic features. Furthermore, high expression of miR-517a appears to be a prognostic marker for predicting poor survival of CRC patients. In vitro experiments demonstrated that miR-517a facilitates CRC cell migration and invasion. Mechanistically, we propose that miR-517a may promote CRC cell mobility by suppressing FOXJ3. Taken together, we propose that miR-517a may potentially act as a clinical biomarker and may also be a therapeutic target in CRC.

Acknowledgements

The present study was supported by a grant from the National Natural Science Foundation of China (no. 81171356).

References

1 

Li L and Ma BB: Colorectal cancer in Chinese patients: Current and emerging treatment options. Onco Targets Ther. 7:1817–1828. 2014.PubMed/NCBI

2 

Jemal A, Bray F, Center MM, Ferlay J, Ward E and Forman D: Global cancer statistics. CA Cancer J Clin. 61:69–90. 2011. View Article : Google Scholar : PubMed/NCBI

3 

van Hees F, Saini SD, Lansdorp-Vogelaar I, Vijan S, Meester RG, de Koning HJ, Zauber AG and van Ballegooijen M: Personalizing colonoscopy screening for elderly individuals based on screening history, cancer risk, and comorbidity status could increase cost effectiveness. Gastroenterology. 149:1425–1437. 2015. View Article : Google Scholar : PubMed/NCBI

4 

Croce CM: Causes and consequences of microRNA dysregulation in cancer. Nat Rev Genet. 10:704–714. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Wu WK, Lee CW, Cho CH, Fan D, Wu K, Yu J and Sung JJ: MicroRNA dysregulation in gastric cancer: A new player enters the game. Oncogene. 29:5761–5771. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Tu K, Zheng X, Dou C, Li C, Yang W, Yao Y and Liu Q: MicroRNA-130b promotes cell aggressiveness by inhibiting peroxisome proliferator-activated receptor gamma in human hepatocellular carcinoma. Int J Mol Sci. 15:20486–20499. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Tu K, Li C, Zheng X, Yang W, Yao Y and Liu Q: Prognostic significance of miR-218 in human hepatocellular carcinoma and its role in cell growth. Oncol Rep. 32:1571–1577. 2014.PubMed/NCBI

8 

Sun HB, Chen X, Ji H, Wu T, Lu HW, Zhang Y, Li H and Li YM: miR494 is an independent prognostic factor and promotes cell migration and invasion in colorectal cancer by directly targeting PTEN. Int J Oncol. 45:2486–2494. 2014.PubMed/NCBI

9 

Liu K, Li G, Fan C, Zhou X, Wu B and Li J: Increased expression of microRNA-21 and its association with chemotherapeutic response in human colorectal cancer. J Int Med Res. 39:2288–2295. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Jahid S, Sun J, Edwards RA, Dizon D, Panarelli NC, Milsom JW, Sikandar SS, Gümüs ZH and Lipkin SM: miR-23a promotes the transition from indolent to invasive colorectal cancer. Cancer Discov. 2:540–553. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Colangelo T, Fucci A, Votino C, Sabatino L, Pancione M, Laudanna C, Binaschi M, Bigioni M, Maggi CA, Parente D, et al: MicroRNA-130b promotes tumor development and is associated with poor prognosis in colorectal cancer. Neoplasia. 15:1218–1231. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Ahmed FE: miRNA as markers for the diagnostic screening of colon cancer. Expert Rev Anticancer Ther. 14:463–485. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Zhang C, Liu J, Wang X, Wu R, Lin M, Laddha SV, Yang Q, Chan CS and Feng Z: MicroRNA-339-5p inhibits colorectal tumorigenesis through regulation of the MDM2/p53 signaling. Oncotarget. 5:9106–9117. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Bao Y, Chen Z, Guo Y, Feng Y, Li Z, Han W, Wang J, Zhao W, Jiao Y, Li K, et al: Tumor suppressor microRNA-27a in colorectal carcinogenesis and progression by targeting SGPP1 and Smad2. PLoS One. 9:e1059912014. View Article : Google Scholar : PubMed/NCBI

15 

Zhang L, Dong Y, Zhu N, Tsoi H, Zhao Z, Wu CW, Wang K, Zheng S, Ng SS, Chan FK, et al: microRNA-139-5p exerts tumor suppressor function by targeting NOTCH1 in colorectal cancer. Mol Cancer. 13:1242014. View Article : Google Scholar : PubMed/NCBI

16 

Toffanin S, Hoshida Y, Lachenmayer A, Villanueva A, Cabellos L, Minguez B, Savic R, Ward SC, Thung S, Chiang DY, et al: MicroRNA-based classification of hepatocellular carcinoma and oncogenic role of miR-517a. Gastroenterology. 140:1618–1628, e16. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Feng J, Kim ST, Liu W, Zhang Z, Zhu Y, Berens M, Sun J and Xu J: An integrated analysis of germline and somatic, genetic and epigenetic alterations at 9p21.3 in glioblastoma. Cancer. 118:232–240. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Jin J, Zhou S, Li C, Xu R, Zu L, You J and Zhang B: MiR-517a-3p accelerates lung cancer cell proliferation and invasion through inhibiting FOXJ3 expression. Life Sci. 108:48–53. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Tong LL, Gao P, Wang ZN, Song YX, Xu YY, Sun Z, Xing CZ and Xu HM: Is the seventh edition of the UICC/AJCC TNM staging system reasonable for patients with tumor deposits in colorectal cancer? Ann Surg. 255:208–213. 2012. View Article : Google Scholar : PubMed/NCBI

20 

World Medical Association: World Medical Association Declaration of Helsinki: Ethical principles for medical research involving human subjects. JAMA. 310:2191–2194. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Chang RM, Yang H, Fang F, Xu JF and Yang LY: MicroRNA-331-3p promotes proliferation and metastasis of hepatocellular carcinoma by targeting PH domain and leucine-rich repeat protein phosphatase. Hepatology. 60:1251–1263. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Muhammad S, Kaur K, Huang R, Zhang Q, Kaur P, Yazdani HO, Bilal MU, Zheng J, Zheng L and Wang XS: MicroRNAs in colorectal cancer: Role in metastasis and clinical perspectives. World J Gastroenterol. 20:17011–17019. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Tokarz P and Blasiak J: The role of microRNA in metastatic colorectal cancer and its significance in cancer prognosis and treatment. Acta Biochim Pol. 59:467–474. 2012.PubMed/NCBI

24 

Bonfrate L, Altomare DF, Di Lena M, Travaglio E, Rotelli MT, De Luca A and Portincasa P: MicroRNA in colorectal cancer: New perspectives for diagnosis, prognosis and treatment. J Gastrointestin Liver Dis. 22:311–320. 2013.PubMed/NCBI

25 

Landgren H and Carlsson P: FoxJ3, a novel mammalian forkhead gene expressed in neuroectoderm, neural crest and myotome. Dev Dyn. 231:396–401. 2004. View Article : Google Scholar : PubMed/NCBI

26 

Alexander MS, Shi X, Voelker KA, Grange RW, Garcia JA, Hammer RE and Garry DJ: Foxj3 transcriptionally activates Mef2c and regulates adult skeletal muscle fiber type identity. Dev Biol. 337:396–404. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Ma W, Yu Q, Jiang J, Du X, Huang L, Zhao L and Zhou Q: miR-517a is an independent prognostic marker and contributes to cell migration and invasion in human colorectal cancer. Oncol Lett 11: 2583-2589, 2016.
APA
Ma, W., Yu, Q., Jiang, J., Du, X., Huang, L., Zhao, L., & Zhou, Q. (2016). miR-517a is an independent prognostic marker and contributes to cell migration and invasion in human colorectal cancer. Oncology Letters, 11, 2583-2589. https://doi.org/10.3892/ol.2016.4269
MLA
Ma, W., Yu, Q., Jiang, J., Du, X., Huang, L., Zhao, L., Zhou, Q."miR-517a is an independent prognostic marker and contributes to cell migration and invasion in human colorectal cancer". Oncology Letters 11.4 (2016): 2583-2589.
Chicago
Ma, W., Yu, Q., Jiang, J., Du, X., Huang, L., Zhao, L., Zhou, Q."miR-517a is an independent prognostic marker and contributes to cell migration and invasion in human colorectal cancer". Oncology Letters 11, no. 4 (2016): 2583-2589. https://doi.org/10.3892/ol.2016.4269
Copy and paste a formatted citation
x
Spandidos Publications style
Ma W, Yu Q, Jiang J, Du X, Huang L, Zhao L and Zhou Q: miR-517a is an independent prognostic marker and contributes to cell migration and invasion in human colorectal cancer. Oncol Lett 11: 2583-2589, 2016.
APA
Ma, W., Yu, Q., Jiang, J., Du, X., Huang, L., Zhao, L., & Zhou, Q. (2016). miR-517a is an independent prognostic marker and contributes to cell migration and invasion in human colorectal cancer. Oncology Letters, 11, 2583-2589. https://doi.org/10.3892/ol.2016.4269
MLA
Ma, W., Yu, Q., Jiang, J., Du, X., Huang, L., Zhao, L., Zhou, Q."miR-517a is an independent prognostic marker and contributes to cell migration and invasion in human colorectal cancer". Oncology Letters 11.4 (2016): 2583-2589.
Chicago
Ma, W., Yu, Q., Jiang, J., Du, X., Huang, L., Zhao, L., Zhou, Q."miR-517a is an independent prognostic marker and contributes to cell migration and invasion in human colorectal cancer". Oncology Letters 11, no. 4 (2016): 2583-2589. https://doi.org/10.3892/ol.2016.4269
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team