Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
December-2016 Volume 12 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2016 Volume 12 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Ubiquitin specific protease 21 upregulation in breast cancer promotes cell tumorigenic capability and is associated with the NOD-like receptor signaling pathway

  • Authors:
    • Liang Peng
    • Yi Hu
    • Demeng Chen
    • Ruixia Linghu
    • Yingzhe Wang
    • Xiaoxue Kou
    • Junlan Yang
    • Shunchang Jiao
  • View Affiliations / Copyright

    Affiliations: Department of Oncology, Chinese PLA General Hospital, Beijing 100853, P.R. China, School of Dentistry, University of California, Los Angeles, CA 90095, USA
    Copyright: © Peng et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 4531-4537
    |
    Published online on: October 14, 2016
       https://doi.org/10.3892/ol.2016.5263
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Ubiquitination and deubiquitination have emerged as critical regulators in cancer. In the present study, the expression pattern of 50 ubiquitin‑specific proteases (USPs) was summarized in breast cancer using a bioinformatics approach, and USP21 was identified as the most altered gene in breast cancer. In particular, expression of USP21 in triple negative breast cancer (TNBC) cell lines was greater compared with other subtypes of breast cancer. Knockdown of USP21 in TNBC cells inhibited cell proliferation, migration and invasion. Microarray profiling of the USP21 knockdown cells revealed significant downregulation of multiple genes associated with the NOD‑like receptor signaling pathway. The results of the present study suggest that USP21 has a significant role in TNBC progression, and therefore may represent a novel therapeutic target.

Introduction

Breast cancer is the most common carcinoma in women, with low survival rates in patients due to metastatic lesions (1,2). Triple negative breast cancer (TNBC) is an aggressive breast cancer subtype in which the tumor cells lack expression of the estrogen, progesterone and human epidermal growth factor 2 receptors. TNBC has a high rate of relapse and metastasis, and accounts for approximately 12–17% of all breast cancer cases (1,3). Due to poor prognosis and a lack of treatment options, TNBC patients have a disproportionately high mortality rate: No more than 30% of patients with metastatic TNBC survive for 5 years (4). Therefore, understanding the mechanism regulating TNBC progression may assist with the development of accurate prognosticators and more effective treatments.

Cancer comprises a collection of complicated genetic and epigenetic alterations that arise via multistep processes (5–7). Ubiquitin-specific proteases (USPs) are frequently involved in cancer regulation, as oncogenic mutations in USP genes are able to disrupt deubiquitination of proteins that control cell growth and apoptosis (8–10). To date, 50 USP family members have been identified in humans (11). USP21 is able to facilitate initiation of transcriptional activity via catalyzing the hydrolysis of the ubiquitylation of histone H2A (12). USP21 is also able to regulate the stability of proteins through deubiquitination. For example, USP21 can mediate deubiquitination of GATA3 and maintain GATA3 expression in regulatory T cells (13). Thus, USP proteins may serve as a good point of intervention for the prevention of cancer and other mutation-associated diseases (14).

Nucleotide oligomerization domain (NOD)-like receptor (NLR) signaling pathways have a significant role in numerous human diseases, including bacterial infections, autoimmune and inflammatory disorders, and cancer (15). Stimulation of NLRs results in the activation of nuclear factor (NF)-κB and mitogen-activated protein kinases (MAPKs), which drive the transcription of numerous genes involved in both innate and adaptive immune responses (16). Previously, USPs have been shown to participate in the regulation of the NF-κB signaling pathway (17,18). For example, USP4 promotes stimulation of NF-κB mediated by tumor necrosis factor α (TNF-α) through deubiquitination-dependent downregulation of TGFβ-activated kinase 1 (19). USP11 is able to modulate TNF-α-induced NF-κB activation through regulation of nuclear factor of κ light polypeptide gene enhancer in B-cells inhibitor α (IκBα) stability (20). By contrast, USP21 inhibits TNF-α-induced NF-κB signaling by promoting the deubiquitination of receptor-interacting protein 1 (RIP1) in HeLa cells (21). However, the role of USP21 in breast cancer remains to be elucidated.

In the present study, bioinformatics tools were used to study data online and characterize the gene alteration status of USP family members in breast cancer. Subsequently, the expression of the most altered member, USP21, was validated in vitro. The expression of USP21 was then knocked down using small interfering RNA (siRNA) in TNBC cell lines, and cellular experiments were performed to investigate its biological function, in the hope that the results may provide useful insights into the prognosis and treatment of TNBC.

Materials and methods

Cell culture and siRNA transfection

All breast cancer cells were obtained from American Type Culture Collection (Manassas, VA, USA) and maintained in Dulbecco's modified Eagle's medium (DMEM; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) and 1% PenStrep (100 U/ml penicillin and 100 µg/ml streptomycin; Invitrogen; Thermo Fisher Scientific, Inc.), in an incubator at 37°C with 5% CO2. MDA-MB-231 or MDA-MB-157 cells were plated onto tissue culture plates 24 h prior to transfection. Transient transfection of siUSP21 (siUSP21-1: 5′-GCUAGAAGAACCUGAGUUA-3′; siUSP21-2: 5′-GAGCUGUCUUCCAGAAAUA-3′) or siControl (5′-GUACUUGUACUCCAGCUUUGUG-3′) (Invitrogen; Thermo Fisher Scientific, Inc.) at a final concentration of 50 nM was accomplished with Lipofectmine® 2000 reagent according to the manufacturer's protocol (Invitrogen; Thermo Fisher Scientific, Inc.).

Cell migration assay

For scratch wound-healing assays, 48 h following siRNA transfection, 1.5×105 cells were seeded into six-well plates and serum starved for 24 h. Cells were wounded by scratching with a pipette tip and cultured in medium containing 0.5 g/ml mitomycin-C (Sigma-Aldrich; EMD Millipore, Billerica, MA, USA) to block cell division. Cells were photographed at 0, 5 and 10 h timepoints. The distance of migration was calculated using ImageJ software (version 1.46; imagej.nih.gov/ij/). Matrigel invasion assay was performed using a Corning® BioCoat™ Matrigel Invasion Chamber (Corning Incorportated, Corning, NY, USA). Tumor cells (1×105) treated with control or USP21 siRNA in 200 µl serum-free DMEM were placed in the upper chamber. The lower chamber was filled with 600 µl conditioned medium (DMEM medium containing 1% FBS for 24 h) as chemoattractant. After 24 h of incubation at 37°C, the cells on the upper surface of the filter were removed with a cotton swab. The cells that had invaded the Matrigel and reached the lower surface of the filter were fixed in methanol, stained with hematoxylin and eosin, and counted under magnification, ×400. A total of five fields were randomly selected and the number of invasive cells was counted.

Protein isolation, western blot analysis and co-immunoprecipitation (Co-IP)

Cells were lysed with radioimmunoprecipitation assay buffer (Sigma-Aldrich; EMD Millipore) as previously described (22–24). Cells were centrifuged at 4°C for 10 min at 16,000 × g. Protein concentrations were determined by the Bradford assay (25). Aliquots containing 20 µg of total protein were separated by 10% sodium dodecyl-polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes. Blots were probed with primary antibodies against USP21 (1:1,000; goat polyclonal; sc-79305; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) and β-actin (1:5,000, mouse monoclonal; A5316; Sigma-Aldrich; EMD Millipore). Appropriate secondary antibodies (1:3,000; rabbit anti-goat; ab6741; 1:5,000; rabbit anti-mouse; ab97046; Abcam, Cambridge, MA, USA) conjugated to horseradish peroxidase and enhanced chemiluminescence (GE Healthcare Life Sciences, Chalfont, UK) were used to detect the bound primary antibodies. Co-IP was performed with cell lysate (500 µg) incubated with USP21 (1:1,000; goat polyclonal; sc-79305; Santa Cruz Biotechnology, Inc.), relA (1:1,000; rabbit polyclonal; sc-372; Santa Cruz Biotechnology, Inc.) or non-specific-IgG antibodies (1:1,000; rabbit IgG, monoclonal; ab172730; Abcam) using µMACS™ Protein A/G MicroBeads and MACS® Separation Columns according to the manufacturer's protocol (Miltenyi Biotec, Auburn, USA).

RNA isolation, cDNA preparation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

As previously described (26–28), total RNA was isolated from cells using the RNeasy Mini kit (Qiagen, Inc., Valencia, CA, USA). cDNA was prepared from 1 µg of RNA using the iScript cDNA Synthesis kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA). RT-qPCR was performed using a GeneAmp Gold RNA PCR Core kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) and an iCycler iQ™ Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.), where each 20 µl reaction included 1% cDNA preparation, 0.5 µM primers and 10 µl SYBR Green (Bio-Rad Laboratories, Inc.). Primer sequences are presented in Table I. Expression of glyceraldehyde-3-phosphate dehydrogenase was used to normalize the gene expression level. The relative difference in the expression level was calculated using the ΔΔCq method (29). The data presented are representative of three independent biological repeats each assayed in triplicate and show the relative expression levels.

Table I.

Reverse transcription-qPCR primer sequences.

Table I.

Reverse transcription-qPCR primer sequences.

Gene nameF/RSequences of the qPCR primer pairs (5′-3′ direction)
GAPDHF GGTGAAGGTCGGAGTCAACGG
GAPDHR GAGGTCAATGAAGGGGTCATTG
USP21F ATCTCGGACCAACTTAGCCC
USP21R GTGCCCTCCCAAGGCAATC
IL8F TTTTGCCAAGGAGTGCTAAAGA
IL8R AACCCTCTGCACCCAGTTTTC
CARD8F GAAGCGAAACTGCATATTCTGGT
CARD8R GGGTTGGAAGAGGCATGGC
CCL2F CAGCCAGATGCAATCAATGCC
CCL2R TGGAATCCTGAACCCACTTCT
IL6F ACTCACCTCTTCAGAACGAATTG
IL6R CCATCTTTGGAAGGTTCAGGTTG
CXCL1F GCGGAAAGCTTGCCTCAA
CXCL1R TCAGCATCTTTTCGATGATTTTCTT
NLRP3F GATCTTCGCTGCGATCAACAG
NLRP3R CGTGCATTATCTGAACCCCAC
NFKB1AF AACAGAGAGGATTTCGTTTCCG
NFKB1AR TTTGACCTGAGGGTAAGACTTCT

[i] qPCR, quantitative polymerase chain reaction; F, forward; R, reverse; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; USP21, ubiquitin specific protease 21; IL, interleukin; CARD8, caspase recruitment domain family member 8; CCL2, chemokine (C-C motif) ligand 2; CXCL1, chemokine (C-X-C motif) ligand 1; NFKBIA, nuclear factor of κ light polypeptide gene enhancer in B-cells inhibitor α.

Microarray hybridization data analysis and The Cancer Genome Atlas (TCGA) analysis

MDA-MB-231 cells were plated onto a 6-well plate at 70% confluence and transfected with siControl or siUSP21. A total of 48 h subsequent to transfection, the cells were washed with phosphate-buffered saline, and total RNA was obtained using the RNeasy Mini kit (Qiagen, Inc.) and treated with 1 unit of DNase I (Qiagen, Inc.). Expression profiles were generated by hybridizing 10 µg of total RNA to GeneChip® Human Genome U133 Plus2.0 Gene Chips (Affymetrix, Inc., Santa Clara, CA, USA) according to the Affymetrix Eukaryote One-cycle protocol (30). Briefly, 5–10 µg of total RNA were used to generate biotinylated cDNA, which was fragmented and hybridized to a chip for 16 h at 45°C in a GeneChip Hybridization Oven 640 (Affymetrix, Inc.). Arrays were then washed and stained on a GeneChip Fluidics Station 450 (Affymetrix, Inc.) and subsequently scanned on a GeneChip Scanner 3000 7G (Affymetrix, Inc.) to obtain fluorescence intensities. To eliminate data with low reliability, genes whose expression was regarded as absent in these cell lines as a result of software analysis were excluded. Following identification of the differentially expressed genes, DAVID online software (david.ncifcrf.gov/) was used to perform Kyoto Encyclopedia of Genes and Genomes pathway significant enrichment analysis of 1,007 differentially expressed genes associated with USP21, and the six signaling pathways with the smallest P-values were selected. For TCGA analysis, data including 1,105 breast invasive carcinoma samples from 1,098 patients were obtained from the TCGA website using the cBioPortal tool (www.cbioportal.org/).

Statistical analysis

Data are presented as the mean ± standard deviation. Statistical analyses were performed using SPSS version 19.0 software (IBM SPSS, Armonk, NY, USA). Statistically significant differences were determined by Student's t-test. P<0.05 was considered to indicate a statistically significant difference.

Results

USP21 is the most upregulated USP family member in breast cancer

USP family proteins have a significant role in multiple signaling and cell regulatory networks in breast cancer (9). To characterize the extent of changes in all 50 USP genes in breast cancer, the present study generated an alteration-summary for these genes in breast cancer using the cBioPortal tool for Cancer Genomics (31,32) (Fig. 1A). The results of the present study demonstrated that USP21 was altered in 39% (375/971 samples) of patients with breast invasive carcinomas, indicating it is the most altered gene among all the USP gene family members. In all the deregulation situations, including gene copy number amplification and mRNA expression alteration, of USP21, 13.6% (132/971) of the patients displayed copy number amplification, while 37.8% (367/971) of the patients showed mRNA upregulation (Fig. 1B), suggesting a role for USP21 in breast cancer.

Figure 1.

Alterations of the human USP21 gene in breast invasive carcinoma (TCGA). (A) Alterations of the USP gene family in breast invasive carcinoma (TCGA). (B) Amplification, mutation, mRNA upregulation and mRNA downregulation of the USP21 gene in breast invasive carcinoma (TCGA). Data was obtained using c-BioPortal. (C) The relative mRNA expression level of USP21 across ten breast cancer cell lines. USP21, ubiquitin specific protease 21; TGCA, The Cancer Genome Atlas.

To investigate the expression of USP21 in breast cancer cell lines in vitro, the present study analyzed a panel of 10 breast cancer cell lines including luminal, basal and non-cancerous breast epithelial lines. Notably, it was observed that the expression of USP21 was enriched in triple negative cell lines, MDA-MB-231 and MDA-MB-157 (Fig. 1C). Therefore, it appears that USP21 is required for the cancerous ability of TNBC cells.

USP21 affects TNBC cell proliferation, migration and invasion

To directly investigate the contribution of USP21 to breast tumorigenesis, the present study knocked down USP21 protein using two specific siRNAs in MDA-MB-231 and MDA-MB-157 cells. Western blot analysis confirmed the knockdown of USP21 under these conditions (Fig. 2A). It was initially investigated whether USP21 is crucial to the proliferation of these cells. Cells transfected with control or USP21-siRNAs were cultured for up to 7 days. The difference in cell proliferation was measured by viable cell counting from day 1 to day 7. Knockdown of USP21 reduced the proliferation of MDA-MB-157 and MDA-MB-231 cells 5 days after siRNA transfection (Fig. 2B and C).

Figure 2.

Effect of USP21 on triple negative breast cancer cell proliferation. (A) MDA-MB-231 and MDA-MB-157 cells were transfected with scrambled siRNA (control) and two specific USP21 siRNAs, followed by western blot analysis using anti-USP21 antibody (upper panel). β-actin was used as loading control (lower panel). (B and C) Proliferation of MDA-MB-231 and MDA-MB-157 cells transfected with USP21 siRNA or control siRNA. *P<0.05. siRNA, small interfering RNA; USP21, ubiquitin specific protease 21.

To determine the effects of USP21 on cell migration, a wound-healing assay was performed following USP21 silencing. The scratch wounds were almost identical sizes in each experimental group at 0 h; however, knockdown of USP21 using two different siRNAs markedly decreased the migration ability of MDA-MB-231 and MDA-MB-157 cells at 5 and 10 h (Fig. 3A). The present study measured the distance between the migrating frontlines and calculated the rate of wound closure. It was observed that the USP21 silenced groups were less effective than the control group in terms of the healing process (Fig. 3A).

Figure 3.

Effect of USP21 on TNBC cell motility. (A) Representative images showing the scratch (wound) at 0, 5 and 10 h for TNBC cells with various treatments. Magnification, ×40. The graphs show the percentage of wound closure in MDA-MB-231 and MDA-MB-157 cells with various treatments. Data are presented as the mean ± SD of three independent experiments. *P<0.05. (B) The invasive ability of MDA-MB-231 and MDA-MB-157 cells 48 h subsequent to transfection with siControl, siUSP21-1 or siUSP21-2, was assayed using a Matrigel-coated transwell chamber. The cells that successfully invaded into the Matrigel were quantified 24 h after plating. Statistically significant differences were detected when control groups were compared with the USP21 knockdown groups. Data are presented as the mean ± SD of three independent experiments. *P<0.05. USP21, ubiquitin specific protease 21; TNBC, triple negative breast cancer; SD, standard deviation; si, small interfering.

To investigate the role of USP21 in TNBC cell invasion, the present study measured the invasive ability using invasion assays. Consistent with the migration assay results, downregulation of USP21 in MDA-MB-231 and MDA-MB-157 cells by siRNA knockdown resulted in a marked reduction in the cell invasive capability compared to the control group (Fig. 3B). These results suggested that USP21 is involved in TNBC cancer growth, migration and invasion.

Microarray data analysis indicates that USP21 expression is associated with NOD-like receptor signaling pathway

To further investigate USP21-mediated gene expression changes, the cDNA from USP21-knockdown and control MDA-MB-231 cells was subjected to microarray analyses. A total of 1,007 genes in USP21 siRNA treated cells exhibited a differential expression more than double that of the control sample. A total of 309 genes were upregulated in the USP21 knockdown sample compared with the control, while 698 genes demonstrated decreased expression in the USP21 siRNA treated sample. Furthermore, it was observed that the major signaling pathways of the differentially expressed genes were associated with the following molecular pathways: NOD-like receptor signaling, TGF-β signaling pathway, RNA degradation, small cell lung cancer, pathways in cancer and extracellular matrix-receptor interaction. It was observed that USP21 depletion markedly attenuated genes specifically associated with the NOD-like receptor signaling pathway [interleukin (IL)6, NLR family, pyrin domain containing (NLRP)3, IκBα and chemokine (C-X-C motif) ligand (CXCL)8] and stimulated genes associated with the TGF-β signaling pathway (bone morphogenetic protein (BMP)4, BMP type IB receptor, ID1, ID2, ID3, ID4 and TGF-β receptor 1) (Fig. 4A and B). To confirm the microarray results, 8 genes were selected (USP21, IL8, caspase recruitment domain family member 8 (CARD8), chemokine (C-C motif) ligand 2 (CCL2), IL6, CXCL1, NLRP3 and IκBα) and their expression was measured with RT-qPCR on the same sample used for microarray studies. All of these genes exhibited moderate to high expression and demonstrated high concordance between microarray and PCR data (Fig. 4C).

Figure 4.

Global gene profiling of MDA-MB-231 following USP21 knockdown. (A) Summary of the kyoto enclyclopedia of genes and genomes pathways of genes significantly enriched in response to USP21 knockdown, using database for annotation, visualization and integrated discovery software. (B) Changes in gene expression levels in MDA-MB-231 cells following USP21 knockdown. The heat map depicts relative gene expression changes (siRNA control/siUSP21-1). (C) Confirmation of downregulated genes from the microarray dataset by reverse transcription-quantitative polymerase chain reaction. *P<0.05. (D) Co-immunoprecipitation of USP21 and relA in MDA-MB-231 cells. USP21, ubiquitin specific protease 21; ECM, extracellular matrix; TGF, transforming growth factor; NOD, nucleotide-binding oligomerization domain; siRNA, small interfering RNA; IL, interleukin; CARD8, caspase recruitment domain family member 8; MAPK8, mitogen-activated protein kinase 8; BIRC3, baculoviral IAP repeat containing 3; CCL2, chemokine (C-C motif) ligand 2; CXCL, chemokine (C-X-C motif) ligand; RIPK2, receptor interacting serine/threonine kinase 2; XIAP, X-linked inhibitor of apoptosis protein; NLRP3, NLR family pyrin domain containing 3; NFKBIA, nuclear factor of κ light polypeptide gene enhancer in B-cells inhibitor α; IP, immunoprecipitation.

As USP21 has been reported to be a histone H2A deubiquitinase that initiates transcriptional activity (12), the present study screened the association of USP21 with NOD-like receptor associated transcription factors, including NF-κB, activator protein 1 or interferon regulatory factors. Notably, it was observed that relA, an essential subunit of the transcriptionally active NF-κB dimer, may be ‘pulled down’ with USP21 using a co-IP assay (Fig. 4D). Thus, these results indicate that USP21 may associate with NF-κB transcription factors.

Discussion

TNBC is an aggressive and deadly subtype of breast cancer and lacks targeted therapies (33). In the present study, it was observed that USP21 is the most altered USP member in breast cancer using online TCGA data sets. Furthermore, the present study demonstrated, for the first time to the best of our knowledge, that silencing of USP21 leads to impaired proliferation, migration and invasion ability of TNBC cells, which indicates that USP21 may be involved in tumor metastasis. The present study also investigated global gene profiling upon depletion of USP21 in TNBC cells. The results of the present study revealed that a subset of genes involved in NLR signaling pathways were significantly repressed when USP21 was knocked down in TNBC cells. It was also observed that USP21 was associated with relA, implying a link between USP21 and NF-κB in regulating NLR signaling and TNBC progression.

The NLR signaling pathway plays a vital role in human diseases, including cancer (15). In the current study, it was demonstrated that silencing of USP21 repressed several NLR signaling pathway factors, including IL6, IL8, CCL2, CXCL1, NLRP3, IκBα and CARD8. A number of these genes are involved in TNBC regulation. For example, inhibition of IL-6 and IL-8 expression in TNBC led to a decrease in colony formation and cell survival in vitro and inhibited tumor engraftment and growth in vivo (34). In addition, RIPK2 can stimulate triple-negative breast cancer cell migration and invasion through NF-κB and c-Jun N-terminal kinase signaling pathways (35). Thus, it appears likely that the impaired tumorigenic ability in USP21 depleted TNBC cells may be directly associated with this downregulation of NLR signaling pathway members.

Several studies have demonstrated a role of USP21 in inflammation and the NF-κB signaling pathway (21,36,37). It has been previously shown that USP21 is able to regulate the expression of IL8 and cancer stem cell properties in human renal cell carcinoma (28). IL8 has been demonstrated to be an important cytokine that is required for growth of TNBC (34), supporting the results of the present study. Through deubiqutinating RIP1, USP21 is able to repress TNFα-induced NF-κB activation in HeLa cells, suggesting that USP21 may serve as a negative regulator of the NF-κB signaling pathway (21). An additional study has revealed that depletion of USP21 decreases IL33 protein levels and IL33-mediated NF-κB p65 promoter activity, indicating USP21 is able to positively regulate the NF-κB signaling pathway (36). Therefore, although USP21 is involved in NF-κB signaling transduction activity, the function of USP21 appears to be context dependent. Based on the fact that NLR signaling pathway components were repressed upon USP21 depletion, and USP21 was associated with relA, it is likely USP21 is a positive regulator of the NF-κB signaling pathway in TNBC cells. If that is the case, the global regulation of histone deubiquitination by USP21 requires further investigation. IL6 and IL8 have critical roles in anchorage-independent growth of TNBC, and function through the NF-κB signaling pathway (34), meaning that NF-κB may be a potential therapeutic target in TNBC. A previous report demonstrated that NF-κB regulates cancer stem cell populations in the basal-like breast cancer subtype of TNBC (38). In addition, TGF-β ligands are often enriched in the TNBC tumor microenvironment and have a role in breast cancer stem cells (39,40). The results of the present study suggest that USP21 may serve as a modulator for the TGF-β signaling pathway in TNBC.

In conclusion, USP21 was observed to be elevated in breast cancer patient samples. The expression of USP21 may promote proliferation, migration and invasion of breast cancer cells. Therefore, USP21 may have a potential role in the prognosis of and be a relevant target in breast cancer.

Acknowledgements

The present research was supported by the China National Nature Science Youth Fund (grant no. 30600613).

References

1 

Siegel RL, Miller KD and Jemal A: Cancer statistics, 2016. CA Cancer J Clin. 66:7–30. 2016. View Article : Google Scholar : PubMed/NCBI

2 

Zang QQ, Zhang L, Gao N and Huang C: Ophiopogonin D inhibits cell proliferation, causes cell cycle arrest at G2/M, and induces apoptosis in human breast carcinoma MCF-7 cells. J Integr Med. 14:51–59. 2016. View Article : Google Scholar : PubMed/NCBI

3 

Foulkes WD, Smith IE and Reis-Filho JS: Triple-negative breast cancer. N Engl J Med. 363:1938–1948. 2010. View Article : Google Scholar : PubMed/NCBI

4 

Lehmann BD, Bauer JA, Chen X, Sanders ME, Chakravarthy AB, Shyr Y and Pietenpol JA: Identification of human triple-negative breast cancer subtypes and preclinical models for selection of targeted therapies. J Clin Invest. 121:2750–2767. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Liang Y, Zhu F, Zhang H, Chen D, Zhang X, Gao Q and Li Y: Conditional ablation of TGF-β signaling inhibits tumor progression and invasion in an induced mouse bladder cancer model. Sci Rep. 6:294792016. View Article : Google Scholar : PubMed/NCBI

6 

Sun S, Xu A, Yang G and Cheng Y: Galanin is a novel epigenetic silenced functional tumor suppressor in renal cell carcinoma. Cancer Translational Medicine. 1:183–187. 2015. View Article : Google Scholar

7 

Cheng Y, Tu Y and Liang P: Promoter methylated tumor suppressor genes in glioma. Cancer Translational Medicine. 1:123–130. 2015. View Article : Google Scholar

8 

Mani A and Gelmann EP: The ubiquitin-proteasome pathway and its role in cancer. J Clin Oncol. 23:4776–4789. 2005. View Article : Google Scholar : PubMed/NCBI

9 

Pal A and Donato NJ: Ubiquitin-specific proteases as therapeutic targets for the treatment of breast cancer. Breast Cancer Res. 16:4612014. View Article : Google Scholar : PubMed/NCBI

10 

Chen D, Dai C and Jiang Y: Histone H2A and H2B deubiquitinase in developmental disease and cancer. Cancer Translational Med. 1:170–175. 2015. View Article : Google Scholar

11 

Reyes-Turcu FE, Ventii KH and Wilkinson KD: Regulation and cellular roles of ubiquitin-specific deubiquitinating enzymes. Annu Rev Biochem. 78:363–397. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Nakagawa T, Kajitani T, Togo S, Masuko N, Ohdan H, Hishikawa Y, Koji T, Matsuyama T, Ikura T, Muramatsu M and Ito T: Deubiquitylation of histone H2A activates transcriptional initiation via trans-histone cross-talk with H3K4 di- and trimethylation. Genes Dev. 22:37–49. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Zhang J, Chen C, Hou X, Gao Y, Lin F, Yang J, Gao Z, Pan L, Tao L, Wen C, et al: Identification of the E3 deubiquitinase ubiquitin-specific peptidase 21 (USP21) as a positive regulator of the transcription factor GATA3. J Biol Chem. 288:9373–9382. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Sippl W, Collura V and Colland F: Ubiquitin-specific proteases as cancer drug targets. Future Oncol. 7:619–632. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Saxena M and Yeretssian G: NOD-like receptors: Master regulators of inflammation and cancer. Front Immunol. 5:3272014. View Article : Google Scholar : PubMed/NCBI

16 

Yimam M, Lee YC, Moore B, Jiao P, Hong M, Nam JB, Kim MR, Hyun EJ, Chu M, Brownell L and Jia Q: Analgesic and anti-inflammatory effects of UP1304, a botanical composite containing standardized extracts of Curcuma longa and Morus alba. J Integr Med. 14:60–68. 2016. View Article : Google Scholar : PubMed/NCBI

17 

Wertz IE, O'Rourke KM, Zhou H, Eby M, Aravind L, Seshagiri S, Wu P, Wiesmann C, Baker R, Boone DL, et al: De-ubiquitination and ubiquitin ligase domains of A20 downregulate NF-kappaB signalling. Nature. 430:694–699. 2004. View Article : Google Scholar : PubMed/NCBI

18 

Tzimas C, Michailidou G, Arsenakis M, Kieff E, Mosialos G and Hatzivassiliou EG: Human ubiquitin specific protease 31 is a deubiquitinating enzyme implicated in activation of nuclear factor-kappaB. Cell Signal. 18:83–92. 2006. View Article : Google Scholar : PubMed/NCBI

19 

Fan YH, Yu Y, Mao RF, Tan XJ, Xu GF, Zhang H, Lu XB, Fu SB and Yang J: USP4 targets TAK1 to downregulate TNFα-induced NF-κB activation. Cell Death Differ. 18:1547–1560. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Sun W, Tan X, Shi Y, Xu G, Mao R, Gu X, Fan Y, Yu Y, Burlingame S, Zhang H, et al: USP11 negatively regulates TNFalpha-induced NF-kappaB activation by targeting on IkappaBalpha. Cell Signal. 22:386–394. 2010. View Article : Google Scholar : PubMed/NCBI

21 

Xu G, Tan X, Wang H, Sun W, Shi Y, Burlingame S, Gu X, Cao G, Zhang T, Qin J and Yang J: Ubiquitin-specific peptidase 21 inhibits tumor necrosis factor alpha-induced nuclear factor kappaB activation via binding to and deubiquitinating receptor-interacting protein 1. J Biol Chem. 285:969–978. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Pei M, Chen D, Li J and Wei L: Histone deacetylase 4 promotes TGF-beta1-induced synovium-derived stem cell chondrogenesis but inhibits chondrogenically differentiated stem cell hypertrophy. Differentiation. 78:260–268. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Zhu XX, Yan YW, Chen D, Ai CZ, Lu X, Xu SS, Jiang S, Zhong GS, Chen DB and Jiang YZ: Long non-coding RNA HoxA-AS3 interacts with EZH2 to regulate lineage commitment of mesenchymal stem cells. Oncotarget. 2016.(Epub ahead of print). doi: 10.18632/oncotarget.11538.

24 

Chen Y, Wang M, Chen D, Wang J and Kang N: Chromatin remodeling enzyme CHD7 is necessary for osteogenesis of human mesenchymal stem cells. Biochem Biophys Res Commun. 478:1588–1593. 2016. View Article : Google Scholar : PubMed/NCBI

25 

Bradford MM: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 72:248–254. 1976. View Article : Google Scholar : PubMed/NCBI

26 

Chen D, Jarrell A, Guo C, Lang R and Atit R: Dermal β-catenin activity in response to epidermal Wnt ligands is required for fibroblast proliferation and hair follicle initiation. Development. 139:1522–1533. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Budnick I, Hamburg-Shields E, Chen D, Torre E, Jarrell A, Akhtar-Zaidi B, Cordovan O, Spitale RC, Scacheri P and Atit RP: Defining the identity of mouse embryonic dermal fibroblasts. Genesis. 54:415–430. 2016. View Article : Google Scholar : PubMed/NCBI

28 

Peng L, Hu Y, Chen D, Jiao S and Sun S: Ubiquitin specific peptidase 21 regulates interleukin-8 expression, stem-cell like property of human renal cell carcinoma. Oncotarget. 2016.(Epub ahead of print). doi: 10.18632/oncotarget.9751. View Article : Google Scholar

29 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

30 

Johansson P, Pavey S and Hayward N: Confirmation of a BRAF mutation-associated gene expression signature in melanoma. Pigment Cell Res. 20:216–221. 2007. View Article : Google Scholar : PubMed/NCBI

31 

Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, Sun Y, Jacobsen A, Sinha R, Larsson E, et al: Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci Signal. 6:pl12013. View Article : Google Scholar : PubMed/NCBI

32 

Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, Jacobsen A, Byrne CJ, Heuer ML, Larsson E, et al: The cBio cancer genomics portal: An open platform for exploring multidimensional cancer genomics data. Cancer Discov. 2:401–404. 2012. View Article : Google Scholar : PubMed/NCBI

33 

Anders C and Carey LA: Understanding and treating triple-negative breast cancer. Oncology (Williston Park). 22:1233–1240, 1243. 2008.PubMed/NCBI

34 

Hartman ZC, Poage GM, den Hollander P, Tsimelzon A, Hill J, Panupinthu N, Zhang Y, Mazumdar A, Hilsenbeck SG, Mills GB and Brown PH: Growth of triple-negative breast cancer cells relies upon coordinate autocrine expression of the proinflammatory cytokines IL-6 and IL-8. Cancer Res. 73:3470–3480. 2013. View Article : Google Scholar : PubMed/NCBI

35 

Singel SM, Batten K, Cornelius C, Jia G, Fasciani G, Barron SL, Wright WE and Shay JW: Receptor-interacting protein kinase 2 promotes triple-negative breast cancer cell migration and invasion via activation of nuclear factor-kappaB and c-Jun N-terminal kinase pathways. Breast Cancer Res. 16:R282014. View Article : Google Scholar : PubMed/NCBI

36 

Tao L, Chen C, Song H, Piccioni M, Shi G and Li B: Deubiquitination and stabilization of IL-33 by USP21. Int J Clin Exp Pathol. 7:4930–4937. 2014.PubMed/NCBI

37 

Fan Y, Mao R, Yu Y, Liu S, Shi Z, Cheng J, Zhang H, An L, Zhao Y, Xu X, et al: USP21 negatively regulates antiviral response by acting as a RIG-I deubiquitinase. J Exp Med. 211:313–328. 2014. View Article : Google Scholar : PubMed/NCBI

38 

Yamamoto M, Taguchi Y, Ito-Kureha T, Semba K, Yamaguchi N and Inoue J: NF-κB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4:22992013. View Article : Google Scholar : PubMed/NCBI

39 

Mani SA, Guo W, Liao MJ, Eaton EN, Ayyanan A, Zhou AY, Brooks M, Reinhard F, Zhang CC, Shipitsin M, et al: The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 133:704–715. 2008. View Article : Google Scholar : PubMed/NCBI

40 

Bhola NE, Balko JM, Dugger TC, Kuba MG, Sánchez V, Sanders M, Stanford J, Cook RS and Arteaga CL: TGF-β inhibition enhances chemotherapy action against triple-negative breast cancer. J Clin Invest. 123:1348–1358. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Peng L, Hu Y, Chen D, Linghu R, Wang Y, Kou X, Yang J and Jiao S: Ubiquitin specific protease 21 upregulation in breast cancer promotes cell tumorigenic capability and is associated with the NOD-like receptor signaling pathway. Oncol Lett 12: 4531-4537, 2016.
APA
Peng, L., Hu, Y., Chen, D., Linghu, R., Wang, Y., Kou, X. ... Jiao, S. (2016). Ubiquitin specific protease 21 upregulation in breast cancer promotes cell tumorigenic capability and is associated with the NOD-like receptor signaling pathway. Oncology Letters, 12, 4531-4537. https://doi.org/10.3892/ol.2016.5263
MLA
Peng, L., Hu, Y., Chen, D., Linghu, R., Wang, Y., Kou, X., Yang, J., Jiao, S."Ubiquitin specific protease 21 upregulation in breast cancer promotes cell tumorigenic capability and is associated with the NOD-like receptor signaling pathway". Oncology Letters 12.6 (2016): 4531-4537.
Chicago
Peng, L., Hu, Y., Chen, D., Linghu, R., Wang, Y., Kou, X., Yang, J., Jiao, S."Ubiquitin specific protease 21 upregulation in breast cancer promotes cell tumorigenic capability and is associated with the NOD-like receptor signaling pathway". Oncology Letters 12, no. 6 (2016): 4531-4537. https://doi.org/10.3892/ol.2016.5263
Copy and paste a formatted citation
x
Spandidos Publications style
Peng L, Hu Y, Chen D, Linghu R, Wang Y, Kou X, Yang J and Jiao S: Ubiquitin specific protease 21 upregulation in breast cancer promotes cell tumorigenic capability and is associated with the NOD-like receptor signaling pathway. Oncol Lett 12: 4531-4537, 2016.
APA
Peng, L., Hu, Y., Chen, D., Linghu, R., Wang, Y., Kou, X. ... Jiao, S. (2016). Ubiquitin specific protease 21 upregulation in breast cancer promotes cell tumorigenic capability and is associated with the NOD-like receptor signaling pathway. Oncology Letters, 12, 4531-4537. https://doi.org/10.3892/ol.2016.5263
MLA
Peng, L., Hu, Y., Chen, D., Linghu, R., Wang, Y., Kou, X., Yang, J., Jiao, S."Ubiquitin specific protease 21 upregulation in breast cancer promotes cell tumorigenic capability and is associated with the NOD-like receptor signaling pathway". Oncology Letters 12.6 (2016): 4531-4537.
Chicago
Peng, L., Hu, Y., Chen, D., Linghu, R., Wang, Y., Kou, X., Yang, J., Jiao, S."Ubiquitin specific protease 21 upregulation in breast cancer promotes cell tumorigenic capability and is associated with the NOD-like receptor signaling pathway". Oncology Letters 12, no. 6 (2016): 4531-4537. https://doi.org/10.3892/ol.2016.5263
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team