Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
July-2018 Volume 16 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2018 Volume 16 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Naringin inhibits ovarian tumor growth by promoting apoptosis: An in vivo study

  • Authors:
    • Liping Cai
    • Heli Wu
    • Chunhua Tu
    • Xiaochun Wen
    • Bei Zhou
  • View Affiliations / Copyright

    Affiliations: Department of Obstetrics and Gynecology, The First Affiliated Hospital of Nanchang University, Nanchang, Jiangxi 330006, P.R. China, Graduate School, Nanchang University, Nanchang, Jiangxi 330006, P.R. China
    Copyright: © Cai et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 59-64
    |
    Published online on: May 2, 2018
       https://doi.org/10.3892/ol.2018.8611
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The aim of the present study was to investigate the antitumor activities of naringin in ovarian cancer, and to assess the underlying mechanisms. Ovarian tumor cells were implanted into nude mice to produce ovarian tumors in vivo. The mice were divided into six groups: Control, low dose naringin [0.5 mg/kg, intraperitoneal (i.p.)], middle dose naringin (1 mg/kg, i.p.), high dose naringin (2 mg/kg, i.p.), positive control (cisplatin, 2 mg/kg, i.p.) and a combination of cisplatin and naringin (both 2 mg/kg). Following administration of naringin and/or cisplatin, the tumor size and weight were measured. Apoptosis of tumor cells was detected using a terminal deoxynucleotidyl transferase dUTP nick end labeling assay. Apoptosis‑associated gene expression was detected using reverse transcription‑polymerase chain reaction and immunohistochemistry. In the range of 0.5‑2 mg/kg, naringin dose‑dependently inhibited tumor growth, as demonstrated by a decrease in tumor size and weight. Naringin promoted apoptosis of the ovarian tumor cells. Additionally, naringin reduced the expression of B‑cell lymphoma (Bcl)‑2, Bcl‑extra large (Bcl‑xL), cyclin D1, c‑Myc and survivin, while it increased the expression of caspase‑3 and caspase‑7. The data demonstrated that naringin inhibited ovarian tumor growth in vivo. Its mechanisms may be associated with caspase‑7‑, caspase‑3‑, Bcl‑2‑ and Bcl‑xL‑mediated apoptosis. Nevertheless, the clinical application of naringin in the treatment of ovarian cancer requires further study.

Introduction

Ovarian cancer is a common type of malignancy, and also the main cause of gynecological cancer mortality (1). Due to the location of the ovaries, there are no notable symptoms in the early stage of carcinogenesis (2). The majority of patients are diagnosed with advanced-stage ovarian cancer, with the symptoms including an abdominal mass, ascites and notable weight loss (3). Surgery combined with chemotherapy is still the most effective treatment for ovarian cancer (4). Surgery has the ability to eliminate the tumor foci, but it is difficult to completely remove the tumor with surgery alone (5). Furthermore, ovarian cancer cells are prone to metastasize, and the numerous small tumor metastases are problematic due to the difficulty in observing them without a microscope (6). Therefore, chemotherapy is required following surgery to suppress residual tumors, though the frequent use of chemotherapeutic agents can cause adverse reactions and drug resistance (7).

Chinese herbal medicines are extensively reported to kill tumor cells, as well as to not be susceptible to drug resistance and to have few adverse effects (8). Naringin is a bioflavonoid and polyphenolic compound that is located in grapefruit (9). Previous studies have indicated that naringin has a number of pharmacological activities, including anti-inflammation, anti-oxidative stress, myocardial protection, and the regulation of glucose and lipid metabolism (10). Naringin can also induce cancer cell apoptosis via eliminating free radicals using its antioxidant activity, and by inhibiting oncogene expression and cell proliferation (11–13). Naringin can inhibit carcinogenic substance-induced DNA chain destruction, which maintains the stability of genetic information and prevents the occurrence of DNA mutations (10). Additionally, naringin effectively inhibits β-carotene, which in turn reduces carcinogenic substance-induced DNA chain destruction (14,15); however, the antitumor effect of naringin in ovarian cancer and its underlying mechanism remains unknown.

Xenotransplanted cells are vital for investigating the mechanisms underlying tumorigenesis and treatments (16). In the present study, an in vivo tumor model was established via implanting SKOV3 cells in nude mice, and the intervention of naringin was evaluated by calculating the size and weight of tumors. Furthermore, apoptosis was detected in order to investigate the role of naringin in the treatment of ovarian cancer. The current study aimed to provide preclinical evidence for the treatment of ovarian cancer with naringin.

Materials and methods

Cell culture

The SKOV3 cell line was purchased from The Shanghai Institutes for Biological Sciences, Chinese Academy of Science (Shanghai, China). The cells were cultured at 37°C, in an atmosphere containing 5% CO2, in Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal calf serum (HyClone; GE Healthcare Life Sciences, Logan, UT, USA), 100 U/ml penicillin and 100 mg/ml streptomycin.

Establishment of tumor models

A total of 30 female Balb/c nude mice (15–18 g, 4 weeks old) were purchased from The Shanghai Laboratory Animal Center, Chinese Academy of Science, and housed in specific pathogen-free conditions that were automatically maintained at a temperature of 23±2°C, a relative humidity of 45–65%, and a controlled 12/12 h light/dark cycle. Animals had ad libitum access to food and water. All protocols were approved and supervised by the ethics committee of the First Affiliated Hospital of Nanchang University (Nanchang, China). The mice implanted with the tumor cell line were randomly divided into six groups (n=5 in each group): Control, low-dose naringin [0.5 mg/kg, intraperitoneal (i.p.)], middle-dose naringin (1 mg/kg, i.p.), high-dose naringin (2 mg/kg, i.p.), positive control (cisplatin, 2 mg/kg, i.p.), and combination of cisplatin and naringin (cisplatin, 2 mg/kg; naringin, 2 mg/kg). SKOV3 cells in the logarithmic growth phase (1×107) were diluted in 0.2 ml PBS and injected (i.p) into the Balb/c nude mice. Naringin (purity, >90%; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) and/or cisplatin (Sigma-Aldrich; Merck KGaA) were administered for 10 consecutive days, following attainment of a tumor size of 50 mm3. General conditions of the mice were monitored daily and the tumor size was measured every two days. Following 10 days of drug administration, the mice were anesthetized using isoflurane and decapitated thereafter, and the whole tumor was removed. The tumor specimens were fixed in 4% paraformaldehyde in PBS (pH 7.4) at 4°C overnight and then embedded in paraffin for tissue sectioning.

Reverse transcription-polymerase chain reaction (RT-PCR)

Total RNA was extracted from the tumors using a TRIzol® kit (Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. The purity of mRNA was determined using the optical density (OD) at 280/260 nm. Reverse transcription was performed using Random Primer kit (Hexadeoxyribonucleotide mixture; cat. no. 3801; Takara Biotechnology, Co., Ltd., Dalian, China) and Moloney murine leukemia virus reverse transcriptase (Promega Corporation, Madison, WI, USA). The primers were added into a 25-µl PCR reaction system, following a protocol of denaturation at 95°C for 46 sec, annealing at 60°C for 45 sec, and then elongation at 72°C for 60 sec for 36 cycles. The primers were as follows: Cyclin D1, forward AAACTGAAATGGGACTTGG and reverse AGGGTGGATTGGAGATAAA; survivin, forward TTCATCCACTGCCCTACC and reverse GTGCTTTCTATGCTCCTCTAT; c-Myc, forward GGGAGTGGTTCAGGATTGG and reverse GCATCGTCGTGGCTGTCT; caspase-7, forward GTTGACGCCAAGCCAGAC and reverse AATCCATGCGGTACAGATAAG; caspase-3, forward CTAATCTGACGGTCCTCC and reverse TCGCCAAATCTTGCTAAT; Bcl-xL, forward GGGCTGTCTGTCGAATCTG and reverse CTGGAGGCGTAAGGTCAA; Bcl-2, forward ACGTGTAACTTGTAGCGGATAT and reverse GCTGAAAGGTGAAGAGGC; and GAPDH, forward GCAAGTTCAACGGCACAG and reverse CGCCAGTAGACTCCACGAC.

Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay

TUNEL staining was performed on 30 µm slices using the DeadEnd™ Colorimetric TUNEL System (Promega Corporation), following the manufacturer's instructions. Following staining, the sections were observed using a FV1000 Olympus Confocal Laser Scanning Microscope (Olympus Corporation, Tokyo, Japan).

Immunohistochemical staining (IHC)

Tumor tissues were fixed in 10% formaldehyde at room temperature for 24 h and embedded in paraffin. The 3-µm sections were continuously sliced. Following dewaxing by xylene, the tissues were dehydrated in 70, 75, 80, 85 and 95% alcohol. To retrieve the antigen, 3% hydrogen peroxide was applied at 100°C. The slices were blocked in 5% BSA (Hyclone; GE Healthcare Life Sciences, Logan, UT, USA) at 37°C for 30 min. Immunostaining of histological sections was performed using monoclonal antibodies against cyclin D1 (dilution, 1:200; cat no. ab134175), c-Myc (dilution, 1:200; cat no. ab32072), survivin (dilution, 1:200; cat no. ab469), caspase-3 (dilution, 1:200; cat no. ab13585), caspase-7 (dilution, 1:200; cat no. ab69540), Bcl-2 (dilution, 1:200; cat no. ab32124) and Bcl-xL (dilution, 1:200; cat no. ab32370; all from Abcam, Cambridge, MA, USA) overnight at 4°C, followed by a 30 min incubation with horseradish peroxidase (HRP)-coupled secondary antibodies goat anti-mouse immunoglobulin (Ig)G HRP (dilution, 1:500; cat no. P0447; Dako; Agilent Technologies, Inc., Santa Clara, CA, USA) or goat anti-rabbit IgG HRP (dilution, 1:500, cat no. P0448; Dako; Agilent Technologies, Inc., Santa Clara, CA, USA) and then sections were visualized with diaminobenzidine for 3 min under a light microscope with ×200 magnification. PBS was used instead of the primary antibody in the negative control group. The positive staining was analyzed using ImageJ software version 1.48 (National Institutes of Health, Bethesda, MD, USA).

Statistical analysis

Data are presented as the mean ± standard error of the mean and analyzed by SPSS 19.0 (IBM Corp., Armonk, NY, USA). One-way analysis of variance with Bonferroni correction post-hoc for multiple comparisons was performed. P<0.05 was considered to indicate a statistically significant difference.

Results

Naringin inhibits ovarian cancer growth

As depicted in Fig. 1A and B, in the first four days of treatment, the mean values of tumor sizes in each group were comparable. By contrast, following treatment for six days, the tumor inhibition by naringin was observable based upon the tumor sizes, particularly in the naringin and cisplatin combination group. Following 10 days of treatment, the tumor size (mean value) in each group was in the following order (largest to smallest): Control, 0.5 mg/kg naringin, 1 mg/kg naringin, 2 mg/kg naringin, positive control and combination (Fig. 1B). The data indicated that naringin inhibits tumor growth in a dose-dependent manner. The tumor weight was also measured. As depicted in Fig. 1C, cisplatin, 2 mg/kg naringin, and the cisplatin and naringin combination significantly reduced the tumor weight, compared with the control (P<0.05).

Figure 1.

Naringin inhibited ovarian cancer growth. (A) The nude mice and tumors. (B) Volume and (C) weight of the tumors following naringin administration. The data are expressed as the mean ± standard error of the mean. n=5 in each group. *P<0.05, compared with the negative control.

Naringin promotes apoptosis in ovarian tumors

Apoptosis was detected in the tumor cells. As depicted in Fig. 2, naringin triggered apoptosis in ovarian tumors in a dose-dependent manner in the range 0.5–2 mg/kg. The cisplatin, 2 mg/kg naringin, and cisplatin and naringin combination groups notably promoted apoptosis.

Figure 2.

Naringin promoted apoptosis in the ovarian tumors. The blue staining indicated the nucleus with green staining indicating apoptosis. The green cells were pronounced in the model group.

Naringin regulates apoptosis-associated gene expression

Apoptosis-associated gene expression was also detected. As depicted in Fig. 3, naringin increased the expression of caspase-7 and caspase-3 protein (Fig. 3A) and mRNA (Fig. 3B) in a dose-dependent manner. In particular, the cisplatin, 2 mg/kg naringin, and cisplatin and naringin combination groups notably promoted the expression of caspase-7 and caspase-3, compared with the control (P<0.05).

Figure 3.

Naringin increased the expression of caspase-7 and caspase-3. (A) Protein expression as detected by immunohistochemistry. (B) mRNA expression as detected by reverse transcription-polymerase chain reaction. The data are expressed as the mean ± standard error of the mean. n=5 in each group. *P<0.05, compared with the negative control.

The expression of Bcl-2 and Bcl-xL was also evaluated via IHC (Fig. 4A) and RT-PCR (Fig. 4B). Naringin reduced the expression of Bcl-2 and Bcl-xL protein and mRNA in a dose-dependent manner. In particular, the cisplatin, 2 mg/kg naringin, and cisplatin and naringin combination groups significantly reduced the expression of Bcl-2 and Bcl-xL, compared with the control (P<0.05).

Figure 4.

Naringin reduced the expression of Bcl-2 and Bcl-xL. (A) Protein expression as detected by immunohistochemistry. (B) mRNA expression as detected by reverse transcription-polymerase chain reaction. The data are expressed as the mean ± standard error of the mean. n=5 in each group. *P<0.05, compared with the negative control. Bcl-xL, B-cell lymphoma-extra large.

Naringin reduces cell growth-associated gene expression

Cyclin D1, c-Myc and survivin were detected in each group. As depicted in Fig. 5, naringin reduced the expression of cyclin D1, c-Myc and survivin protein (Fig. 5A) and mRNA (Fig. 5B) in a dose-dependent manner. In particular, the cisplatin, 2 mg/kg naringin and cisplatin and naringin combination groups significantly reduced cyclin D1, c-Myc and survivin, compared with the control (P<0.05).

Figure 5.

Naringin reduced the expression of cyclin D1, c-Myc and survivin. (A) Protein expression as detected by immunohistochemistry. (B) mRNA expression as detected by reverse transcription-polymerase chain reaction. The data are expressed as the mean ± standard error of the mean. n=5 in each group. *P<0.05, compared with the negative control.

Discussion

In the present study, nude mouse tumor xenograft models were produced and administered naringin. The data demonstrated that the tumor volume and weight were reduced gradually with the increased dose of naringin, and that naringin has an antitumor effect in vivo.

Caspases belong to the aspartic acid specific cysteine protease family (17). Caspase-3 and caspase-7 serve important roles in the process of apoptosis (18). Caspase-3 is a regulator of cell death (18). When caspase-3 is inhibited, apoptosis is prohibited, which contributes to tumorigenesis (19). A previous study demonstrated that caspase-3 and caspase-7 have synergistic effects in promoting apoptosis (20). The results also demonstrated that the expression of caspase-3 and caspase-7 was upregulated significantly with an increased dose of naringin. The results indicated that naringin has the ability to induce apoptosis via promoting the expression of caspase-3 and caspase-7. Bcl-2 can inhibit the apoptosis of tumor cells (21) and Bcl-xL prohibits apoptosis in the absence of a cell growth factor (21). Takehara et al (22) revealed that the expression level of Bcl-xL in hepatocellular carcinoma tissues was significantly higher, compared with paracancerous tissue, which could inhibit apoptosis during serum starvation and p53 activation. The results demonstrated that naringin reduced the expression of Bcl-2 and Bcl-xL, which promoted apoptosis. The data further indicated that naringin has an antitumor effect via the promotion of apoptosis.

Cyclin D1 belongs to the group of cell cycle regulating proteins, can be expressed continuously under mitogen stimulation, which can then promote cell proliferation, and participate in tumorigenesis (23). Cyclin D1 is highly expressed in tumor cells; it is not only associated with the occurrence and development of tumors, but also with tumor prognosis, metastasis and tumor recurrence following radiotherapy (24). c-Myc affects the processes of cell growth, differentiation and apoptosis, and the cell cycle, and the abnormal expression of these molecules frequently occurs in the early phase of carcinogenesis; in addition, it is closely associated with tumor proliferation and the initiation of cancer (25). c-Myc has dual effects; not only does it promote cell apoptosis, but it also stimulates cell proliferation (26). As a nuclear protein-regulating gene, c-Myc serves an important role in regulating tumor-associated gene expression and modulating cell invasion, growth and metastasis (27); however, overexpression of c-Myc alone cannot cause the malignant change in tissues (28,29). The survivin gene is a novel inhibitor of apoptosis (30), which participates in regulating cell growth and proliferation (31). The results demonstrated that with an increase in the naringin concentration, the protein expression of cyclin D1, c-Myc and survivin was reduced significantly. These results indicate that naringin can induce apoptosis in tumor cells.

In conclusion, the data demonstrated that naringin inhibited ovarian tumor growth in vivo. Its mechanisms may be associated with caspase-7, caspase-3, Bcl-2 and Bcl-xL-mediated apoptosis. Furthermore, naringin also reduced the expression of cyclin D1, c-Myc and survivin. Nevertheless, the clinical application of naringin in the treatment of ovarian cancer warrants further study.

Acknowledgements

The present study was supported by The Science and Technology Support Plan from Jiangxi, China (grant no. 20152ACG70022).

References

1 

Viau M, Renaud MC, Gregoire J, Sebastianelli A and Plante M: Paraneoplastic syndromes associated with gynecological cancers: A systematic review. Gynecol Oncol. 146:661–671. 2017. View Article : Google Scholar : PubMed/NCBI

2 

Banach P, Suchy W, Dereziński P, Matysiak J, Kokot ZJ and Nowak-Markwitz E: Mass spectrometry as a tool for biomarkers searching in gynecological oncology. Biomed Pharmacother. 92:836–842. 2017. View Article : Google Scholar : PubMed/NCBI

3 

Jelovac D and Armstrong DK: Recent progress in the diagnosis and treatment of ovarian cancer. CA Cancer J Clin. 61:183–203. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Armstrong DK, Bundy B, Wenzel L, Huang HQ, Baergen R, Lele S, Copeland LJ, Walker JL and Burger RA: Gynecologic Oncology Group: Intraperitoneal cisplatin and paclitaxel in ovarian cancer. N Engl J Med. 354:34–43. 2006. View Article : Google Scholar : PubMed/NCBI

5 

Zhou YF: High intensity focused ultrasound in clinical tumor ablation. World J Clin Oncol. 2:8–27. 2011. View Article : Google Scholar : PubMed/NCBI

6 

To SKY, Mak ASC, Fung Eva YM, Che CM, Li SS, Deng W, Ru B, Zhang J and Wong AST: β-catenin downregulates Dicer to promote ovarian cancer metastasis. Oncogene. 36:5927–5938. 2017. View Article : Google Scholar : PubMed/NCBI

7 

Mihanfar A, Fattahi A and Nejabati HR: MicroRNA-mediated drug resistance in ovarian cancer. J Cell Physiol. Jun 19–2017.(Epub ahead of print). View Article : Google Scholar : PubMed/NCBI

8 

Kuo YT, Chang TT, Muo CH, Wu MY, Sun MF, Yeh CC and Yen HR: Use of complementary traditional chinese medicines by adult cancer patients in Taiwan: A nationwide population-based study. Integr Cancer Ther. June 1–2017.(Epub ahead of print).

9 

Singh N, Bansal Y, Bhandari R, Marwaha L, Singh R, Chopra K and Kuhad A: Naringin reverses neurobehavioral and biochemical alterations in intracerebroventricular collagenase-induced intracerebral hemorrhage in rats. Pharmacology. 100:172–187. 2017. View Article : Google Scholar : PubMed/NCBI

10 

Chen R, Qi QL, Wang MT and Li QY: Therapeutic potential of naringin: An overview. Pharm Biol. 54:3203–3210. 2016. View Article : Google Scholar : PubMed/NCBI

11 

Jeon SM, Bok SH, Jang MK, Kim YH, Nam KT, Jeong TS, Park YB and Choi MS: Comparison of antioxidant effects of naringin and probucol in cholesterol-fed rabbits. Clin Chim Acta. 317:181–190. 2002. View Article : Google Scholar : PubMed/NCBI

12 

Jagetia GC and Reddy TK: Modulation of radiation-induced alteration in the antioxidant status of mice by naringin. Life Sci. 77:780–794. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Rajadurai M and Stanely Mainzen Prince P: Preventive effect of naringin on lipid peroxides and antioxidants in isoproterenol-induced cardiotoxicity in Wistar rats: Biochemical and histopathological evidences. Toxicology. 228:259–268. 2006. View Article : Google Scholar : PubMed/NCBI

14 

Li W, Wang C, Peng J, Liang J, Jin Y, Liu Q, Meng Q, Liu K and Sun H: Naringin inhibits TNF-α induced oxidative stress and inflammatory response in HUVECs via Nox4/NF-κB and PI3K/Akt pathways. Curr Pharm Biotechnol. 15:1173–1182. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Ramalingayya GV, Nampoothiri M, Nayak PG, Kishore A, Shenoy RR, Rao Mallikarjuna C and Nandakumar K: Naringin and rutin alleviates episodic memory deficits in two differentially challenged object recognition tasks. Pharmacogn Mag. 12 Suppl 1:S63–S70. 2016. View Article : Google Scholar : PubMed/NCBI

16 

Cao X, Lin W, Liang C, Zhang D, Yang F, Zhang Y, Zhang X, Feng J and Chen C: Naringin rescued the TNF-α-induced inhibition of osteogenesis of bone marrow-derived mesenchymal stem cells by depressing the activation of NF-κB signaling pathway. Immunol Res. 62:357–367. 2015. View Article : Google Scholar : PubMed/NCBI

17 

Chang HY and Yang X: Proteases for cell suicide: Functions and regulation of caspases. Microbiol Mol Biol Rev. 64:821–846. 2000. View Article : Google Scholar : PubMed/NCBI

18 

Zhu G, Wang X, Wu S and Li Q: Involvement of activation of PI3K/Akt pathway in the protective effects of puerarin against MPP+-induced human neuroblastoma SH-SY5Y cell death. Neurochem Int. 60:400–408. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Linder M and Tschernig T: Vasculogenic mimicry: Possible role of effector caspase-3, caspase-6 and caspase-7. Ann Anat. 204:114–117. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Médoc M, Dhilly M, Matesic L, Toutain J, Krause-Heuer AM, Delamare J, Fraser BH, Touzani O, Barré L, Greguric I and Sobrio F: In vivo evaluation of radiofluorinated caspase-3/7 inhibitors as radiotracers for apoptosis imaging and comparison with [18F]ML-10 in a stroke model in the rat. Mol Imaging Biol. 18:117–126. 2016. View Article : Google Scholar : PubMed/NCBI

21 

Zolota V, Gerokosta A, Melachrinou M, Kominea A, Aletra C and Scopa CD: Microvessel density, proliferating activity, p53 and bcl-2 expression in in situ ductal carcinoma of the breast. Anticancer Res. 19:3269–3274. 1999.PubMed/NCBI

22 

Takehara T, Liu X, Fujimoto J, Friedman SL and Takahashi H: Expression and role of Bcl-xL in human hepatocellular carcinomas. Hepatology. 34:55–61. 2001. View Article : Google Scholar : PubMed/NCBI

23 

Li Z, Cui J, Yu Q, Wu X, Pan A and Li L: Evaluation of CCND1 amplification and CyclinD1 expression: Diffuse and strong staining of CyclinD1 could have same predictive roles as CCND1 amplification in ER positive breast cancers. Am J Transl Res. 8:142–153. 2016.PubMed/NCBI

24 

Yamamoto K, Lee BJ, Li C, Dubois RL, Hobeika E, Bhagat G and Zha S: Early B-cell-specific inactivation of ATM synergizes with ectopic CyclinD1 expression to promote pre-germinal center B-cell lymphomas in mice. Leukemia. 29:1414–1424. 2015. View Article : Google Scholar : PubMed/NCBI

25 

Kandela I, Jin HY and Owen K: Reproducibility Project: Cancer biology: Registered report: BET bromodomain inhibition as a therapeutic strategy to target c-Myc. Elife. 4:e070722015. View Article : Google Scholar : PubMed/NCBI

26 

Lin CY, Lovén J, Rahl PB, Paranal RM, Burge CB, Bradner JE, Lee TI and Young RA: Transcriptional amplification in tumor cells with elevated c-Myc. Cell. 151:56–67. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Zhang E, Li W, Yin D, De W, Zhu L, Sun S and Han L: c-Myc-regulated long non-coding RNA H19 indicates a poor prognosis and affects cell proliferation in non-small-cell lung cancer. Tumour Biol. 37:4007–4015. 2016. View Article : Google Scholar : PubMed/NCBI

28 

Wu DW, Hsu NY, Wang YC, Lee MC, Cheng YW, Chen CY and Lee H: c-Myc suppresses microRNA-29b to promote tumor aggressiveness and poor outcomes in non-small cell lung cancer by targeting FHIT. Oncogene. 34:2072–2082. 2015. View Article : Google Scholar : PubMed/NCBI

29 

Xia B, Tian C, Guo S, Zhang L, Zhao D, Qu F, Zhao W, Wang Y, Wu X, Da W, et al: c-Myc plays part in drug resistance mediated by bone marrow stromal cells in acute myeloid leukemia. Leuk Res. 39:92–99. 2015. View Article : Google Scholar : PubMed/NCBI

30 

Kato J, Kuwabara Y, Mitani M, Shinoda N, Sato A, Toyama T, Mitsui A, Nishiwaki T, Moriyama S, Kudo J and Fujii Y: Expression of survivin in esophageal cancer: Correlation with the prognosis and response to chemotherapy. Int J Cancer. 95:92–95. 2001. View Article : Google Scholar : PubMed/NCBI

31 

Mitrović Z, Ilić I, Aurer I, Kinda SB, Radman I, Dotlić S, Ajduković R and Labar B: Prognostic significance of survivin and caspase-3 immunohistochemical expression in patients with diffuse large B-cell lymphoma treated with rituximab and CHOP. Pathol Oncol Res. 17:243–247. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Cai L, Wu H, Tu C, Wen X and Zhou B: Naringin inhibits ovarian tumor growth by promoting apoptosis: An in vivo study. Oncol Lett 16: 59-64, 2018.
APA
Cai, L., Wu, H., Tu, C., Wen, X., & Zhou, B. (2018). Naringin inhibits ovarian tumor growth by promoting apoptosis: An in vivo study. Oncology Letters, 16, 59-64. https://doi.org/10.3892/ol.2018.8611
MLA
Cai, L., Wu, H., Tu, C., Wen, X., Zhou, B."Naringin inhibits ovarian tumor growth by promoting apoptosis: An in vivo study". Oncology Letters 16.1 (2018): 59-64.
Chicago
Cai, L., Wu, H., Tu, C., Wen, X., Zhou, B."Naringin inhibits ovarian tumor growth by promoting apoptosis: An in vivo study". Oncology Letters 16, no. 1 (2018): 59-64. https://doi.org/10.3892/ol.2018.8611
Copy and paste a formatted citation
x
Spandidos Publications style
Cai L, Wu H, Tu C, Wen X and Zhou B: Naringin inhibits ovarian tumor growth by promoting apoptosis: An in vivo study. Oncol Lett 16: 59-64, 2018.
APA
Cai, L., Wu, H., Tu, C., Wen, X., & Zhou, B. (2018). Naringin inhibits ovarian tumor growth by promoting apoptosis: An in vivo study. Oncology Letters, 16, 59-64. https://doi.org/10.3892/ol.2018.8611
MLA
Cai, L., Wu, H., Tu, C., Wen, X., Zhou, B."Naringin inhibits ovarian tumor growth by promoting apoptosis: An in vivo study". Oncology Letters 16.1 (2018): 59-64.
Chicago
Cai, L., Wu, H., Tu, C., Wen, X., Zhou, B."Naringin inhibits ovarian tumor growth by promoting apoptosis: An in vivo study". Oncology Letters 16, no. 1 (2018): 59-64. https://doi.org/10.3892/ol.2018.8611
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team